Search Results

Search found 44874 results on 1795 pages for 'format string'.

Page 17/1795 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • Convert a PDF eBook to ePub Format

    - by Matthew Guay
    Would you like to read a PDF eBook on an eReader or mobile device, but aren’t happy with the performance? Here’s how you can convert your PDFs to the popular ePub format so you can easily read them on any device. PDFs are a popular format for eBooks since they render the same on any device and can preserve the exact layout of the print book.  However, this benefit is their major disadvantage on mobile devices, as you often have to zoom and pan back and forth to see everything on the page.  ePub files, on the other hand, are an increasingly popular option. They can reflow to fill your screen instead of sticking to a strict layout style.  With the free Calibre program, you can quickly convert your PDF eBooks to ePub format. Getting Started Download the Calibre installer (link below) for your operating system, and install as normal.  Calibre works on recent versions of Windows, OS X, and Linux.  The Calibre installer is very streamlined, so the install process was quite quick. Calibre is a great application for organizing your eBooks.  It can automatically sort your books by their metadata, and even display their covers in a Coverflow-style viewer. To add an eBook to your library, simply drag-and-drop the file into the Calibre window, or click Add books at the top.  Here you can choose to add all the books from a folder and more. Calibre will then add the book(s) to your library, import the associated metadata, and organize them in the catalog. Convert your Books Once you’ve imported your books into Calibre, it’s time to convert them to the format you want.  Select the book or books you want to convert, and click Convert E-books.  Select whether you want to convert them individually or bulk convert them. The convertor window has lots of options, so you can get your ePub book exactly like you want.  You can simply click Ok and go with the defaults, or you can tweak the settings. Do note that the conversion will only work successfully with PDFs that contain actual text.  Some PDFs are actually images scanned in from the original books; these will appear just like the PDF after the conversion, and won’t be any easier to read. On the first tab, you’ll notice that Calibri will repopulate most of the metadata fields with info from your PDF.  It will also use the first page of the PDF as the cover.  Edit any of the information that may be incorrect, and add any additional information you want associated with the book. If you want to convert your eBook to a different format other than ePub, Calibri’s got you covered, too.  On the top right, you can choose to output the converted eBook into a many different file formats, including the Kindle-friendly MOBI format. One other important settings page is the Structure Detection tab.  Here you can choose to have it remove headers and footers in the converted book, as well as automatically detect chapter breaks. Click Ok when you’ve finished choosing your settings and Calibre will convert the book.  This may take a few minutes, depending on the size of the PDF.  If the conversion seems to be taking too long, you can click Show job details for more information on the progress.   The conversion usually works good, but we did have one job freeze on us.  When we checked the job details, it indicated that the PDF was copy-protected.  Most PDF eBooks, however, worked fine. Now, back in the main Calibri window, select your book and save it to disk.  You can choose to save only the EPUB format, or you can select Save to disk to save all formats of the book to your computer. You can also view the ePub file directly in Calibri’s built-in eBook viewer.  This is the PDF book we converted, and it looks fairly good in the converted format.  It does have some odd line breaks and some misplaced numbers, but on the whole, the converted book is much easier to read, especially on small mobile devices.   Even images get included inline, so you shouldn’t be missing anything from the original eBook. Conclusion Calibri makes it simple to read your eBooks in any format you need. It is a project that is in constant development, and updates regularly adding better stability and features.  Whether you want to ready your PDF eBooks on a Sony Reader, Kindle, netbook or Smartphone, your books will now be more accessible than ever.  And with thousands of free PDF eBooks out there, you’ll be sure to always have something to read. If you’d like some Geeky PDF eBooks, Microsoft Press is offering a number of free PDF eBooks right now.  Check them out at this link (Account Required). Download the Calibre eBook program Similar Articles Productive Geek Tips Format a String as Currency in C#Convert Older Excel Documents to Excel 2007 FormatShare OneNote 2010 Notebooks with OneNote 2007Install an RPM Package on Ubuntu LinuxConvert PDF Files to Word Documents and Other Formats TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips HippoRemote Pro 2.2 Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Nice Websites To Watch TV Shows Online 24 Million Sites Windows Media Player Glass Icons (icons we like) How to Forecast Weather, without Gadgets Outlook Tools, one stop tweaking for any Outlook version Zoofs, find the most popular tweeted YouTube videos

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • Android - phone number contact format

    - by Daniel Benedykt
    Hi In Android I can get phone numbers of all the contacts without any problem. Tha problem is that for most users some numbers are stored as 'local' numbers, meaning that they dont have the country code included. For example, if the user lives in US and he has 2 contacts: 1) John - 555-123-1234 (local) (starting 1 not showing) 2) Jane - 44-123456787 (england phone number) The question is: How do I get all the numbers in an international format, when some of the numbers doesnt include the country code? Any way to figure that out? Thanks

    Read the article

  • java: decoding URI query string

    - by Jason S
    I need to decode a URI that contains a query string; expected input/output behavior is something like the following: abstract class URIParser { /** example input: * something?alias=pos&FirstName=Foo+A%26B%3DC&LastName=Bar */ URIParser(String input) { ... } /** should return "something" for the example input */ public String getPath(); /** should return a map * {alias: "pos", FirstName: "Foo+A&B=C", LastName: "Bar"} */ public Map<String,String> getQuery(); } I've tried using java.net.URI, but it seems to decode the query string so in the above example I'm left with "alias=pos&FirstName=Foo+A&B=C&LastName=Bar" so there is ambiguity whether a "&" is a query separator or is a character in a query component. edit: just tried URI.getRawQuery() and it doesn't do the encoding, so I can split the query string with a "&", but then what do I do? Any suggestions?

