Search Results

Search found 5313 results on 213 pages for 'steve care'.

Page 174/213 | < Previous Page | 170 171 172 173 174 175 176 177 178 179 180 181  | Next Page >

• Why calling Process.killProcess(Process.myPid()) is a bad idea?

  - by Tal Kanel

  I've read some posts saying using this method is "not good", shouldn't been use, it's not the right way to "close" the application and it's not how android works... I understand and accept the fact that Android OS knows better then me when it's the right time to terminate the process, but I didn't heard yet a good explanation why it's wrong using the killProcess() method?. after all - it's part of the android API... what I do know is that calling this method while other threads doing in potential an important work (operations on files, writing to DB, HTTP requests, running services..) can be terminated in the middle, and it's clearly not good. also I know I can benefit from the fact that "re-open" the application will be faster, cause the system maybe still "holds" in memory state from last time been used, and killProcess() prevents that. beside this reason, in assumption I don't have such operations, and I don't care my application will load from scratch each run, there are other reasons why not using the killProcess() method? I know about finish() method to close an Activity, so don't write me about that please.. finish() is only for Activity. not to all application, and I think I know exactly why and when to use it... and another thing - I'm developing also games with the Unity3D framework, and exporting the project to android. when I decompiled the generated apk, I was very suprised to find out that the java source code created from unity - implementing Unity's - Application.quit() method, with Process.killProcess(Process.myPid()). Application.quit() is suppose to be the right way to close game according to Unity3d guides (is it really?? maybe I'm wrong, and missed something), so how it happens that the Unity's framework developers which doing a very good work as it seems implemented this in native android to killProcess()? anyway - I wish to have a "list of reasons" why not using the killProcess() method, so please write down your answer - if you have something interesting to say about that. TIA

  Read the article

• Is there a good tutorial for figuring out what a website is doing so your program can do the same th

  - by brian d foy

  Is there a good guide or tutorial for people who need to programmatically interact with dynamic websites? There's been a rash of Perl questions about that lately, and I haven't found a good resource to point people toward. I'm asking not because I need one but because I don't want to waste my time writing it if it already exists. Although I'm most interested in Perl, the extra tools and techniques are mostly the same. Typically, I see see these problems in people's questions: Handling, setting, and saving cookies Finding and interacting with forms Handling JavaScript inside your user-agent especially things like onLoad, onSumbit, and Ajax Using HTTP sniffer tools Using Web developer plugins in interactive browsers Interacting with DOM, screen scraping, etc. If there's no good tutorial, I'll add it to my list of things to do (unless someone else wants to do it :). Along the way, if you don't have a suggestion for an existing tutorial, please suggest the things that you think should be in a new one, including links, your favorite tools, and your own user-agent development experiences. I don't care about the particular language you use.

  Read the article

• Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

  - by Deepak Konidena

  Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

  Read the article

• Parent Control Mouse Enter/Leave Events With Child Controls

  - by Paul Williams

  I have a C# .NET 2.0 WinForms app. My app has a control that is a container for two child controls: a label, and some kind of edit control. You can think of it like this, where the outer box is the parent control: +---------------------------------+ | [Label Control] [Edit Control] | +---------------------------------+ I am trying to do something when the mouse enters or leaves the parent control, but I don't care if the mouse moves into one of its children. I want a single flag to represent "the mouse is somewhere inside the parent or children" and "the mouse has moved outside of the parent control bounds". I've tried handling MouseEnter and MouseLeave on the parent and both child controls, but this means the action begins and ends multiple times as the mouse moves across the control. In other words, I get this: Parent.OnMouseEnter (start doing something) Parent.OnMouseLeave (stop) Child.OnMouseEnter (start doing something) Child.OnMouseLeave (stop) Parent.OnMouseEnter (start doing something) Parent.OnMouseLeave (stop) The intermediate OnMouseLeave events cause some undesired effects as whatever I'm doing gets started and then stopped. I want to avoid that. I don't want to capture the mouse as the parent gets the mouse over, because the child controls need their mouse events, and I want menu and other shortcut keys to work. Is there a way to do this inside the .NET framework? Or do I need to use a Windows mouse hook?

