Search Results

Search found 4670 results on 187 pages for 'jvm arguments'.

Page 163/187 | < Previous Page | 159 160 161 162 163 164 165 166 167 168 169 170  | Next Page >

  • Method not being resolved for dynamic generic type

    - by kelloti
    I have these types: public class GenericDao<T> { public T Save(T t) { return t; } } public abstract class DomainObject { // Some properties protected abstract dynamic Dao { get; } public virtual void Save() { var dao = Dao; dao.Save(this); } } public class Attachment : DomainObject { protected dynamic Dao { get { return new GenericDao<Attachment>(); } } } Then when I run this code it fails with RuntimeBinderException: Best overloaded method match for 'GenericDAO<Attachment.Save(Attachment)' has some invalid arguments var obj = new Attachment() { /* set properties */ }; obj.Save(); I've verified that in DomainObject.Save() "this" is definitely Attachment, so the error doesn't really make sense. Can anyone shed some light on why the method isn't resolving? Some more information - It succeeds if I change the contents of DomainObject.Save() to use reflection: public virtual void Save() { var dao = Dao; var type = dao.GetType(); var save = ((Type)type).GetMethod("Save"); save.Invoke(dao, new []{this}); }

    Read the article

  • Oracle User definied aggregate function for varray of varchar

    - by baju
    I am trying to write some aggregate function for the varray and I get this error code when I'm trying to use it with data from the DB: ORA-00600 internal error code, arguments: [kodpunp1], [], [], [], [], [], [], [], [], [], [], [] [koxsihread1], [0], [3989], [45778], [], [], [], [], [], [], [], [] Code of the function is really simple(in fact it does nothing ): create or replace TYPE "TEST_VECTOR" as varray(10) of varchar(20) ALTER TYPE "TEST_VECTOR" MODIFY LIMIT 4000 CASCADE create or replace type Test as object( lastVector TEST_VECTOR, STATIC FUNCTION ODCIAggregateInitialize(sctx in out Test) return number, MEMBER FUNCTION ODCIAggregateIterate(self in out Test, value in TEST_VECTOR) return number, MEMBER FUNCTION ODCIAggregateMerge(self IN OUT Test, ctx2 IN Test) return number, MEMBER FUNCTION ODCIAggregateTerminate(self IN Test, returnValue OUT TEST_VECTOR, flags IN number) return number ); create or replace type body Test is STATIC FUNCTION ODCIAggregateInitialize(sctx in out Test) return number is begin sctx := Test(TEST_VECTOR()); return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateIterate(self in out Test, value in TEST_VECTOR) return number is begin self.lastVector := value; return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateMerge(self IN OUT Test, ctx2 IN Test) return number is begin return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateTerminate(self IN Test, returnValue OUT TEST_VECTOR, flags IN number) return number is begin returnValue := self.lastVector; return ODCIConst.Success; end; end; create or replace FUNCTION test_fn (input TEST_VECTOR) RETURN TEST_VECTOR PARALLEL_ENABLE AGGREGATE USING Test; Next I create some test data: create table t1_test_table( t1_id number not null, t1_value TEST_VECTOR not null, Constraint PRIMARY_KEY_1 PRIMARY KEY (t1_id) ) Next step is to put some data to the table insert into t1_test_table (t1_id,t1_value) values (1,TEST_VECTOR('x','y','z')) Now everything is prepared to perform queries: Select test_fn(TEST_VECTOR('y','x')) from dual Query above work well Select test_fn(t1_value) from t1_test_table where t1_id = 1 Version of Oracle DBMS I use: 11.2.0.3.0 Does anyone tried do such a thing? What can be the reason that it does not work? How to solve it? Thanks in advance for help.

    Read the article

  • Slightly different execution times between python2 and python3

    - by user557634
    Hi. Lastly I wrote a simple generator of permutations in python (implementation of "plain changes" algorithm described by Knuth in "The Art... 4"). I was curious about the differences in execution time of it between python2 and python3. Here is my function: def perms(s): s = tuple(s) N = len(s) if N <= 1: yield s[:] raise StopIteration() for x in perms(s[1:]): for i in range(0,N): yield x[:i] + (s[0],) + x[i:] I tested both using timeit module. My tests: $ echo "python2.6:" && ./testing.py && echo "python3:" && ./testing3.py python2.6: args time[ms] 1 0.003811 2 0.008268 3 0.015907 4 0.042646 5 0.166755 6 0.908796 7 6.117996 8 48.346996 9 433.928967 10 4379.904032 python3: args time[ms] 1 0.00246778964996 2 0.00656183719635 3 0.01419159912 4 0.0406293644678 5 0.165960511097 6 0.923101452814 7 6.24257639835 8 53.0099868774 9 454.540967941 10 4585.83498001 As you can see, for number of arguments less than 6, python 3 is faster, but then roles are reversed and python2.6 does better. As I am a novice in python programming, I wonder why is that so? Or maybe my script is more optimized for python2? Thank you in advance for kind answer :)

