Search Results

Search found 5262 results on 211 pages for 'operation'.

Page 177/211 | < Previous Page | 173 174 175 176 177 178 179 180 181 182 183 184  | Next Page >

  • Excel - Best Way to Connect With Access Data

    - by gamerzfuse
    Hello there, Here is the situation we have: a) I have an Access database / application that records a significant amount of data. Significant fields would be hours, # of sales, # of unreturned calls, etc b) I have an Excel document that connects to the Access database and pulls data in to visualize it As it stands now, the Excel file has a Refresh button that loads new data. The data is loaded into a large PivotTable. The main 'visual form' then uses VLOOKUP to get the results from the form, based on the related hours. This operation is slow (~10 seconds) and seems to be redundant and inefficient. Is there a better way to do this? I am willing to go just about any route - just need directions. Thanks in advance! Update: I have confirmed (due to helpful comments/responses) that the problem is with the data loading itself. removing all the VLOOKUPs only took a second or two out of the load time. So, the questions stands as how I can rapidly and reliably get the data without so much time involvement (it loads around 3000 records into the PivotTables).

    Read the article

  • When to save a mongoose model

    - by kentcdodds
    This is an architectural question. I have models like this: var foo = new mongoose.Schema({ name: String, bars: [{type: ObjectId, ref: 'Bar'}] }); var FooModel = mongoose.model('Foo', foo); var bar = new mongoose.Schema({ foobar: String }); var BarModel = mongoose.model('Bar', bar); Then I want to implement a convenience method like this: BarModel.methods.addFoo = function(foo) { foo.bars = foo.bars || []; // Side note, is this something I should check here? foo.bars.push(this.id); // Here's the line I'm wondering about... Should I include the line below? foo.save(); } The biggest con I see about this is that if I did include foo.save() then I should pass in a callback to addFoo so I avoid issues with the async operation. I'm thinking this is not preferable. But I also think it would be nice to include because addFoo hasn't really "addedFoo" until it's been saved... Am I breaking any design best practices doing it either way?

    Read the article

  • perl - universal operator overload

    - by Todd Freed
    I have an idea for perl, and I'm trying to figure out the best way to implement it. The idea is to have new versions of every operator which consider the undefined value as the identity of that operation. For example: $a = undef + 5; # undef treated as 0, so $a = 5 $a = undef . "foo"; # undef treated as '', so $a = foo $a = undef && 1; # undef treated as false, $a = true and so forth. ideally, this would be in the language as a pragma, or something. use operators::awesome; However, I would be satisfied if I could implement this special logic myself, and then invoke it where needed: use My::Operators; The problem is that if I say "use overload" inside My::Operators only affects objects blessed into My::Operators. So the question is: is there a way (with "use overoad" or otherwise) to do a "universal operator overload" - which would be called for all operations, not just operations on blessed scalars. If not - who thinks this would be a great idea !? It would save me a TON of this kind of code if($object && $object{value} && $object{value} == 15) replace with if($object{value} == 15) ## the special "is-equal-to" operator

    Read the article

  • VB.net avoiding cross thread exception with extension method

    - by user574632
    Hello I am trying to implement a solution for updating form controls without using a delegate. I am attempting to use the 1st solution on this page: http://www.dreamincode.net/forums/blog/143/entry-2337-handling-the-dreaded-cross-thread-exception/ Imports System.ComponentModel Imports System.Runtime.CompilerServices Public Module MyInvoke <Extension()> _ Public Sub CustomInvoke(Of T As ISynchronizeInvoke)(ByVal control As T, ByVal toPerform As Action(Of T)) If control.InvokeRequired Then control.Invoke(toPerform, New Object() {control}) toPerform(control) End If End Sub End Module The site gives this as example of how to use: Label1.CustomInvoke(l => l.Text = "Hello World!") But i get 'l' is not declared error. As you can see im very new to VB or any OOP. I can get the second solution on that page to work (using delegates) but i have quite a few things to do in this thread and it seems like i would need to write a new delegate sub for each thing, which seems wasteful. What i need to do is select the 1st item from a combobox, update a textbox.text with the selected item, and pass the selected item to a function. Then wait for x seconds and start again, selecting the second item. I can get it to work in a single threaded application, but i need the interface to remain responsive. Any help greatly appreciated. EDIT: OK so changing the syntax worked for the example. However if i change it from Label1.CustomInvoke(Sub(l) l.text = "hello world!") (which worked just fine) to: Dim indexnumber As Integer = 0 ComboBox1.CustomInvoke(Sub(l) l.SelectedIndex = indexnumber) I get a cross threading error as though i didnt even use this method: Cross-thread operation not valid: Control 'ComboBox1' accessed from a thread other than the thread it was created on. So now im back to where i started? Any further help very much appreciated.