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Finding distance to the closest point in a point cloud on an uniform grid

  - by erik

  I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

  Read the article

• Is there a way to effect user defined data types in MySQL?

  - by Dancrumb

  I have a database which stores (among other things), the following pieces of information: Hardware IDs BIGINTs Storage Capacities BIGINTs Hardware Names VARCHARs World Wide Port Names VARCHARs I'd like to be able to capture a more refined definition of these datatypes. For instance, the hardware IDs have no numerical significance, so I don't care how they are formatted when displayed. The Storage Capacities, however, are cardinal numbers and, at a user's request, I'd like to present them with thousands and decimal separators, e.g. 123,456.789. Thus, I'd like to refine BIGINT into, say ID_NUMBER and CARDINAL. The same with Hardware Names, which are simple text and WWPNs, which are hexstrings, e.g. 24:68:AC:E0. Thus, I'd like to refine VARCHAR into ENGLISH_WORD and HEXSTRING. The specific datatypes I made up are just for illustrative purposes. I'd like to keep all this information in one place and I'm wondering if anybody knows of a good way to hold this all in my MySQL table definitions. I could use the Comment field of the table definition, but that smells fishy to me. One approach would be to define the data structure elsewhere and use that definition to generate my CREATE TABLEs, but that would be a major rework of the code that I currently have, so I'm looking for alternatives. Any suggestions? The application language in use is Perl, if that helps.

  Read the article

• Can NSCollectionView autoresize the width of its subviews to display one column

  - by littlecharva

  Hi, I have an NSCollectionView that contains a collection of CustomViews. Initially it tiled the subviews into columns and rows like a grid. I then set the Columns property in IB to 1, so now it just displays them one after another in rows. However, even though my CustomView is 400px wide, it's set to autoresize, the NSCollectionView is 400px wide, and it's set to 1 column, the subviews are drawn about 80px wide. I know I can get around this by calling: CGFloat width = [collectionView bounds].size.width; NSSize size = NSMakeSize(width, 85); [collectionView setMinItemSize:size]; [collectionView setMaxItemSize:size]; But putting this code in the awakeFromNib method of my WindowController only sets the correct width when the program launches. When I resize the window (and the NSCollectionView autoresizes as I've specified), the CustomViews stay at their initially set width. I'm happy to take care of resizing the subviews myself if need be, but I'm quite new to Cocoa and can't seem to find any articles explaining how to do such a thing. Can someone point me in the right direction? Anthony

  Read the article

• Does my API design violate RESTful principles?

  - by peta

  Hello everybody, I'm currently (I try to) designing a RESTful API for a social network. But I'm not sure if my current approach does still accord to the RESTful principles. I'd be glad if some brighter heads could give me some tips. Suppose the following URI represents the name field of a user account: people/{UserID}/profile/fields/name But there are almost hundred possible fields. So I want the client to create its own field views or use predefined ones. Let's suppose that the following URI represents a predefined field view that includes the fields "name", "age", "gender": utils/views/field-views/myFieldView And because field views are kind of higher logic I don't want to mix support for field views into the "people/{UserID}/profile/fields" resource. Instead I want to do the following: utils/views/field-views/myFieldView/{UserID} Though Leonard Richardson & Sam Ruby state in their book "RESTful Web Services" that a RESTful design is somehow like an "extreme object oriented" approach, I think that my approach is object oriented and therefore accords to RESTful principles. Or am I wrong? When not: Are such "object oriented" approaches generally encouraged when used with care and in order to avoid query-based REST-RPC hybrids? Thanks for your feedback in advance, peta

  Read the article

• Linq to SQL with INSTEAD OF Trigger and an Identity Column

  - by Bob Horn

  I need to use the clock on my SQL Server to write a time to one of my tables, so I thought I'd just use GETDATE(). The problem is that I'm getting an error because of my INSTEAD OF trigger. Is there a way to set one column to GETDATE() when another column is an identity column? This is the Linq-to-SQL: internal void LogProcessPoint(WorkflowCreated workflowCreated, int processCode) { ProcessLoggingRecord processLoggingRecord = new ProcessLoggingRecord() { ProcessCode = processCode, SubId = workflowCreated.SubId, EventTime = DateTime.Now // I don't care what this is. SQL Server will use GETDATE() instead. }; this.Database.Add<ProcessLoggingRecord>(processLoggingRecord); } This is the table. EventTime is what I want to have as GETDATE(). I don't want the column to be null. And here is the trigger: ALTER TRIGGER [Master].[ProcessLoggingEventTimeTrigger] ON [Master].[ProcessLogging] INSTEAD OF INSERT AS BEGIN SET NOCOUNT ON; SET IDENTITY_INSERT [Master].[ProcessLogging] ON; INSERT INTO ProcessLogging (ProcessLoggingId, ProcessCode, SubId, EventTime, LastModifiedUser) SELECT ProcessLoggingId, ProcessCode, SubId, GETDATE(), LastModifiedUser FROM inserted SET IDENTITY_INSERT [Master].[ProcessLogging] OFF; END Without getting into all of the variations I've tried, this last attempt produces this error: InvalidOperationException Member AutoSync failure. For members to be AutoSynced after insert, the type must either have an auto-generated identity, or a key that is not modified by the database after insert. I could remove EventTime from my entity, but I don't want to do that. If it was gone though, then it would be NULL during the INSERT and GETDATE() would be used. Is there a way that I can simply use GETDATE() on the EventTime column for INSERTs? Note: I do not want to use C#'s DateTime.Now for two reasons: 1. One of these inserts is generated by SQL Server itself (from another stored procedure) 2. Times can be different on different machines, and I'd like to know exactly how fast my processes are happening.

  Read the article

• Databinding question: DataGridView <=> XDocument (using LINQ-to-XML)

  - by Pretzel

  Learning LINQ has been a lot of fun so far, but despite reading a couple books and a bunch of online resources on the topic, I still feel like a total n00b. Recently, I just learned that if my query returns an Anonymous type, the DataGridView I'm populating will be ReadOnly (because, apparently Anonymous types are ReadOnly.) Right now, I'm trying to figure out the easiest way to: Get a subset of data from an XML file into a DataGridView, Allow the user to edit said data, Stick the changed data back into the XML file. So far I have Steps 1 and 2 figured out: public class Container { public string Id { get; set; } public string Barcode { get; set; } public float Quantity { get; set; } } // For use with the Distinct() operator public class ContainerComparer : IEqualityComparer<Container> { public bool Equals(Container x, Container y) { return x.Id == y.Id; } public int GetHashCode(Container obj) { return obj.Id.GetHashCode(); } } var barcodes = (from src in xmldoc.Descendants("Container") where src.Descendants().Count() > 0 select new Container { Id = (string)src.Element("Id"), Barcode = (string)src.Element("Barcode"), Quantity = float.Parse((string)src.Element("Quantity").Attribute("value")) }).Distinct(new ContainerComparer()); dataGridView1.DataSource = barcodes.ToList(); This works great at getting the data I want from the XML into the DataGridView so that the user has a way to manipulate the values. Upon doing a Step-thru trace of my code, I'm finding that the changes to the values made in DataGridView are not bound to the XDocument object and as such, do not propagate back. How do we take care of Step 3? (getting the data back to the XML) Is it possible to Bind the XML directly to the DataGridView? Or do I have to write another LINQ statement to get the data from the DGV back to the XDocument? Suggstions?

  Read the article

• Which Django 1.2.x multilingual application to use?

  - by mawimawi

  There are a couple of different applications for internationalized content in Django. As of now I only have used http://code.google.com/p/django-multilingual/ in my production environments, but I wonder if there are "better" solutions for my wishes. What my staff users need is the following: An object is being created by a staff user in any language (e.g. "de") This object should be displayed in the german version of the website. When a staff user translates the object into a different language (e.g. "fr"), then the page must be visible in the french version as well. If an object is not translated in the visitor's currently selected language (e.g. "en"), then calling the objects url shall raise a 404 Error (or even better a notice that the object is only available in the languages "de" and "fr", and the visitor might be able to select one of the languages) My staff users are working in the admin interface, so the multilingual application must support this as well. I don't really care whether the multilingual app uses a single table with many fields (like title_en, title_de, title_fr) or a foreign key to a related table (as it is implemented in django-multlingual). I only want it to have a good admin interface and no "default" language, because some content might be available just in "de", and some other just in "fr" and "en". And the most important issue of course is compatibility with Django 1.2.x. What are your experiences and preferred apps, and why?