    Read the article

  • Generic Class Vb.net

    - by KoolKabin
    hi guys, I am stuck with a problem about generic classes. I am confused how I call the constructor with parameters. My interface: Public Interface IDBObject Sub [Get](ByRef DataRow As DataRow) Property UIN() As Integer End Interface My Child Class: Public Class User Implements IDBObject Public Sub [Get](ByRef DataRow As System.Data.DataRow) Implements IDBObject.Get End Sub Public Property UIN() As Integer Implements IDBObject.UIN Get End Get Set(ByVal value As Integer) End Set End Property End Class My Next Class: Public Class Users Inherits DBLayer(Of User) #Region " Standard Methods " #End Region End Class My DBObject Class: Public Class DBLayer(Of DBObject As {New, IDBObject}) Public Shared Function GetData() As List(Of DBObject) Dim QueryString As String = "SELECT * ***;" Dim Dataset As DataSet = New DataSet() Dim DataList As List(Of DBObject) = New List(Of DBObject) Try Dataset = Query(QueryString) For Each DataRow As DataRow In Dataset.Tables(0).Rows **DataList.Add(New DBObject(DataRow))** Next Catch ex As Exception DataList = Nothing End Try Return DataList End Function End Class I get error in the starred area of the DBLayer Object. What might be the possible reason? what can I do to fix it? I even want to add New(byval someval as datatype) in IDBObject interface for overloading construction. but it also gives an error? how can i do it? Adding Sub New(ByVal DataRow As DataRow) in IDBObject producess following error 'Sub New' cannot be declared in an interface. Error Produced in DBLayer Object line: DataList.Add(New DBObject(DataRow)) Msg: Arguments cannot be passed to a 'New' used on a type parameter.

    Read the article

  • Learn Prolog Now! DCG Practice Example

    - by Timothy
    I have been progressing through Learn Prolog Now! as self-study and am now learning about Definite Clause Grammars. I am having some difficulty with one of the Practical Session's tasks. The task reads: The formal language anb2mc2mdn consists of all strings of the following form: an unbroken block of as followed by an unbroken block of bs followed by an unbroken block of cs followed by an unbroken block of ds, such that the a and d blocks are exactly the same length, and the c and d blocks are also exactly the same length and furthermore consist of an even number of cs and ds respectively. For example, ε, abbccd, and aaabbbbccccddd all belong to anb2mc2mdn. Write a DCG that generates this language. I am able to write rules that generate andn, b2mc2m, and even anb2m and c2mndn... but I can't seem to join all these rules into anb2mc2mdn. The following are my rules that can generate andn and b2mc2m. s1 --> []. s1 --> a,s1,d. a --> [a]. d --> [d]. s2 --> []. s2 --> c,c,s2,d,d. c --> [c]. d --> [d]. Is anb2mc2mdn really a CFG, and is it possible to write a DCG using only what was taught in the lesson (no additional arguments or code, etc)? If so, can anyone offer me some guidance how I can join these so that I can solve the given task?

    Read the article

  • Haskell Cons Operator (:)

    - by Carson Myers
    I am really new to Haskell (Actually I saw "Real World Haskell" from O'Reilly and thought "hmm, I think I'll learn functional programming" yesterday) and I am wondering: I can use the construct operator to add an item to the beginning of a list: 1 : [2,3] [1,2,3] I tried making an example data type I found in the book and then playing with it: --in a file data BillingInfo = CreditCard Int String String | CashOnDelivery | Invoice Int deriving (Show) --in ghci $ let order_list = [Invoice 2345] $ order_list [Invoice 2345] $ let order_list = CashOnDelivery : order_list $ order_list [CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, CashOnDelivery, ...- etc... it just repeats forever, is this because it uses lazy evaluation? -- EDIT -- okay, so it is being pounded into my head that let order_list = CashOnDelivery:order_list doesn't add CashOnDelivery to the original order_list and then set the result to order_list, but instead is recursive and creates an infinite list, forever adding CashOnDelivery to the beginning of itself. Of course now I remember that Haskell is a functional language and I can't change the value of the original order_list, so what should I do for a simple "tack this on to the end (or beginning, whatever) of this list?" Make a function which takes a list and BillingInfo as arguments, and then return a list? -- EDIT 2 -- well, based on all the answers I'm getting and the lack of being able to pass an object by reference and mutate variables (such as I'm used to)... I think that I have just asked this question prematurely and that I really need to delve further into the functional paradigm before I can expect to really understand the answers to my questions... I guess what i was looking for was how to write a function or something, taking a list and an item, and returning a list under the same name so the function could be called more than once, without changing the name every time (as if it was actually a program which would add actual orders to an order list, and the user wouldn't have to think of a new name for the list each time, but rather append an item to the same list).

    Read the article

  • Breaking dependencies when you can't make changes to other files?

    - by codemuncher
    I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

    Read the article

  • Are there equivalents to Ruby's method_missing in other languages?

    - by Justin Ethier
    In Ruby, objects have a handy method called method_missing which allows one to handle method calls for methods that have not even been (explicitly) defined: Invoked by Ruby when obj is sent a message it cannot handle. symbol is the symbol for the method called, and args are any arguments that were passed to it. By default, the interpreter raises an error when this method is called. However, it is possible to override the method to provide more dynamic behavior. The example below creates a class Roman, which responds to methods with names consisting of roman numerals, returning the corresponding integer values. class Roman def romanToInt(str) # ... end def method_missing(methId) str = methId.id2name romanToInt(str) end end r = Roman.new r.iv #=> 4 r.xxiii #=> 23 r.mm #=> 2000 For example, Ruby on Rails uses this to allow calls to methods such as find_by_my_column_name. My question is, what other languages support an equivalent to method_missing, and how do you implement the equivalent in your code?

    Read the article

  • Convincing why testing is good

    - by FireAphis
    Hello, In my team of real-time-embedded C/C++ developers, most people don't have any culture of testing their code beyond the casual manual sanity checks. I personally strongly believe in advantages of autonomous automatic tests, but when I try to convince I get some reappearing arguments like: We will spend more time on writing the tests than writing the code. It takes a lot of effort to maintain the tests. Our code is spaghetti; no way we can unit-test it. Our requirement are not sealed – we’ll have to rewrite all the tests every time the requirements are changed. Now, I'd gladly hear any convincing tips and advises, but what I am really looking for are references to researches, articles, books or serious surveys that show (preferably in numbers) how testing is worth the effort. Something like "We in IBM/Microsoft/Google, surveying 3475 active projects, found out that putting 50% more development time into testing decreased by 75% the time spent on fixing bugs" or "after half a year, the time needed to write code with test was only marginally longer than what used to take without tests". Any ideas? P.S.: I'm adding C++ tag too in case someone has a specific experience with convincing this, usually elitist, type of developers :-)

    Read the article

  • Memory management of objects returned by methods (iOS / Objective-C)

    - by iOSNewb
    I am learning Objective-C and iOS programming through the terrific iTunesU course posted by Stanford (http://www.stanford.edu/class/cs193p/cgi-bin/drupal/) Assignment 2 is to create a calculator with variable buttons. The chain of commands (e.g. 3+x-y) is stored in a NSMutableArray as "anExpression", and then we sub in random values for x and y based on an NSDictionary to get a solution. This part of the assignment is tripping me up: The final two [methods] “convert” anExpression to/from a property list: + (id)propertyListForExpression:(id)anExpression; + (id)expressionForPropertyList:(id)propertyList; You’ll remember from lecture that a property list is just any combination of NSArray, NSDictionary, NSString, NSNumber, etc., so why do we even need this method since anExpression is already a property list? (Since the expressions we build are NSMutableArrays that contain only NSString and NSNumber objects, they are, indeed, already property lists.) Well, because the caller of our API has no idea that anExpression is a property list. That’s an internal implementation detail we have chosen not to expose to callers. Even so, you may think, the implementation of these two methods is easy because anExpression is already a property list so we can just return the argument right back, right? Well, yes and no. The memory management on this one is a bit tricky. We’ll leave it up to you to figure out. Give it your best shot. Obviously, I am missing something with respect to memory management because I don't see why I can't just return the passed arguments right back. Thanks in advance for any answers!

    Read the article

  • Encode_JSON Errors in Lasso 8.6.2 After Period of Time

    - by ATP_JD
    We are in the process of converting apps from Lasso 8 to Lasso 9, and as an intermediate step, have upgraded from 8.5.5 to 8.6.2 (which runs alongside 9 on our new box, in different virtual hosts). I am finding that with 8.6.2 we are getting a slew of errors on pages that call encode_json. The weird thing with these errors is that they don't start happening until some period of time after the site starts. Then, some hours later, all encode_json calls begin to fail with error messages like this: An error occurred while processing your request. Error Information Error Message: No tag, type or constant was defined under the name "?????????????????" with arguments: array: (pair: (-find)=([\x{0020}-\x{21}\x{23}-\x{5b}\x{5d}-\x{10fff}])), (r) at: onCompare with params: 'r' at: JSON with params: 'reload', -Options=array: (-Internal) at: JSON with params: @map: (reload)=(false), (tcstring)=(LZU), (timestring)=(10:42 AM&nbsp;&nbsp;&nbsp;1442Z) at: [...].lasso with params: 'pageloadtime'='1383038310' on line: 31 at position: 1 Error Code: -9948 (Yes, those Chinese(?) characters are in the error message.) I have removed the 8.5.5 encode_json tag from LassoStartup, so we are using the correct built-in method. The encode_json method fails for any and all parameters I throw at it from simple strings to arrays of maps. Upon restarting the site, encode_json resumes working for an hour or two, seemingly depending on load. On 8.5.5, we don't have this problem. Does anyone have experience with this issue? Any advice regarding trying the 8.5.5 tag swap encode_json to see if I can override the built-in method? Maybe it will work better? Thanks in advance for your time and assistance. -Justin

    Read the article

  • Being pressured to GOTO the dark-side

    - by Dan McG
    We have a situation at work where developers working on a legacy (core) system are being pressured into using GOTO statements when adding new features into existing code that is already infected with spagetti code. Now, I understand there may be arguments for using 'just one little GOTO' instead of spending the time on refactoring to a more maintainable solution. The issue is, this isolated 'just one little GOTO' isn't so isolated. At least once every week or so there is a new 'one little GOTO' to add. This codebase is already a horror to work with due to code dating back to or before 1984 being riddled with GOTOs that would make many Pastafarians believe it was inspired by the Flying Spagetti Monster itself. Unfortunately the language this is written in doesn't have any ready made refactoring tools, so it makes it harder to push the 'Refactor to increase productivity later' because short-term wins are the only wins paid attention to here... Has anyone else experienced this issue whereby everybody agrees that we cannot be adding new GOTOs to jump 2000 lines to a random section, but continually have Anaylsts insist on doing it just this one time and having management approve it? tldr; How can one go about addressing the issue of developers being pressured (forced) to continually add GOTO statements (by add, I mean add to jump to random sections many lines away) because it 'gets that feature in quicker'? I'm beginning to fear we may loses valuable developers to the raptors over this...

    Read the article

  • How can I build a generic dataset-handling Perl library?

    - by Pep.
    Hello, I want to build a generic Perl module for handling and analysing biomedical character separated datasets and which can, most certain, be used on any kind of datasets that contain a mixture of categorical (A,B,C,..) and continuous (1.2,3,881..) and identifier (XXX1,XXX2...). The plan is to have people initialize the module and then use some arguments to point to the data file(s), the place were the analysis reports should be placed and the structure of the data. By structure of data I mean which variable is in which place and its name/type. And this is where I need some enlightenment. I am baffled how to do this in a clean way. Obviously, having people create a simple schema file, be it XML or some other format would be the cleanest but maybe not all people enjoy doing something like this. The solutions I can think of are: Create a configuration file in XML or similar and with a prespecified format. Pass the information during initialization of the module. Use the first row of the data as headers and try to guess types (ouch) Surely there must be a "canonical" way of doing this that is also usable and efficient. Thanks p.

    Read the article

  • Vectorize matrix operation in R

    - by Fernando
    I have a R x C matrix filled to the k-th row and empty below this row. What i need to do is to fill the remaining rows. In order to do this, i have a function that takes 2 entire rows as arguments, do some calculations and output 2 fresh rows (these outputs will fill the matrix). I have a list of all 'pairs' of rows to be processed, but my for loop is not helping performance: # M is the matrix # nrow(M) and k are even, so nLeft is even M = matrix(1:48, ncol = 3) # half to fill k = nrow(M)/2 # simulate empty rows to be filled M[-(1:k), ] = 0 cat('before fill') print(M) # number of empty rows to fill nLeft = nrow(M) - k nextRow = k + 1 # list of rows to process (could be any order of non-empty rows) idxList = matrix(1:k, ncol = 2) for ( i in 1 : (nLeft / 2)) { row1 = M[idxList[i, 1],] row2 = M[idxList[i, 2],] # the two columns in 'results' will become 2 rows in M # fake result, return 2*row1 and 3*row2 results = matrix(c(2*row1, 3*row2), ncol = 2) # fill the matrix M[nextRow, ] = results[, 1] nextRow = nextRow + 1 M[nextRow, ] = results[, 2] nextRow = nextRow + 1 } cat('after fill') print(M) I tried to vectorize this, but failed... appreciate any help on improving this code, thanks!

    Read the article

  • Mulltiple configurations in Qt

    - by user360607
    Hi all! I'm new to Qt Creator and I have several questions regarding multiple build configurations. A side note: I have the QtCreator 1.3.1 installed on my Linux machine. I need to have two configurations in my Qt Creator project. The thing is that these aren't simply debug and release but are based on the target architecture - x86 or x64. I came across http://stackoverflow.com/questions/2259192/building-multiple-targets-in-qt-qmake and from that I went trying something like: Conf_x86 { TARGET = MyApp_x86 } Conf_x64 { TARGET = MyApp_x64 } This way however I don't seems to be able to use the Qt Creator IDE to build each of these separately (Build All, Rebuild All, etc. options from the IDE menu). Is there a way to achieve this - may be even show Conf_x86 and Conf_x64 as new build configurations in Qt Creator? One other thing the Qt I have is 64 bit so by default the target built using Qt Creator IDE will also be 64 bit. I noticed that the effective qmake call in the build step includes the following option '-spec linux-g++-64'. I also noticed that should I add '-spec linux-g++-32' in 'Additional arguments' it would override '-spec linux-g++-64' and the resulting target will be 32 bit. How can I achieve this by simply editing the contents of the .pro file? I saw that all these changes are initially saved in the .pro.user file but does doesn't suit me at all. I need to be able to make these configurations from the .pro file if possible. Any help will be appreciated. 10x in advance!

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • Refining Search Results [PHP/MySQL]

    - by Dae
    I'm creating a set of search panes that allow users to tweak their results set after submitting a query. We pull commonly occurring values in certain fields from the results and display them in order of their popularity - you've all seen this sort of thing on eBay. So, if a lot of rows in our results were created in 2009, we'll be able to click "2009" and see only rows created in that year. What in your opinion is the most efficient way of applying these filters? My working solution was to discard entries from the results that didn't match the extra arguments, like: while($row = mysql_fetch_assoc($query)) { foreach($_GET as $key => $val) { if($val !== $row[$key]) { continue 2; } } // Output... } This method should hopefully only query the database once in effect, as adding filters doesn't change the query - MySQL can cache and reuse one data set. On the downside it makes pagination a bit of a headache. The obvious alternative would be to build any additional criteria into the initial query, something like: $sql = "SELECT * FROM tbl MATCH (title, description) AGAINST ('$search_term')"; foreach($_GET as $key => $var) { $sql .= " AND ".$key." = ".$var; } Are there good reasons to do this instead? Or are there better options altogether? Maybe a temporary table? Any thoughts much appreciated!

    Read the article

  • recvfrom returns invalid argument when *from* is passed

    - by Aditya Sehgal
    I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

    Read the article

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • Adding text read from a file to an array list in java

    - by user1824856
    I am having trouble putting text read from a file into an array list. My text looks like this: 438;MIA;JFK;10:55;1092;447 638;JFK;MIA;19:45;1092;447 689;ATL;DFW;12:50;732;448 etc... My code looks like this: package filesexample; import java.io.*; import java.io.FileNotFoundException; import java.util.Scanner; import java.util.ArrayList; /** * * @author */ public class FilesExample { /** * @param args the command line arguments */ public static void main(String[] args) throws IOException { File file = new File ("/Schedule.txt"); try { Scanner scanner= new Scanner(file);; while (scanner.hasNextLine()) { String line = scanner.nextLine(); Scanner lineScanner= new Scanner(line); lineScanner.useDelimiter(";"); while(lineScanner.hasNext()){ String part = lineScanner.next(); System.out.print(part + " "); } System.out.println(); } }catch (FileNotFoundException e){ e.printStackTrace(); } } } Some help on getting started would be much appreciated thank you!

    Read the article

< Previous Page | 159 160 161 162 163 164 165 166 167 168 169 170  | Next Page >