    Read the article

  • Aggregating a list of dates to start and end date

    - by Joe Mako
    I have a list of dates and IDs, and I would like to roll them up into periods of consucitutive dates, within each ID. For a table with the columns "testid" and "pulldate" in a table called "data": | A79 | 2010-06-02 | | A79 | 2010-06-03 | | A79 | 2010-06-04 | | B72 | 2010-04-22 | | B72 | 2010-06-03 | | B72 | 2010-06-04 | | C94 | 2010-04-09 | | C94 | 2010-04-10 | | C94 | 2010-04-11 | | C94 | 2010-04-12 | | C94 | 2010-04-13 | | C94 | 2010-04-14 | | C94 | 2010-06-02 | | C94 | 2010-06-03 | | C94 | 2010-06-04 | I want to generate a table with the columns "testid", "group", "start_date", "end_date": | A79 | 1 | 2010-06-02 | 2010-06-04 | | B72 | 2 | 2010-04-22 | 2010-04-22 | | B72 | 3 | 2010-06-03 | 2010-06-04 | | C94 | 4 | 2010-04-09 | 2010-04-14 | | C94 | 5 | 2010-06-02 | 2010-06-04 | This is the the code I came up with: SELECT t2.testid, t2.group, MIN(t2.pulldate) AS start_date, MAX(t2.pulldate) AS end_date FROM(SELECT t1.pulldate, t1.testid, SUM(t1.check) OVER (ORDER BY t1.testid,t1.pulldate) AS group FROM(SELECT data.pulldate, data.testid, CASE WHEN data.testid=LAG(data.testid,1) OVER (ORDER BY data.testid,data.pulldate) AND data.pulldate=date (LAG(data.pulldate,1) OVER (PARTITION BY data.testid ORDER BY data.pulldate)) + integer '1' THEN 0 ELSE 1 END AS check FROM data ORDER BY data.testid, data.pulldate) AS t1) AS t2 GROUP BY t2.testid,t2.group ORDER BY t2.group; I use the use the LAG windowing function to compare each row to the previous, putting a 1 if I need to increment to start a new group, I then do a running sum of that column, and then aggregate to the combinations of "group" and "testid". Is there a better way to accomplish my goal, or does this operation have a name? I am using PostgreSQL 8.4

    Read the article

  • IIS doesn't send two responses to the same client at the same time (only for ASP)

    - by dr. evil
    I've got 2 ASP pages. I do a request to the first page from Firefox (which takes 30 seconds to process on server-side), and during the execution of 30 seconds I do another request from Firefox to the second page (takes less than 1 second in server-side), but it does come after 31 second. Because it waits first requests to finish. When I request to the first page from Firefox and then request the second page from IE it's just instant. So basically ASP - IIS 6 somehow limiting every client to one request (long processing request) at a time. I need to get around this problem in my .NET client application. This is tested in 3 different systems. If you want to test you can try the ASP scripts at the end. This behaviour is same in a long SQL execution or just in a time consuming ASP operation. Note: It's not about HTTP Keep Alive It's not about persistent connection limit (we tried to increase this in firefox and in .NET with Net.ServicePointManager.DefaultConnectionLimit) It's not about User Agent This doesn't happen in ASP.NET so I assume it's something to the with ASP.dll I'm trying to solve this on the client not the server. I don't have direct control over the server it's a 3rd party solution. Is there any way to get around this? Sample ASP Code: First ASP: <% Set cnn = Server.CreateObject("Adodb.Connection") cnn.Open "Provider=sqloledb;Data Source=.;Initial Catalog=master;User Id=sa;Password=;" cnn.Execute("WAITFOR DELAY '0:0:30'") cnn.Close %> Second ASP: <% Response.Write "bla bla" %>

    Read the article

  • Why is CoRegisterClassObject creating two extra threads?

    - by Stijn Sanders
    I'm trying to fix a problem that only recently happens on a number of machine's on a VPN. They each run a client application I wrote that exposes a COM automation object. For some strange reason I haven't been able to discover yet, one thread in the application takes up all of the available CPU time, slowing other operation on the machine. In observing the application's strange behaviour, I've noticed it's the third thread started, and if I debug on my machine I notice the first call to CoRegisterClassObject created two extra threads. If the second of these two threads is the one that gets into an infinite loop, I'm not at all shure how to fix this. Where could I check next about what's wrong? Could it have started by one of the recent patches rolled out by Microsoft this last 'patch tuesday'? I had a go with ProcessExplorer to extract a stack trace of the thread: ntoskrnl.exe!ExReleaseResourceLite+0x1a3 ntoskrnl.exe!PsGetContextThread+0x329 WLDAP32.dll!Ordinal325+0x1231 WLDAP32.dll!Ordinal325+0x129e WLDAP32.dll!Ordinal325+0x1178 ntdll.dll!LdrInitializeThunk+0x24 ntdll.dll!LdrShutdownThread+0xe9 kernel32.dll!ExitThread+0x3e kernel32.dll!FreeLibraryAndExitThread+0x1e ole32.dll!StringFromGUID2+0x65d kernel32.dll!GetModuleFileNameA+0x1ba

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Using external SOAP service in Workflow service

    - by whirlwin
    I am using the .NET 4 framework and have made a WCF Workflow Service Application. I want to use a SOAP web service (.NET 3.5) I have running in another instance of VS. The only method that is exposed is the following: [WebMethod] public string Reverse(string input) { char[] chars = input.ToCharArray(); Array.Reverse(chars); return new string(chars); } I have used the following steps to add the service in my Workflow: Add Service Reference Provided the WSDL (the operation shows in the Operations box as expected) Clicked OK Build the solution to ensure that the service shows in my toolbox Drag the service from the toolbox into the workflow However, when I look at the properties of the service in the workflow, there is no way to specify the input argument or where to store the result of the invocation of the service. I only have the option of specifying some obscure parameters such as Body:InArgument<ReverseRequestBody and outBody:OutArgument<ReverseResponseBody (none of which are strings). Here is a screenshot depicting the properties of the service in the workflow: My question is therefore: Is it possible at all to use the SOAP service by specifying a string as the input argument (like it is meant to be used), and also assign the result to a workflow variable?

    Read the article

  • C++ - Basic WinAPI question

    - by HardCoder1986
    Hello! I am now working on a some sort of a game engine and I had an idea to put everything engine-related into a static library and then link it to my actual problem. Right now I achieved it and actually link that library and every functions seem to work fine, except those, which are windows-related. I have a chunk of code in my library that looks like this: hWnd = CreateWindow(className, "Name", WS_OVERLAPPED | WS_CAPTION | WS_EX_TOPMOST, 0, 0, 800, 600, NULL, NULL, GetModuleHandle(NULL), this); if (hWnd) { ShowWindow(hWnd, SW_NORMAL); UpdateWindow(hWnd); } else { MessageBox(NULL, "Internal program error", "Error", MB_OK | MB_ICONERROR); return; } When this code was not in the library, but in the actual project, it worked fine, created the window and everything was ok. Right now (when I'm linking to my library that contains this code) CreateWindow(...) call returns NULL and GetLastError() returns "Operation succesfully completed" (wtf?). Could anybody help me with this? Is it possible to create a window and display it using a static library call and why could my code fail? Thank you.

    Read the article

  • Injecting the application TransactionManager into a JPA EntityListener

    - by nodje
    I want to use the JPA EntityListener to support spring security ACLs. On @PostPersist events, I create a permission corresponding to the persisted entity. I need this operation to participate to the current Transaction. For this to happen I need to have a reference to the application TransactionManager in the EntityListener. The problem is, Spring can't manage the EntityListener as it is created automatically when EntityManagerFactory is instantiated. And in a classic Spring app, the EntityManagerFactory is itself created during the TransactioManager instantiation. <bean id="transactionManager" class="org.springframework.orm.jpa.JpaTransactionManager"> <property name="entityManagerFactory" ref="entityManagerFactory" /> </bean> So I have no way to inject the TransactionManager with the constructor, as it is not yet instantiated. Making the EntityManager a @Component create another instance of the EntityManager. Implementing InitiliazingBean and using afterPropertySet() doesn't work as it's not a Spring managed bean. Any idea would be helpful as I'm stuck and out of ideas.

    Read the article

  • MPI Odd/Even Compare-Split Deadlock

    - by erebel55
    I'm trying to write an MPI version of a program that runs an odd/even compare-split operation on n randomly generated elements. Process 0 should generated the elements and send nlocal of them to the other processes, (keeping the first nlocal for itself). From here, process 0 should print out it's results after running the CompareSplit algorithm. Then, receive the results from the other processes run of the algorithm. Finally, print out the results that it has just received. I have a large chunk of this already done, but I'm getting a deadlock that I can't seem to fix. I would greatly appreciate any hints that people could give me. Here is my code http://pastie.org/3742474 Right now I'm pretty sure that the deadlock is coming from the Send/Recv at lines 134 and 151. I've tried changing the Send to use "tag" instead of myrank for the tag parameter..but when I did that I just keep getting a "MPI_ERR_TAG: invalid tag" for some reason. Obviously I would also run the algorithm within the processors 0 but I took that part out for now, until I figure out what is going wrong. Any help is appreciated.

    Read the article

  • PHP – Slow String Manipulation

    - by Simon Roberts
    I have some very large data files and for business reasons I have to do extensive string manipulation (replacing characters and strings). This is unavoidable. The number of replacements runs into hundreds of thousands. It's taking longer than I would like. PHP is generally very quick but I'm doing so many of these string manipulations that it's slowing down and script execution is running into minutes. This is a pain because the script is run frequently. I've done some testing and found that str_replace is fastest, followed by strstr, followed by preg_replace. I've also tried individual str_replace statements as well as constructing arrays of patterns and replacements. I'm toying with the idea of isolating string manipulation operation and writing in a different language but I don't want to invest time in that option only to find that improvements are negligible. Plus, I only know Perl, PHP and COBOL so for any other language I would have to learn it first. I'm wondering how other people have approached similar problems? I have searched and I don't believe that this duplicates any existing questions.

    Read the article

  • How to get around LazyInitializationException in scheduled jobs?

    - by Shreerang
    I am working on a J2EE server application which is deployed on Tomcat. I use Spring source as MVC framework and Hibernate as ORM provider. My object model has lot of Lazy relationships (dependent objects are fetched on request). The high level design is like Service level methods call a few DAO methods to perform database operation. The service method is called either from the Flex UI or as a scheduled job. When it is called from Flex UI, the service method works fine i.e. it fetches some objects using DAO methods and even Lazy loading works. This is possible by the use of OpenSessionInViewFilter configured with the UI servlet. But when the same service method is called as scheduled Job, it gives LazyInitializationException. I can not configure OpenSessionInViewFilter because there is no servlet or UI request associated with that. I tried configuring Transaction around the scheduled job method so that service method starts a transaction and all the DAO methods participate in that same transaction, hoping that the transaction will remain active and hibernate session will be available. But it does not work. Please suggest if anyone has ever been able to get such a configuration working. If needed, I can post the Hibernate configuration and log messages. Thanks a lot for help! Shreerang

    Read the article

  • numpy array assignment problem

    - by Sujan
    Hi All: I have a strange problem in Python 2.6.5 with Numpy. I assign a numpy array, then equate a new variable to it. When I perform any operation to the new array, the original's values also change. Why is that? Please see the example below. Kindly enlighten me, as I'm fairly new to Python, and programming in general. -Sujan >>> import numpy as np >>> a = np.array([[1,2],[3,4]]) >>> b = a >>> b array([[1, 2], [3, 4]]) >>> c = a >>> c array([[1, 2], [3, 4]]) >>> c[:,1] = c[:,1] + 5 >>> c array([[1, 7], [3, 9]]) >>> b array([[1, 7], [3, 9]]) >>> a array([[1, 7], [3, 9]])

    Read the article

  • Creating new image in a loop using OpenCV

    - by user565415
    I am programing some image conversion code with OpenCV and I don't know how can I create image memory buffer to load image on every iteration. I have number of iteration (maxImNumber) and I have an input image. In every loop program must create image that is resized and modified input image. Here is some basic code (concept). for (int imageIndex = 0; imageIndex < maxImNumber; imageIndex++){ cvCopy(inputImage, images[imageIndex], 0); cvReleaseImage(&inputImage); images[imageIndex+1] = cvCreateImage(cvSize((image[imageIndex]->width)/2, image[imageIndex]->height), IPL_DEPTH_8U, 1); for (i=1; i < image[imageIndex]->height; i++) { index = 0; // for(j=0; j < image[imageIndex]->width ; j=j+2){ // doing some basic matematical operation on image content and store it to new image images[imageIndex+1][i][index] = (image[imageIndex][i][j] + image[imageIndex][i][j+2])/2; index++ } } inputImage = cvCreateImage(cvSize((image[imageIndex+1]->width), image[imageIndex]->height), IPL_DEPTH_8U, 1); cvCopy(images[imageIndex+1], inputImage, 0); } Can somebody, please, explain how can I create this image buffer (images[]) and allocate memory for it. Also how can I access any image in this buffer? Thank you very much in advance!

    Read the article

  • What is the fastest way to get a DataTable into SQL Server?

    - by John Gietzen
    I have a DataTable in memory that I need to dump straight into a SQL Server temp table. After the data has been inserted, I transform it a little bit, and then insert a subset of those records into a permanent table. The most time consuming part of this operation is getting the data into the temp table. Now, I have to use temp tables, because more than one copy of this app is running at once, and I need a layer of isolation until the actual insert into the permanent table happens. What is the fastest way to do a bulk insert from a C# DataTable into a SQL Temp Table? I can't use any 3rd party tools for this, since I am transforming the data in memory. My current method is to create a parameterized SqlCommand: INSERT INTO #table (col1, col2, ... col200) VALUES (@col1, @col2, ... @col200) and then for each row, clear and set the parameters and execute. There has to be a more efficient way. I'm able to read and write the records on disk in a matter of seconds...

    Read the article

  • How to write a "thread safe" function in C ?

    - by Andrei Ciobanu
    Hello I am writing some data structures in C, and I've realized that their associated functions aren't thread safe. The i am writing code uses only standard C, and I want to achieve some sort of 'synchronization'. I was thinking to do something like this: enum sync_e { TRUE, FALSE }; typedef enum sync_e sync; struct list_s { //Other stuff struct list_node_s *head; struct list_node_s *tail; enum sync_e locked; }; typedef struct list_s list; , to include a "boolean" field in the list structure that indicates the structures state: locked, unlocked. For example an insertion function will be rewritten this way: int list_insert_next(list* l, list_node *e, int x){ while(l->locked == TRUE){ /* Wait */ } l->locked = TRUE; /* Insert element */ /* -------------- */ l->locked = FALSE; return (0); } While operating on the list the 'locked' field will be set to TRUE, not allowing any other alterations. After operation completes the 'locked' field will be again set to 'TRUE'. Is this approach good ? Do you know other approaches (using only standard C).

    Read the article

  • How to set buffer size in client-server app using sockets?

    - by nelly
    First of all i am new to networking so i may say dumb thing in here. Considering a client-server application using sockets(.net with c# if that matters). The client sends some data, the server process it and sends back a string. The client sends some other data, the serve process it, queries the db and sends back several hundreds of items from the database The client sends some other type of data and the server notifies some other clients . My question is how to set the buffer size correctly for reading/writing operation. Should i do something like this: byte[] buff = new byte[client.ReceiveBufferSize] ? I am thinking of something like this: Client sends data to the server(and the server will follow the same pattern) byte[] bytesToSend=new byte[2048] //2048 to be standard for any command send by the client bytes 0..1 ->command type bytes 1..2047 ->command parameters byte[] bytesToReceive=new byte[8]/byte[64]/byte[8192] //switch(command type) But..what is happening when a client is notified by the server without sending data? What is the correct way to accomplish what i am trying to do? Thanks for reading.

    Read the article

  • Is locking on the requested object a bad idea?

    - by Quick Joe Smith
    Most advice on thread safety involves some variation of the following pattern: public class Thing { private static readonly object padlock = new object(); private string stuff, andNonsense; public string Stuff { get { lock (Thing.padlock) { if (this.stuff == null) this.stuff = "Threadsafe!"; } return this.stuff; } } public string AndNonsense { get { lock (Thing.padlock) { if (this.andNonsense == null) this.andNonsense = "Also threadsafe!"; } return this.andNonsense; } } // Rest of class... } In cases where the get operations are expensive and unrelated, a single locking object is unsuitable because a call to Stuff would block all calls to AndNonsense, degrading performance. And rather than create a lock object for each call, wouldn't it be better to acquire the lock on the member itself (assuming it is not something that implements SyncRoot or somesuch for that purpose? For example: public string Stuff { get { lock (this.stuff) { // Pretend that this is a very expensive operation. if (this.stuff == null) this.stuff = "Still threadsafe and good?"; } return this.stuff; } } Strangely, I have never seen this approach recommended or warned against. Am I missing something obvious?

    Read the article

  • How to set up a load/stress test for a web site?

    - by Ryan
    I've been tasked with stress/load testing our company web site out of the blue and know nothing about doing so. Every search I make on google for "how to load test a web site" just comes back with various companies and software to physically do the load testing. For now I'm more interested in how to actually go about setting up a load test like what I should take into account prior to load testing, what pages within my site I should be testing load against and what things I'm going to want to monitor when doing the test. Our web site is on a multi-tier system complete with a separate database server (IIS 7 Web Server, SQL Server 2000 db). I imagine I'd want to monitor both the web server and the database server for testing load however when setting up scenarios to load test the web server I'd have to use pages that query the database to see any load on the database server at the same time. Are web servers and database servers generally tested simultaneously or are they done as separate tests? As you can see I'm pretty clueless as to the whole operation so any incite as to how to go about this would be very helpful. FYI I have been tinkering with Pylot and was able to create and run a scenario against our site but I'm not sure what I should be looking for in the results or if the scenario I created is even a scenario worth measuring for our site. Thanks in advance.

    Read the article

  • C# threading solution for long queries

    - by Eddie
    Senerio We have an application that records incidents. An external database needs to be queried when an incident is approved by a supervisor. The queries to this external database are sometimes taking a while to run. This lag is experienced through the browser. Possible Solution I want to use threading to eliminate the simulated hang to the browser. I have used the Thread class before and heard about ThreadPool. But, I just found BackgroundWorker in this post. MSDN states: The BackgroundWorker class allows you to run an operation on a separate, dedicated thread. Time-consuming operations like downloads and database transactions can cause your user interface (UI) to seem as though it has stopped responding while they are running. When you want a responsive UI and you are faced with long delays associated with such operations, the BackgroundWorker class provides a convenient solution. Is BackgroundWorker the way to go when handling long running queries? What happens when 2 or more BackgroundWorker processes are ran simultaneously? Is it handled like a pool?

    Read the article

  • Parse files in directory/insert in database

    - by jakesankey
    Hey there, Here is my dillema... I have a directory full of .txt comma delimited files arranged as shown below. What I want to do is to import each of these into a SQL or SQLite database, appending each one below the last. (1 table)... I am open to C# or VB scripting and just not sure how to accomplish this. I want to only extract and import the data starting BELOW the 'Feat. Type,Feat. Name, etc' line. These are stored in a \mynetwork\directory\stats folder on my network drive. Ideally I will be able to add functionality that will make the software/script know not to re-add the file to the database once it has already done so as well. Any guidance or tips is appreciated! $$ SAMPLE= $$ FIXTURE=- $$ OPERATOR=- $$ INSPECTION PROCESS=CMM #4 $$ PROCESS OPERATION=- $$ PROCESS SEQUENCE=- $$ TRIAL=- Feat. Type,Feat. Name,Value,Actual,Nominal,Dev.,Tol-,Tol+,Out of Tol.,Comment Point,_FF_PLN_A_1,X,-17.445,-17.445,0.000,-999.000,999.000,, Point,_FF_PLN_A_1,Y,-195.502,-195.502,0.000,-999.000,999.000,, Point,_FF_PLN_A_1,Z,32.867,33.500,-0.633,-0.800,0.800,, Point,_FF_PLN_A_2,X,-73.908,-73.908,0.000,-999.000,999.000,, Point,_FF_PLN_A_2,Y,-157.957,-157.957,0.000,-999.000,999.000,, Point,_FF_PLN_A_2,Z,32.792,33.500,-0.708,-0.800,0.800,, Point,_FF_PLN_A_3,X,-100.180,-100.180,0.000,-999.000,999.000,, Point,_FF_PLN_A_3,Y,-142.797,-142.797,0.000,-999.000,999.000,, Point,_FF_PLN_A_3,Z,32.768,33.500,-0.732,-0.800,0.800,, Point,_FF_PLN_A_4,X,-160.945,-160.945,0.000,-999.000,999.000,, Point,_FF_PLN_A_4,Y,-112.705,-112.705,0.000,-999.000,999.000,, Point,_FF_PLN_A_4,Z,32.719,33.500,-0.781,-0.800,0.800,, Point,_FF_PLN_A_5,X,-158.096,-158.096,0.000,-999.000,999.000,, Point,_FF_PLN_A_5,Y,-73.821,-73.821,0.000,-999.000,999.000,, Point,_FF_PLN_A_5,Z,32.756,33.500,-0.744,-0.800,0.800,, Point,_FF_PLN_A_6,X,-195.670,-195.670,0.000,-999.000,999.000,, Point,_FF_PLN_A_6,Y,-17.375,-17.375,0.000,-999.000,999.000,, Point,_FF_PLN_A_6,Z,32.767,33.500,-0.733,-0.800,0.800,, Point,_FF_PLN_A_7,X,-173.759,-173.759,0.000,-999.000,999.000,, Point,_FF_PLN_A_7,Y,14.876,14.876,0.000,-999.000,999.000,,

    Read the article

  • FileSystemWatcher Work is Done?

    - by Snowy
    I setup a FsWatcher on a local filesystem directory. I only want to know when files are added to the directory so they can be moved to another filesystem. I seem to be able to detect when the first file is in, but actually I want to know when all files from a given copy operation are done. If I used Windows Explorer to copy files from one directory to another, Explorer would tell me that there are n seconds left in the transfer, so while there is some activity for the begin-transfer and end-transfer for each file, it appears that there is something for the begin-transfer and end-transfer for all files. I wonder if there is something similar that I can do just with the .NET Framework. I would like to know when "all" files are in and not just a single file in a "transaction". If there is nothing baked in, maybe I should come up with some kind of waiting/countering in order to only do my activity when a job is "done". Not sure if I'm making 100% sense on this one, please anyone comment. Thanks.

    Read the article

< Previous Page | 173 174 175 176 177 178 179 180 181 182 183 184  | Next Page >