  Read the article

• Alternative Python standard library reference

  - by Ender

  I love Python; I absolutely despise its official documentation. Tutorials do not count as library references, but that appears to be what they're attempting. What I really want is the ability to find a class in the standard library and view documentation for all of its properties and methods. Actionscript, MSDN, and Java all do this just fine (although each with their odd quirks). Where is this for python? For example, I wanted to sort a list. mylist.sort(). Awesome. But what if I wanted it sorted in descending order? Official documentation is not - much - help. Or what if I wanted to specify a key function? That's also supported: mylist.sort(key=lamba item: item.customVar)- but documented...where? I understand that Python's approach to OOP may not be equivalent to Java et. al. Maybe list isn't actually a class - maybe it's just a function that returns an iterable when the tachyon beams are set to glorious and the unboxed hyper enumeration is quantized, but...I don't care. I just want to know how to sort lists. (Apologies for the angst - too much caffeine today)

  Read the article

• Filtering Wikipedia's XML dump: error on some accents

  - by streetpc

  I'm trying to index Wikpedia dumps. My SAX parser make Article objects for the XML with only the fields I care about, then send it to my ArticleSink, which produces Lucene Documents. I want to filter special/meta pages like those prefixed with Category: or Wikipedia:, so I made an array of those prefixes and test the title of each page against this array in my ArticleSink, using article.getTitle.startsWith(prefix). In English, everything works fine, I get a Lucene index with all the pages except for the matching prefixes. In French, the prefixes with no accent also work (i.e. filter the corresponding pages), some of the accented prefixes don't work at all (like Catégorie:), and some work most of the time but fail on some pages (like Wikipédia:) but I cannot see any difference between the corresponding lines (in less). I can't really inspect all the differences in the file because of its size (5 GB), but it looks like a correct UTF-8 XML. If I take a portion of the file using grep or head, the accents are correct (even on the incriminated pages, the <title>Catégorie:something</title> is correctly displayed by grep). On the other hand, when I rectreate a wiki XML by tail/head-cutting the original file, the same page (here Catégorie:Rock par ville) gets filtered in the small file, not in the original… Any idea ? Alternatives I tried: Getting the file (commented lines were tried wihtout success): FileInputStream fis = new FileInputStream(new File(xmlFileName)); //ReaderInputStream ris = ReaderInputStream.forceEncodingInputStream(fis, "UTF-8" ); //(custom function opening the stream, reading it as UFT-8 into a Reader and returning another byte stream) //InputSource is = new InputSource( fis ); is.setEncoding("UTF-8"); parser.parse(fis, handler); Filtered prefixes: ignoredPrefix = new String[] {"Catégorie:", "Modèle:", "Wikipédia:", "Cat\uFFFDgorie:", "Mod\uFFFDle:", "Wikip\uFFFDdia:", //invalid char "Catégorie:", "Modèle:", "Wikipédia:", // UTF-8 as ISO-8859-1 "Image:", "Portail:", "Fichier:", "Aide:", "Projet:"}; // those last always work

  Read the article

• Regex to extract portions of file name

  - by jakesankey

  I have text files formatted as such: R156484COMP_004A7001_20100104_065119.txt I need to consistently extract the R****COMP, the 004A7001 number, 20100104 (date), and don't care about the 065119 number. the problem is that not ALL of the files being parsed have the exact naming convention. some may be like this: R168166CRIT_156B2075_SU2_20091223_123456.txt or R285476COMP_SU1_125A6025_20100407_123456.txt So how could I use regex instead of split to ensure I am always getting that serial (ex. 004A7001), the date (ex. 20100104), and the R****COMP (or CRIT)??? Here is what I do now but it only gets the files formatted like my first example. if (file.Count(c => c == '_') != 3) continue; and further down in the code I have: string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); UPDATE: This is now where I am at -- I get an error to parse RNumberDate to an actual date format. "Cannot implicitly convert type 'RegularExpressions.Match' to 'string' string RNumber = Path.GetFileNameWithoutExtension(file); Match RNumberE = Regex.Match(RNumber, @"^(R|L)\d{6}(COMP|CRIT|TEST|SU[1-9])(?=_)", RegexOptions.IgnoreCase); Match RNumberD = Regex.Match(RNumber, @"(?<=_)\d{3}[A-Z]\d{4}(?=_)", RegexOptions.IgnoreCase); Match RNumberDate = Regex.Match(RNumber, @"(?<=_)\d{8}(?=_)", RegexOptions.IgnoreCase); DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy")

  Read the article

• perl dynamic path given to 'use lib'

  - by Ed Hyer

  So, my code (Perl scripts and Perl modules) sits in a tree like this: trunk/ util/ process/ scripts/ The 'util' directory has, well, utilities, that things in the 'process/' dir need. They get access like this: use FindBin; use lib "$FindBin::Bin/../util"; use UtilityModule qw(all); That construct doesn't care where you start, as long as you're at the same level in the tree as "util/". But I decided that 'scripts/' was getting too crowded, so I created scripts/scripts1 scripts/scripts2 Now I see that this doesn't work. If I run a script 'trunk/scripts/scripts1/call_script.pl', and it calls '/trunk/process/process_script.pl', then 'process_script.pl' will fail trying to get the routines from UtilityModule(), because the path that FindBin returns is the path of the top-level calling script. The first ten ways I thought of to solve this all involved something like: use lib $path_that_came_from_elsewhere; but that seems to be something Perl doesn't like to do, except via that FindBin trick. I tried some things involving BEGIN{} blocks, but i don't really know what I'm doing there, and will likely just end up refactoring. But if someone has some clever insight into this type of problem, this would be a good chance to earn some points!

  Read the article

• Exporting/Importing events to Outlook 2007 calendar - problem

  - by iandisme

  I work on a web app that involves scheduling. A user can view his schedule, and then download a meeting request file for a particular event. In Outlook 2003, simply opening this event would cause a meeting request to pop up and the user could accept, which would either add or update the event in their calendar. However, in Outlook 2007, the meeting request Accept function is disabled, and the reason given is that the user is the organizer and can't accept his own event request. The ICS file clearly shows that this is not the case. Has anyone experienced this same problem? Does anyone know how to work around it? (Using Outlook's import function is scarcely an option because it causes duplicate events to be created; the import function doesn't seem to care that the events have the same UID) Here is the ICS file: BEGIN:VCALENDAR PRODID:#{my app} VERSION:2.0 CALSCALE:GREGORIAN METHOD:REQUEST BEGIN:VEVENT DTSTAMP:20100324T150236Z UID:eeb639a1-f8e5-4eab-ab3c-232ad91364c6 SEQUENCE:2 ORGANIZER:#{myApp}.#{myDomain}.com DESCRIPTION: DTSTART;TZID=Europe/London:20110620T120010 DTEND;TZID=Europe/London:20110620T133010 SUMMARY:BREAK:Breakfast LOCATION:Room 101 END:VEVENT BEGIN:VTIMEZONE //Timezone info edited for brevity END:VTIMEZONE END:VCALENDAR

  Read the article

• GAE modeling relationship options

  - by Sway

  Hi there, I need to model the following situation and I can't seem to find a consistent example on how to do it "correctly" for the google app engine. Suppose I've got a simple situation like the following: [Company] 1 ----- M [Stare] A company has one to many stores. Each store has an address made up of a address line 1, city, state, country, postcode etc. Ok. Lets say we need to create say an "Audit". An Audit is for a company and can be across one to many stares. So something like: [Audit] 1 ------ 1 [Company] 1 ------ M [Store] Now we need to query all of the "audits" based on the Store "addresses" in order to send the "Auditors" to the right locations. There seem to be numerous articles like this one: http://code.google.com/appengine/articles/modeling.html Which give examples of creating a "ContactCompany" model class. However they also say that you should use this kind of relationship only when you "really need to" and with "care" for performance. I've also read - frequently - that you should denormalize as much as possible thereby moving all of the "query-able" data into the Audit class. So what would you suggest as the best way to solve this? I've seen that there is an Expando class but I'm not sure if that is the "best" option for this. Any help or thoughts on this would be totally appreciated. Thanks in advance, Matt

  Read the article

• Scrolling down to next element via keypress & scrollTo plugin - jQuery

  - by lyrae

  I am using jQuery's scrollTo plugin to scroll up and down my page, using UP arrow and DOWN arrow. i have a bunch of div with class "screen", as so: <div class="screen-wrapper">...</div> What I am trying to do is, when i press UP or DOWN, the window scrolls to the next, or previous div with class of "screen". I have the keypresses taken care of. According to the plugin docs, to scroll a window, you use $.scrollTo(...); Here's the code I have: $(document).keypress(function(e){ switch (e.keyCode) { case 40: // down n = $('.screen-wrapper').next() $.scrollTo( n, 800 ); break; case 38: // up break; case 37: // left break; case 39: // right break; } }); And if it helps, here's the HTML div. I have a few of these on the page, and essentially, am trying to scroll to next one by pressing down arrow: <div class='screen-wrapper'> <div class='screen'> <div class="sections"> <ul> <li><img src="images/portfolio/sushii-1.png " /></li> <li><img src="images/portfolio/sushii-2.png" /></li> <li><img src="images/portfolio/sushii-3.png" /></li> </ul> </div> <div class="next"></div> <div class="prev"></div> </div> And also if it needed, I can provide a link where this is being used if it'll help someone get a better idea. edit And, i forgot to mention what the real question here is. The question/problem is that it won't scroll down past the first element, as seth mentioned.

  Read the article

• How to implement properly plugins in C#?

  - by MartyIX

  I'm trying to add plugins to my game and what I'm trying to implement is this: Plugins will be either mine or 3rd party's so I would like a solution where crashing of the plugin would not mean crashing of the main application. Methods of plugins are called very often (for example because of drawing of game objects). What I've found so far: 1) http://www.codeproject.com/KB/cs/pluginsincsharp.aspx - simple concept that seems like it should work nicely. Since plugins are used in my game for every round I would suffice to add the Restart() method and if a plugin is no longer needed Unload() method + GC should take care of that. 2) http://mef.codeplex.com/Wikipage - Managed Extensibility Framework - my program should work on .NET 3.5 and I don't want to add any other framework separately I want to write my plugin system myself. Therefore this solution is out of question. 3) Microsoft provides: http://msdn.microsoft.com/en-us/library/system.addin.aspx but according to a few articles I've read it is very complex. 4) Different AppDomains for plugins. According to Marc Gravell ( http://stackoverflow.com/questions/665668/usage-of-appdomain-in-c ) different AppDomains allow isolation. Unloading of plugins would be easy. What would the performance load be? I need to call methods of plugins very often (to draw objects for example). Using Application Domains - http://msdn.microsoft.com/en-us/library/yb506139.aspx A few tutorials on java2s.com Could you please comment on my findings? New approaches are also welcomed! Thanks!

  Read the article

• Seperation of game- and rendering logic

  - by Qua

  What is the best way to seperate rendering code from the actually game engine/logic code? And is it even a good idea to seperate those? Let's assume we have a game object called Knight. The Knight has to be rendered on the screen for the user to see. We're now left with two choices. Either we give the Knight a Render/Draw method that we can call, or we create a renderer class that takes care of rendering all knights. In the scenario where the two is seperated the Knight should the knight still contain all the information needed to render him, or should this be seperated as well? In the last project we created we decided to let all the information required to render an object be stored inside the object itself, but we had a seperate component to actually read those informations and render the objects. The object would contain information such as size, rotation, scale, and which animation was currently playing and based on this the renderer object would compose the screen. Frameworks such as XNA seem to think joining the object and rendering is a good idea, but we're afraid to get tied up to a specific rendering framework, whereas building a seperate rendering component gives us more freedom to change framework at any given time.

  Read the article

• "User Friendly" .net compatible Regex/Text matching tools?

  - by Binary Worrier

  Currently in our software we provide a hook where we call a DLL built by our clients to parse information out of documents we are processing (the DLL takes in some text (or a file) and returns a list of name/value pairs). e.g. We're given a Word doc or Text file to Archive. We do various things to the file, and call a DLL that will return "pertinent" information about the file. Among other things we store that "pertinent" data for posterity. What is considered "pertinent" depends on the client and the type of the document, we don't care, we get it and store it. I've been asked to develop a user friendly "something" that will allow a non-programmer user to "configure" how to get this data from a plain text document (<humor>The user story ends with the helpful suggestion/query "We could use regex for this?"</humor>) It's safe to assume that a list of regex's isn't going to cut this, I've written some of these parsers for customers, the regex's to do these would be hedious and some of them can't be done by regex's. Also one of the requirements above is "user friendly" which negates anything that has users seeing or editing regex expressions. As you can guess, I don't have a fortune of time to do this, and am wondering is there anything out there that I can plug in to our app that has a nice front end and does exactly what I need? :) No? Whadda mean no! . . . sigh Ok then failing that, anything out there that "visually" builds regex's and/or other pattern matching expressions, and then allows one to run those expressions against some text? The MS BRE will do what I want, but I need something prettier that looks less like code. Thanks guys,

  Read the article

• Pitfalls and practical Use-Cases: Toplink, Hibernate, Eclipse Link, Ibatis ...

  - by Martin K.

  I worked a lot with Hibernate as my JPA implementation. In most cases it works fine! But I have also seen a lot of pitfalls: Remoting with persisted Objects is difficult, because Hibernate replaces the Java collections with its own collection implementation. So the every client must have the Hibernate .jar libraries. You have to take care on LazyLoading exceptions etc. One way to get around this problem is the use of webservices. Dirty checking is done against the Database without any lock. "Delayed SQL", causes that the data access isn't ACID compliant. (Lost data...) Implict Updates So we don't know if an object is modified or not (commit causes updates). Are there similar issues with Toplink, Eclipse Link and Ibatis? When should I use them? Have they a similar performance? Are there reasons to choose Eclipse Link/Toplink... over Hibernate?

  Read the article

• Frameset isn't working in IE

  - by Cameroon

  First of all, why use a frame set in the first place you ask? answer: Because my boss told me. That been said, I have 2 files. Index.html and Head.html. Contents of index.html: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Frameset//EN" "http://www.w3.org/TR/1999/REC-html401-19991224/frameset.dtd"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1" /> <title>Site Title</title> </head> <frameset rows="122,*" FRAMEBORDER=NO FRAMESPACING=2 BORDER=0> <frame name="t" src="head.html" scrolling="no" marginheight="0" marginwidth="0"> <frame name="b" src="http://www.website.com"> </frameset> <noframes> <p>You have frames turned off on your browser, please turn it on and reload this page.</p> </noframes> </html> Contents of head.html: <div style="border-bottom:2px solid #000;height:120px"> <center>This is the frame head.</center> </div> The code works fine in all browsers except Internet Explorer 7 and 8 (I don't care about 6). Is there anything I am doing wrong, and if not then can the same effect be achieved without frames and if so how?

  Read the article

• R + Bioconductor : combining probesets in an ExpressionSet

  - by Mike Dewar

  Hi, First off, this may be the wrong Forum for this question, as it's pretty darn R+Bioconductor specific. Here's what I have: library('GEOquery') GDS = getGEO('GDS785') cd4T = GDS2eSet(GDS) cd4T <- cd4T[!fData(cd4T)$symbol == "",] Now cd4T is an ExpressionSet object which wraps a big matrix with 19794 rows (probesets) and 15 columns (samples). The final line gets rid of all probesets that do not have corresponding gene symbols. Now the trouble is that most genes in this set are assigned to more than one probeset. You can see this by doing gene_symbols = factor(fData(cd4T)$Gene.symbol) length(gene_symbols)-length(levels(gene_symbols)) [1] 6897 So only 6897 of my 19794 probesets have unique probeset - gene mappings. I'd like to somehow combine the expression levels of each probeset associated with each gene. I don't care much about the actual probe id for each probe. I'd like very much to end up with an ExpressionSet containing the merged information as all of my downstream analysis is designed to work with this class. I think I can write some code that will do this by hand, and make a new expression set from scratch. However, I'm assuming this can't be a new problem and that code exists to do it, using a statistically sound method to combine the gene expression levels. I'm guessing there's a proper name for this also but my googles aren't showing up much of use. Can anyone help?

  Read the article

< Previous Page | 170 171 172 173 174 175 176 177 178 179 180 181  | Next Page >