    Read the article

  • C# parsing txt files IF name format is desired format

    - by jakesankey
    OK, I have txt files that I am parsing and saving into a sql db. The names are formatted like R306025COMP_272A4075_20090929_080159.txt However, there are a select few (out of thousands of files) with names that are formatted differently (particularly files that were generated as tests), example R306025COMP_SU2_TestBottom_20090915_101441.txt The reason this causes a problem for me is that I am using Split('_')[1,2,etc] to extract the R number, the 272A4075 portion, and the 20090929 (date) portion. When the application comes across the oddly named files, it fails because it is trying to parse 'TestBottom' as a date and inserts 'SU2' instead of the 272 number. Basically I want the app to recognize that if the file's name is not formatted like my first example, skip it. Any advice?

    Read the article

  • How to format a money value from an ISOCurrencySymbol in C#

    - by nareshbhatia
    I have created a Money class to save money values in different currencies. The class uses 3 letter ISO symbols to store currency types: public class Money { public decimal Amount { get; set; } public string Currency { get; set; } } Is there a way in C# to use this information, say 100.00 USD, and format it as "$100.00"? Only way I know of requires CultureInfo like this: Amount.ToString("C", CultureInfo.CreateSpecificCulture("en-US")); However this does not work with my Money class. Is there another solution? I am open to changing my Money class. I have searched this site for similar questions (such as this), but couldn't find one that answers the above question.

    Read the article

  • Objective C display money format like Sensible Soccer

    - by worchyld
    I'm wanting to display money like SWOS (or Sensible World of Soccer) used to. IE: Instead of: $10,000,000+ you got $10m, 10.5m, etc. Instead of: $1,000,000 you got $1m Instead of: $1,500,000 you got $1.5m It also worked for both large and smaller figures, say; 1k, 1.25k, 0.75k, 0.25k, etc. I'm wondering, is there a way to display money in a format that is similar to the way SWOS used to do it? Thanks.

    Read the article

  • Hyphenate a random string to an exact format

    - by chrissygormley
    Hello, I am creating a random ID using the below code: from random import * import string # The characters to make up the random password chars = string.ascii_letters + string.digits def random_password(): return "".join(choice(chars) for x in range(32)) This will output something like: 60ff612332b741508bc4432e34ec1d3e I would like the format to be in this format: 60ff6123-32b7-4150-8bc4-432e34ec1d3e I was looking at the .split() method but can't see how to do this with a random id, also the hyphen's must be at these places so splitting them by a certain amount of digits is out. I'm asking is there a way to split these random id's by 8 number's then 4 etc. Thanks

    Read the article

  • return new string vs .ToString()

    - by Leroy Jenkins
    Take the following code: public static string ReverseIt(string myString) { char[] foo = myString.ToCharArray(); Array.Reverse(foo); return new string(foo); } I understand that strings are immutable, but what I dont understand is why a new string needs to be called return new string(foo); instead of return foo.ToString(); I have to assume it has something to do with reassembling the CharArray (but thats just a guess). Whats the difference between the two and how do you know when to return a new string as opposed to returning a System.String that represents the current object?

    Read the article

  • Java: Print and access List <String[]>

    - by battousai622
    Im reading in a file and storing it in t1. How do i access the elements in t1? When i try to print it i get addresses instead of values. Also whats the dif between string and string[]? CSVReader reader = new CSVReader(new FileReader("src/new_acquisitions.csv")); List <String[]> t1 = reader.readAll(); int i = 0 while(i < t1.size()) { System.out.println(t1.get(i)); i++; } output: [Ljava.lang.String;@9304b1 [Ljava.lang.String;@190d11 [Ljava.lang.String;@a90653 [Ljava.lang.String;@de6ced

    Read the article

  • Does the advanced format tool bundled by manufacturers actually do anything which mkntfs doesn't?

    - by neurolysis
    I recently bought a new drive (specifically, a 2TB Samsung Spinpoint) that says on the label that it supports advanced format, and that I should download the tool from their site. Unless I'm missing something, mkntfs has always had its maximum sector size at 4096b: -s, --sector-size BYTES Specify the size of sectors in bytes. Valid sector size values are 256, 512, 1024, 2048 and 4096 bytes per sector. If omitted, mkntfs attempts to determine the sector-size automatically and if that fails a default of 512 bytes per sector is used. Will this tool on Samsung's site do anything other than format the drive in the same way doing mkntfs -s 4K /dev/sdb1 would do? To be specific, I'm intending to use this drive on a machine that will primarily run Windows XP, but I'd rather boot into Linux/BSD and format the disk manually than have bloated software. I do want to have the new AF style sectors though -- that's essential. So if I did the command above, would it have exactly the same effect as using the advanced format tool?

    Read the article

  • Git pack file entry format

    - by Ben Collins
    My understanding of the Git pack file format is something like: Where the table is 32-bits wide, and the first three 32-bit words are the pack file header. The last row of 32 bits are the first 4 bytes of an entry. As I understand it, the size of the entry is specified by consecutive bytes with the MSB set, followed by compressed data. In the first byte whose MSB is not set, is the MSB part of the compressed data, or is it a gap? If it's part of the compressed data, how can you guarantee that when the data is compressed that bit won't be set?

    Read the article

  • Formatting a string in Java using class attributes

    - by Jason R. Coombs
    I have a class with an attribute and getter method: public Class MyClass { private String myValue = "foo"; public String getMyValue(); } I would like to be able to use the value of foo in a formatted string as such: String someString = "Your value is {myValue}." String result = Formatter.format(someString, new MyClass()); // result is now "Your value is foo." That is, I would like to have some function like .format above which takes a format string specifying properties on some object, and an instance with those properties, and formats the string accordingly. Is it possible to do accomplish this feat in Java?

    Read the article

  • jqplot format tooltip values

    - by Jeroen
    I want to have a tooltip hover highlight thingy in jqplot. The problem is that I want it to give more detail then on the axes. So the formatter should be different. I can't get it to display the seconds to: There's a JS fidle here! I want the timestamp to display as hours:minutes:seconds, which would be format string '%H:%M:%S' or '%T' or '%X'. But how do I do that? highlighter: { show: true, sizeAdjust: 3, //useAxesFormatters: false, //tooltipFormatString: '%H:%M:%S', formatString: '<table class="jqplot-highlighter"><tr><td>tijd:</td><td>%s</td></tr><tr><td>snelheid:</td><td>%s</td></tr></table>', },

    Read the article

  • change email address format with minimal disruption

    - by femi
    Hello, all the email addresses in my organization are in the format [email protected]. this was started when we were a small organization. Now we have grown and need to use something a bit more professional like [email protected] how can this change be implemented with minimal disruption? We currently only use smarteremail. Could recieving ONLY with the old and replying with the new be a solution..till we wean our recipients off the old email address? Any suggestions are welcome. How will moving to exchange help in this instance? Can it be configured to automatically send out using a different address? Thanks

    Read the article

  • Resizing page format on iReport

    - by pringlesinn
    I've been trying to print a pdf made from iReport in less than a page A4. it's like half A4 page height. I'm using a Line Matrix printer, doesn't matter which one. So, when I try to print 2 files at same file, it should print everything on the right place, but just first file is printed correctly. The second one is based on a A4 page format, and just starts printing after A4 page height is over, skipping a big blank. Where can I set the size of page in iReport? The only thing I could do was setting size of what is shown on screen while I edit the file. I tried my best to explain the situation, any doubts, ask me and I'll try even harder.

    Read the article

  • JTextField that has inner fields or preformated format, something like the ip field in windows

    - by dimitar
    Hello guys, i want to create a text field that will be for date and will have dd.mm.YYYY format. Now what i want to do is the user to type only the numbers, not the dots to. So the field would be like: _ _. _ _ . _ _ _ _ So when the user wants to type the date: 15.05.2010 for example, he will only type the numbers in the sequence 15052010. Also i would like, when he preses on left or right arrow, the cursor to go from one field(not JTextField, but field in the JTextField). So lets say i have JTextField with text in it: 15.05.2010, so if user is on the beginning and he preses right arrow, the cursor to go to the .05 field. I hope you understand me 'cos right now i don't any idea how to make this, or at least how to look for it on google. Thank you.

    Read the article

  • Why is the proper "respond_to" format not getting called?

    - by humble_coder
    Hi All, I'm having a bit of an odd issue. Really too odd to type out, but here goes. Basically I have a controller that refuses to "respond_to" using javascript unless I assign my "chart.generate_xml" to a variable before the "respond_to" block like so: @xml = @chart.generate_xml(@begin_date,@end_date,1.hour) respond_to do |format| format.html format.js{ render :update do |page| page.insert_html :bottom, "chart-div", @xml #page.insert_html :bottom, "chart-div", @chart.generate_xml(@begin_date,@end_date,1.hour) end } If I remove the upper "@xml= …" portion and go with the lower "page.insert", the "format.js" section doesn't get called. And if I try to force the format with "request.format = :js", I get the javascript returned as text. I'm not doing anything special here in that method call, so I'm not sure why it would choose to respond any differently. FWIW, the method that triggers this controller action is using JS to do so, so I'm confused as to why "format.js" isn't always getting called. Thoughts? Best.

    Read the article

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >