Search Results

Search found 18489 results on 740 pages for 'key'.

Page 166/740 | < Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

  • Disable Internet Explorer 8 Developer Tools

    - by Steve Brouillard
    Is there a way to either disable Internet Explorer 8 Developer Tools, or at least change the shortcut key mapping? I'm working on an ASP.NET AJAX app that has used the F12 key for a function for years (it's actually a hold over from the original DOS app). Customers have used this key for the sam function for nearly 15 years and we'd really like to avoid having to move that function. Cheers

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • NSFetchedResultsController sections localized sorted

    - by Gerd
    How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

    Read the article

  • Trying to work with a multi-value array in LotusScript and sort of stuck

    - by rrumaner
    I have to find a way to store a series of variables - MonthYear (the key) and a counter. The purpose of this is to track the number of documents processed by Month & Year. I was thinking of a list but I am not sure how to save the data so that it is readable and able to be shown in a table at a later date. I thought about using a multi-dimensional array - someArray(1,0 to 1) and ReDim'ing it each time I start a new MonthYear and then save it back to a field on the document but am not sure how that is going to play out. Does anyone have an idea of how I can accomplish this? The first dimension will be the MonthYear (key) and the second will be a counter that is updated every time a new document is processed. The key will be based on a field on the document being processed. How can I make sure I am updating the right key/counter combination? How can I retrieve the existing counter from the field on the document, update the counter and then replace the value? I thought about just adding a new element (ReDim) every time a document is processed and than somehow adding up all the counters for each key and storing that in an array, but that just seems real messy. There has to be a good way to do this. Any and all ideas will be greatly appreciated

    Read the article

  • Does my Dictionary must use locking mechanism?

    - by theateist
    Many threads have access to summary. Each thread will have an unique key for accessing the dictionary; Dictionary<string, List<Result>> summary; Do I need locking for following operations? summary[key] = new List<Result>() summary[key].Add(new Result()); It seems that I don't need locking because each thread will access dictionary with different key, but won't the (1) be problematic because of adding concurrently new record to dictionary with other treads?

    Read the article

  • WinForms: How to prevent textbox from opening alt menu?

    - by Digiku
    I have this textbox I use to capture keyboard shortcuts for a preferences config. I use a low-level keyboard hook to capture keys and also prevent them from taking action, e.g. the Windows key, but the Alt key still comes through and makes my textbox lose focus. How can I block the Alt key, so the focus is kept unaltered at my textbox?

    Read the article

  • C# Tupel group limitation

    - by user609511
    How can i controll the loop of Tupel Repeatation ? Someone has give me a hint about my algorithm. I modified a little bit his algorithm. int LimCol = Convert.ToInt32(LimitColis); result = oListTUP .GroupBy(x => x.Item1) .Select(g => new { Key = g.Key, Sum = g.Sum(x => x.Item2), Poids = g.Sum(x => x.Item3), }) .Select(p => new { Key = p.Key, Items = Enumerable.Repeat(LimCol , p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, 1)), CalculPoids = p.Poids / (Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, 1))).Count() }) .SelectMany(p => p.Items.Select(i => Tuple.Create(p.Key, i, p.CalculPoids))) .ToList(); foreach (var oItem in result) { Label1.Text += oItem.Item1 + "--" + oItem.Item2 + "--" + oItem.Item3 + "<br>"; } the result with LimCol = 3 as you can see i colored with red is the problem. i expected: 0452632--3--3,75 0452632--3--3,75 0452632--3--3,75 0452632--3--3,75 essai 49--3--79,00 essai 49--2--79,00 Thanks you in advance

    Read the article

  • Database Modelling - Conceptually different entities but with near identical fields

    - by Andrew Shepherd
    Suppose you have two sets of conceptual entities: MarketPriceDataSet which has multiple ForwardPriceEntries PoolPriceForecastDataSet which has multiple PoolPriceForecastEntry Both different child objects have near identical fields: ForwardPriceEntry has MarketPriceDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForwardPrice PoolPriceForecastEntry has PoolPriceForecastDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForecastPoolPrice If I modelled them as separate tables, the only difference would be the foreign key, and the name of the price field. There has been a debate as to whether the two near identical tables should be merged into one. Options I've thought of to model this is: Just keep them as two independent, separate tables Have both sets in the one table with an additional "type" field, and a parent_id equalling a foreign key to either parent table. This would sacrifice referential integrity checks. Have both sets in the one table with an additional "type" field, and create a complicated sequence of joining tables to maintain referential integrity. What do you think I should do, and why?

    Read the article

  • FluentNHibernate mapping of composite foreign keys

    - by Faron
    I have an existing database schema and wish to replace the custom data access code with Fluent.NHibernate. The database schema cannot be changed since it already exists in a shipping product. And it is preferable if the domain objects did not change or only changed minimally. I am having trouble mapping one unusual schema construct illustrated with the following table structure: CREATE TABLE [Container] ( [ContainerId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Container] PRIMARY KEY ( [ContainerId] ASC ) ) CREATE TABLE [Item] ( [ItemId] [uniqueidentifier] NOT NULL, [ContainerId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Item] PRIMARY KEY ( [ContainerId] ASC, [ItemId] ASC ) ) CREATE TABLE [Property] ( [ContainerId] [uniqueidentifier] NOT NULL, [PropertyId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Property] PRIMARY KEY ( [ContainerId] ASC, [PropertyId] ASC ) ) CREATE TABLE [Item_Property] ( [ContainerId] [uniqueidentifier] NOT NULL, [ItemId] [uniqueidentifier] NOT NULL, [PropertyId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Item_Property] PRIMARY KEY ( [ContainerId] ASC, [ItemId] ASC, [PropertyId] ASC ) ) CREATE TABLE [Container_Property] ( [ContainerId] [uniqueidentifier] NOT NULL, [PropertyId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Container_Property] PRIMARY KEY ( [ContainerId] ASC, [PropertyId] ASC ) ) The existing domain model has the following class structure: The Property class contains other members representing the property's name and value. The ContainerProperty and ItemProperty classes have no additional members. They exist only to identify the owner of the Property. The Container and Item classes have methods that return collections of ContainerProperty and ItemProperty respectively. Additionally, the Container class has a method that returns a collection of all of the Property objects in the object graph. My best guess is that this was either a convenience method or a legacy method that was never removed. The business logic mainly works with Item (as the aggregate root) and only works with a Container when adding or removing Items. I have tried several techniques for mapping this but none work so I won't include them here unless someone asks for them. How would you map this?

    Read the article

  • DataGridView Cell Validating only when 'Enter' is pressed

    - by Eldad
    Hi, I want to validate and commit the value entered in the DataGridViewCell ONLY when the user presses the 'Enter' key. If the users presses any other key or mouse button (Arrow keys, Pressing a different cell using the mouse...), I want the behavior to be similar to the 'ESC' key: Move the focus to the new cell and revert the edited cell value to its previous value.

    Read the article

  • Advice Please: SQL Server Identity vs Unique Identifier keys when using Entity Framework

    - by c.batt
    I'm in the process of designing a fairly complex system. One of our primary concerns is supporting SQL Server peer-to-peer replication. The idea is to support several geographically separated nodes. A secondary concern has been using a modern ORM in the middle tier. Our first choice has always been Entity Framework, mainly because the developers like to work with it. (They love the LiNQ support.) So here's the problem: With peer-to-peer replication in mind, I settled on using uniqueidentifier with a default value of newsequentialid() for the primary key of every table. This seemed to provide a good balance between avoiding key collisions and reducing index fragmentation. However, it turns out that the current version of Entity Framework has a very strange limitation: if an entity's key column is a uniqueidentifier (GUID) then it cannot be configured to use the default value (newsequentialid()) provided by the database. The application layer must generate the GUID and populate the key value. So here's the debate: abandon Entity Framework and use another ORM: use NHibernate and give up LiNQ support use linq2sql and give up future support (not to mention get bound to SQL Server on DB) abandon GUIDs and go with another PK strategy devise a method to generate sequential GUIDs (COMBs?) at the application layer I'm leaning towards option 1 with linq2sql (my developers really like linq2[stuff]) and 3. That's mainly because I'm somewhat ignorant of alternate key strategies that support the replication scheme we're aiming for while also keeping things sane from a developer's perspective. Any insight or opinion would be greatly appreciated.

    Read the article

  • How do i add a new object with suds?

    - by Jerome
    I'm trying to use suds but have so far been unsuccessful at figuring this out. Hopefully it's something simple that i'm missing. Any help would be highly appreciated. This is supposed to be the raw soap message that i need to achieve: <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:api="http://api.service.apimember.soapservice.com/"> <soapenv:Header/> <soapenv:Body> <api:insertOrUpdateMemberByObj> <token>t67GFCygjhkjyUy8y9hkjhlkjhuii</token> <member> <dynContent> <entry> <key>FIRSTNAME</key> <value>hhhhbbbbb</value> </entry> </dynContent> <email>[email protected]</email> </member> </api:insertOrUpdateMemberByObj> </soapenv:Body> </soapenv:Envelope> So i use suds to create the member object: member = client.factory.create('member') produces: (apiMember){ attributes = (attributes){ entry[] = <empty> } } How exactly do i append an 'entry'? I try this: member.attributes.entry.append({'key':'FIRSTNAME','value':'test'}) and that produces this: (apiMember){ attributes = (attributes){ entry[] = { value = "test" key = "FIRSTNAME" }, } } However, what i actually need is: (apiMember){ attributes = (attributes){ entry[] = (entry) { value = "test" key = "FIRSTNAME" }, } } How do i achieve this?

    Read the article

  • Share java object between two forms using Spring IoC

    - by Vladimir
    I want to share java object between two forms using Spring IoC. It should acts like Registry: Registry.set("key", new Object()); // ... Object o = Registry.get("key"); // ... Registry.set("key", new AnotherObject()); // rewrite old object I tried this code to register bean at runtime: applicationContext.getBeanFactory().registerSingleton("key", object); but it does not allow to rewrite existing object (result code for checking and deleting existing bean is too complicated)... PS I am Java newbie, so mb I am doing it wrong and I should not use IoC at all... any help is appreciated...

    Read the article

  • I made a horrible loop.... help fix my logic please

    - by Webnet
    I know I'm doing this a bad way... but I'm having trouble seeing any alternatives. I have an array of products that I need to select 4 of randomly. $rawUpsellList is an array of all of the possible upsells based off of the items in their cart. Each value is a product object. I know this is horribly ugly code but I don't see an alternative now.... someone please put me out of my misery so this code doesn't make it to production..... $rawUpsellList = array(); foreach ($tru->global->cart->getItemList() as $item) { $product = $item->getProduct(); $rawUpsellList = array_merge($rawUpsellList, $product->getUpsellList()); } $upsellCount = count($rawUpsellList); $showItems = 4; if ($upsellCount < $showItems) { $showItems = $upsellCount; } $maxLoop = 20; $upsellList = array(); for ($x = 0; $x <= $showItems; $x++) { $key = rand(0, $upsellCount); if (!array_key_exists($key, $upsellList) && is_object($rawUpsellList[$key])) { $upsellList[$key] = $rawUpsellList[$key]; $x++; } if ($x == $maxLoop) { break; } } Posting this code was highly embarassing...

    Read the article

  • How do I get query string value from script path?

    - by TruMan1
    I am adding my Javsacript file in pages with different query strings in the script path like this: Page1: <script type="text/javascript" src="file.js?abc=123"></script> Page2: <script type="text/javascript" src="file.js?abc=456"></script> Page3: <script type="text/javascript" src="file.js?abc=789"></script> In my Javascript file, how can I get the value of the "abc" param? I tried using window.location for this, but that does not work. In case it helps, below is a function I use to find the value of a query string param: function getQuerystring(key, defaultValue) { if (defaultValue == null) defaultValue = ""; key = key.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regex = new RegExp("[\\?&]" + key + "=([^&#]*)"); var qs = regex.exec(window.location.href); if (qs == null) return defaultValue; else return qs[1]; }

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • MySQL access classes in PHP

    - by Mike
    I have a connection class for MySQL that looks like this: class MySQLConnect { private $connection; private static $instances = 0; function __construct() { if(MySQLConnect::$instances == 0) { //Connect to MySQL server $this->connection = mysql_connect(MySQLConfig::HOST, MySQLConfig::USER, MySQLConfig::PASS) or die("Error: Unable to connect to the MySQL Server."); MySQLConnect::$instances = 1; } else { $msg = "Close the existing instance of the MySQLConnector class."; die($msg); } } public function singleQuery($query, $databasename) { mysql_select_db(MySQLConfig::DB, $this->connection) or die("Error: Could not select database " . MySQLConfig::DB . " from the server."); $result = mysql_query($query) or die('Query failed.'); return $result; } public function createResultSet($query, $databasename) { $rs = new MySQLResultSet($query, MySQLConfig::DB, $this->connection ) ; return $rs; } public function close() { MySQLConnect::$instances = 0; if(isset($this->connection) ) { mysql_close($this->connection) ; unset($this->connection) ; } } public function __destruct() { $this->close(); } } The MySQLResultSet class looks like this: class MySQLResultSet implements Iterator { private $query; private $databasename; private $connection; private $result; private $currentRow; private $key = 0; private $valid; public function __construct($query, $databasename, $connection) { $this->query = $query; //Select the database $selectedDatabase = mysql_select_db($databasename, $connection) or die("Error: Could not select database " . $this->dbname . " from the server."); $this->result = mysql_query($this->query) or die('Query failed.'); $this->rewind(); } public function getResult() { return $this->result; } // public function getRow() // { // return mysql_fetch_row($this->result); // } public function getNumberRows() { return mysql_num_rows($this->result); } //current() returns the current row public function current() { return $this->currentRow; } //key() returns the current index public function key() { return $this->key; } //next() moves forward one index public function next() { if($this->currentRow = mysql_fetch_array($this->result) ) { $this->valid = true; $this->key++; }else{ $this->valid = false; } } //rewind() moves to the starting index public function rewind() { $this->key = 0; if(mysql_num_rows($this->result) > 0) { if(mysql_data_seek($this->result, 0) ) { $this->valid = true; $this->key = 0; $this->currentRow = mysql_fetch_array($this->result); } } else { $this->valid = false; } } //valid returns 1 if the current position is a valid array index //and 0 if it is not valid public function valid() { return $this->valid; } } The following class is an example of how I am accessing the database: class ImageCount { public function getCount() { $mysqlConnector = new MySQLConnect(); $query = "SELECT * FROM images;"; $resultSet = $mysqlConnector->createResultSet($query, MySQLConfig::DB); $mysqlConnector->close(); return $resultSet->getNumberRows(); } } I use the ImageCount class like this: if(!ImageCount::getCount()) { //Do something } Question: Is this an okay way to access the database? Could anybody recommend an alternative method if it is bad? Thank-you.

    Read the article

  • Best way to model map values in Grails?

    - by Mulone
    Hi guys, I have to implement map values in my Grails app. I have a class that can contain 0..N OsmTags, and the key is unique. In Java I would model this with a Map in each object, but I don't know how to map classes in Grails. So I defined this class: class OsmTag { /** OSM tag name, e.g. natural */ String key /** OSM tag value, e.g. park */ String value static constraints = { key blank:false, size:2..80,matches:/[\S]+/, unique:false value blank:false, size:1..250,matches:/[\S]+/, unique:false } } That works ok, but it's actually quite ugly because the tag key is not unique. Is there a better way to model this issue? Cheers

    Read the article

  • Why i am getting NullPointerException for this btree method??

    - by user306540
    hi, i am writing code for btree algorithms. i am getting NullPointerException . why???? please somebody help me...! public void insertNonFull(BPlusNode root,BPlusNode parent,String key) { int i=0; BPlusNode child=new BPlusNode(); BPlusNode node=parent; while(true) { i=node.numKeys-1; if(node.leaf) { while(i>=0 && key.compareTo(node.keys[i])<0) { node.keys[i+1]=node.keys[i]; i--; } node.keys[i+1]=key; node.numKeys=node.numKeys+1; } else { while(i>=0 && key.compareTo(node.keys[i])<0) { i--; } } i++; child=node.pointers[i]; if(child!=null && child.numKeys==7) { splitChild(root,node,i,child); if(key.compareTo(node.keys[i])>0) { i++; } } node=node.pointers[i]; } }

    Read the article

  • Implementing a logging library in .NET with a database as the storage medium

    - by Dave
    I'm just starting to work on a logging library that everyone can use to keep track of any sort of system information while the user is running our application. The simplest example so far is to track Info, Warnings, and Errors. I want all plugins to be able to use this feature, but since each developer might have a different idea of what's important to report, I want to keep this as generic as possible. In the C++ world, I would normally use something like a stl::pair<string,string> to act as a key value pair structure, and have a stl::list of these to act as a "row" in the log. The log cache would then be a list<list<pair<string,string>>> (ugh!). This way, the developers can use a const string key like INFO, WARNING, ERROR to have a consistent naming for a column in the database (for SELECTing specific types of information). I'd like the database to be able to deal with any number of distinct column names. For example, John might have an INFO row with a column called USER, and Bill might have an INFO row with a column called FILENAME. I want the log viewer to be able to display all information, and if one report doesn't have a value for INFO / FILENAME, those fields should just appear blank. So one option is to use List<List<KeyValuePair<String,String>>, and the another is to have the log library consumer somehow "register" its schema, and then have the database do an ALTER TABLE to handle this situation. Yet another idea is to have a table that's just for key value pairs, with a foreign key that maps the key value pairs back to the original log entry. I obviously don't want logging to bog down the system, so I only lock the log cache to make a copy of the data (and remove the already-copied data), then a background thread will dump the information to the database. My specific questions regarding this are: Do you see any performance issues? In other words, have you ever tried something like this and found that certain things just don't work well in practice? Is there a more .NETish way to implement the key value pairs, other than List<List<KeyValuePair<String,String>>>? Even if there is a way to do #2 better, is the ALTER TABLE idea I proposed above a Bad Thing? Would you recommend multiple databases over a single one? I don't yet have an idea of how frequently the log would get written to, but we ideally would like to have lots of low level information. Perhaps there should be a DB with a fixed schema only for the low level stuff, and then another DB that's more flexible for reporting information back to users.

    Read the article

  • How to get started with testing(jMock)

    - by London
    Hello, I'm trying to learn how to write tests. I'm also learning Java, I was told I should learn/use/practice jMock, I've found some articles online that help to certain extend like : http://www.theserverside.com/news/1365050/Using-JMock-in-Test-Driven-Development http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock And most articles I found was about test driven development, write tests first then write code to make the test pass. I'm not looking for that at the moment, I'm trying to write tests for already existing code with jMock. The official documentation is vague to say the least and just too hard for me. Does anybody have better way to learn this. Good books/links/tutorials would help me a lot. thank you EDIT - more concrete question : http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock - from this article Tried this to mock this simple class : import java.util.Map; public class Cache { private Map<Integer, String> underlyingStorage; public Cache(Map<Integer, String> underlyingStorage) { this.underlyingStorage = underlyingStorage; } public String get(int key) { return underlyingStorage.get(key); } public void add(int key, String value) { underlyingStorage.put(key, value); } public void remove(int key) { underlyingStorage.remove(key); } public int size() { return underlyingStorage.size(); } public void clear() { underlyingStorage.clear(); } } Here is how I tried to create a test/mock : public class CacheTest extends TestCase { private Mockery context; private Map mockMap; private Cache cache; @Override @Before public void setUp() { context = new Mockery() { { setImposteriser(ClassImposteriser.INSTANCE); } }; mockMap = context.mock(Map.class); cache = new Cache(mockMap); } public void testCache() { context.checking(new Expectations() {{ atLeast(1).of(mockMap).size(); will(returnValue(int.class)); }}); } } It passes the test and basically does nothing, what I wanted is to create a map and check its size, and you know work some variations try to get a grip on this. Understand better trough examples, what else could I test here or any other exercises would help me a lot. tnx

    Read the article

  • How can I ensure that a Java object (containing cryptographic material) is zeroized?

    - by Jeremy Powell
    My concern is that cryptographic keys and secrets that are managed by the garbage collector may be copied and moved around in memory without zeroization. As a possible solution, is it enough to: public class Key { private char[] key; // ... protected void finalize() throws Throwable { try { for(int k = 0; k < key.length; k++) { key[k] = '\0'; } } catch (Exception e) { //... } finally { super.finalize(); } } // ... }

    Read the article

  • Make dictionary from list with python

    - by prosseek
    I need to transform a list into dictionary as follows. The odd elements has the key, and even number elements has the value. x = (1,'a',2,'b',3,'c') - {1: 'a', 2: 'b', 3: 'c'} def set(self, val_): i = 0 for val in val_: if i == 0: i = 1 key = val else: i = 0 self.dict[key] = val My solution seems to long, is there a better way to get the same results?

    Read the article

< Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >