Search Results

Search found 21972 results on 879 pages for 'on duplicate key'.

Page 179/879 | < Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >

  • How to pass an associative array as argument to a function in Bash?

    - by niksfirefly
    How do you pass an associative array as an argument to a function? Is this possible in Bash? The code below is not working as expected: function iterateArray { local ADATA="${@}" # associative array for key in "${!ADATA[@]}" do echo "key - ${key}" echo "value: ${ADATA[$key]}" done } Passing associative arrays to a function like normal arrays does not work: iterateArray "$A_DATA" or iterateArray "$A_DATA[@]"

    Read the article

  • mysql error #1452 appearing when trying to add a constraint

    - by user1701484
    I am trying to alter a table so That I can add a foreign key constraint in mysql database: ALTER TABLE `Question` ADD CONSTRAINT `FK_question` FOREIGN KEY (`QuestionId`) REFERENCES `Image_Question` (`QuestionId`) ON DELETE CASCADE ; Problem is that it is giving me this error: 1452 - Cannot add or update a child row: a foreign key constraint fails (mobile_app. '#sql-4517_15241', CONSTRAINT FK_question FOREIGN KEY (QuestionId) REFERENCES Image_Question (QuestionId) ON DELETE CASCADE) What does this error actually mean and what are the possible solutions I might have to undertake in order to fix this?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Loop through a Map with JSTL

    - by Dean
    I'm looking to have JSTL loop through a Map and output the value of the key and it's value. For example I have a Map which can have any number of entries, i'd like to loop through this map using JSTL and output both the key and it's value. I know how to access the value using the key, ${myMap['keystring']}, but how do I access the key?

    Read the article

  • How to use HTTP method DELETE on Google App Engine?

    - by Jader Dias
    I can use this verb in the Python Windows SDK. But not in production. Why? What am I doing wrong? The error message includes (only seen via firebug or fiddler) Malformed request or something like that My code looks like: from google.appengine.ext import db from google.appengine.ext import webapp class Handler(webapp.RequestHandler): def delete(self): key = self.request.get('key') item = db.get(key) item.delete() self.response.out.write(key)

    Read the article

  • Security review of an authenticated Diffie Hellman variant

    - by mtraut
    EDIT I'm still hoping for some advice on this, i tried to clarify my intentions... When i came upon device pairing in my mobile communication framework i studied a lot of papers on this topic and and also got some input from previous questions here. But, i didn't find a ready to implement protocol solution - so i invented a derivate and as i'm no crypto geek i'm not sure about the security caveats of the final solution: The main questions are Is SHA256 sufficient as a commit function? Is the addition of the shared secret as an authentication info in the commit string safe? What is the overall security of the 1024 bit group DH I assume at most 2^-24 bit probability of succesful MITM attack (because of 24 bit challenge). Is this plausible? What may be the most promising attack (besides ripping the device out off my numb, cold hands) This is the algorithm sketch For first time pairing, a solution proposed in "Key agreement in peer-to-peer wireless networks" (DH-SC) is implemented. I based it on a commitment derived from: A fix "UUID" for the communicating entity/role (128 bit, sent at protocol start, before commitment) The public DH key (192 bit private key, based on the 1024 bit Oakley group) A 24 bit random challenge Commit is computed using SHA256 c = sha256( UUID || DH pub || Chall) Both parties exchange this commitment, open and transfer the plain content of the above values. The 24 bit random is displayed to the user for manual authentication DH session key (128 bytes, see above) is computed When the user opts for persistent pairing, the session key is stored with the remote UUID as a shared secret Next time devices connect, commit is computed by additionally hashing the previous DH session key before the random challenge. For sure it is not transfered when opening. c = sha256( UUID || DH pub || DH sess || Chall) Now the user is not bothered authenticating when the local party can derive the same commitment using his own, stored previous DH session key. After succesful connection the new DH session key becomes the new shared secret. As this does not exactly fit the protocols i found so far (and as such their security proofs), i'd be very interested to get an opinion from some more crypto enabled guys here. BTW. i did read about the "EKE" protocol, but i'm not sure what the extra security level is.

    Read the article

  • Is it possible to use pure Encrypting and Decrypting keys in asymmetric cryptography instead of priv

    - by macropas
    Is it possible to use pure Encrypting and Decrypting keys instead of private and public keys? As I know in .Net asymmetric RSA implementation private key RSAParameters parameters = (new RSACryptoServiceProvider()).ExportParameters(true) is a superset of public key. And using private key we can both encrypt and decrypt our data. But I need key only for decrypting data. How to do it? I experimented on nulling RSAParameters fields, but RSACryptoServiceProvider object can't import such parameters.

    Read the article

  • Is HashMap in Java collision safe

    - by changed
    Hi I am developing a parser that needs to put key value pairs in hashmap. But a key can have multiple values which i can do in this way HashMap<String,ArrayList<String>> . But what happens if number of keys are very large and it start matching with other key's hashcode. Will that rewrite previous key's value ? thanks -devSunday

    Read the article

  • C# Keyboard Input (Beginner Help)

    - by ThickBook
    I am trying to ask user "enter any key and when that key is pressed it shows that "You Pressed "Key". Can you help what's wrong in this code? This is what I have written using System; class Program { public static void Main(string[] args) { Console.Write("Enter any Key: "); char name = Console.Read(); Console.WriteLine("You pressed {0}", name); } }

    Read the article

  • Change|Assign parent for the Model instance on Google App Engine Datastore

    - by Vladimir Prudnikov
    Is it possible to change or assign new parent to the Model instance that already in datastore? For example I need something like this task = db.get(db.Key(task_key)) project = db.get(db.Key(project_key)) task.parent = project task.put() but it doesn't works this way because task.parent is built-in method. I was thinking about creating a new Key instance for the task but there is no way to change key as well. Any thoughts?

    Read the article

  • Foreign Keys in SQLITE in the Google Gears framework

    - by Maxim Gershkovich
    Hi all, Could someone please tell me why the following foreign key constraint (although executes fine) is not enforced by SQLITE? Could someone pleasse provide an example of how I can go about enforcing the relationship? CREATE TABLE User (UserID TEXT Unique NOT NULL PRIMARY KEY, FirstName TEXT NOT NULL, LastName TEXT NOT NULL, Username TEXT NOT NULL, Password TEXT NOT NULL, Email TEXT NOT NULL, SignupDate TEXT NOT NULL) CREATE TABLE Category (CategoryID TEXT Unique NOT NULL PRIMARY KEY, UserID TEXT, FOREIGN KEY(UserID) REFERENCES User(UserID))

    Read the article

  • Adding keys to superglobals in php

    - by gautam kumar
    Is there any way by which I can add keys to superglobals in php without defining the corresponding values to those key? For example: $_SESSION['key']='set';//key` automatically gets defined. But I want to do something like this add_key($_SESSION,'key')//key is added to $_SESSION array. Is it possible?

    Read the article

  • MySql Alter Syntax error with mulitple FK

    - by acidzombie24
    If i do the first one i have no problem. When i do addition i get a syntax error. What is wrong with the syntax? The error says syntax error near [entire 2nd line] alter table `ban_Status` add FOREIGN KEY (`banned_user`) REFERENCES `user_data`(`id`) alter table `ban_Status` add FOREIGN KEY (`banned_user`) REFERENCES `user_data`(`id`), FOREIGN KEY (`banning_user`) REFERENCES `user_data`(`id`), FOREIGN KEY (`unban_user`) REFERENCES `user_data`(`id`)

    Read the article

  • Basic question about encryption - what exactly are keys?

    - by Tomas
    Hi, I was browsing and found good articles about encryption. However, none of them described why the key lenght is important and what exactly the key is used for. My guess is that could work this way: 0101001101010101010 Key: 01010010101010010101 //the longer the key, the longer unique sequence XOR or smth: //result Is this at least a bit how it works or I am missing something? Thanks

    Read the article

  • Why doesn't HashTable.Contains() just simply return false if it is passed a null?

    - by Nate Pinchot
    I understand why passing a null to HashTable.Contains() doesn't work, but I don't understand what the point of it throwing an ArgumentNullException is - instead of just simply returning false? What is the benefit of throwing the exception (other than to make me do null checks before calling .Contains())? Caused By [System.ArgumentNullException] Key cannot be null. Parameter name: key at System.Collections.Hashtable.ContainsKey(Object key) at System.Collections.Hashtable.Contains(Object key)

    Read the article

  • Why is Dictionary.First() so slow?

    - by Rotsor
    Not a real question because I already found out the answer, but still interesting thing. I always thought that hash table is the fastest associative container if you hash properly. However, the following code is terribly slow. It executes only about 1 million iterations and takes more than 2 minutes of time on a Core 2 CPU. The code does the following: it maintains the collection todo of items it needs to process. At each iteration it takes an item from this collection (doesn't matter which item), deletes it, processes it if it wasn't processed (possibly adding more items to process), and repeats this until there are no items to process. The culprit seems to be the Dictionary.Keys.First() operation. The question is why is it slow? Stopwatch watch = new Stopwatch(); watch.Start(); HashSet<int> processed = new HashSet<int>(); Dictionary<int, int> todo = new Dictionary<int, int>(); todo.Add(1, 1); int iterations = 0; int limit = 500000; while (todo.Count > 0) { iterations++; var key = todo.Keys.First(); var value = todo[key]; todo.Remove(key); if (!processed.Contains(key)) { processed.Add(key); // process item here if (key < limit) { todo[key + 13] = value + 1; todo[key + 7] = value + 1; } // doesn't matter much how } } Console.WriteLine("Iterations: {0}; Time: {1}.", iterations, watch.Elapsed); This results in: Iterations: 923007; Time: 00:02:09.8414388. Simply changing Dictionary to SortedDictionary yields: Iterations: 499976; Time: 00:00:00.4451514. 300 times faster while having only 2 times less iterations. The same happens in java. Used HashMap instead of Dictionary and keySet().iterator().next() instead of Keys.First().

    Read the article

  • How can I map a String to a function in Java?

    - by Bears will eat you
    Currently, I have a bunch of Java classes that implement a Processor interface, meaning they all have a processRequest(String key) method. The idea is that each class has a few (say, <10) member Strings, and each of those maps to a method in that class via the processRequest method, like so: class FooProcessor implements Processor { String key1 = "abc"; String key2 = "def"; String key3 = "ghi"; // and so on... String processRequest(String key) { String toReturn = null; if (key1.equals(key)) toReturn = method1(); else if (key2.equals(key)) toReturn = method2(); else if (key3.equals(key)) toReturn = method3(); // and so on... return toReturn; } String method1() { // do stuff } String method2() { // do other stuff } String method3() { // do other other stuff } // and so on... } You get the idea. This was working fine for me, but now I need a runtime-accessible mapping from key to function; not every function actually returns a String (some return void) and I need to dynamically access the return type (using reflection) of each function in each class that there's a key for. I already have a manager that knows about all the keys, but not the mapping from key to function. My first instinct was to replace this mapping using if-else statements with a Map<String, Function>, like I could do in Javascript. But, Java doesn't support first-class functions so I'm out of luck there. I could probably dig up a third-party library that lets me work with first-class functions, but I haven't seen any yet, and I doubt that I need an entire new library. I also thought of putting these String keys into an array and using reflection to invoke the methods by name, but I see two downsides to this method: My keys would have to be named the same as the method - or be named in a particular, consistent way so that it's easy to map them to the method name. This seems WAY slower than the if-else statements I have right now. Efficiency is something of a concern because these methods will tend to get called pretty frequently, and I want to minimize unnecessary overhead. TL; DR: I'm looking for a clean, minimal-overhead way to map a String to some sort of a Function object that I can invoke and call (something like) getReturnType() on. I don't especially mind using a 3rd-party library if it really fits my needs. I also don't mind using reflection, though I would strongly prefer to avoid using reflection every single time I do a method lookup - maybe using some caching strategy that combines the Map with reflection. Thoughts on a good way to get what I want? Cheers!

    Read the article

  • git clone with ssh issue

    - by george
    Hi, I have generated a public key, private key pair. I've set the public key to the site. How to use the console in windows to clone a git repository? What do I do with the private key? I keep getting: the remote end hung up unexp. Thanks

    Read the article

  • Replace a method call

    - by deV
    Hi, I want to achieve below task: 1. I need to search Html.Resource("key") in my application and replace it with GetResource("key",object) 2. The GetResource method has two parameters: the first parameter should be the same as the original method,"key" in this case, and I need to pass in the second parameter which is variable. 3. I need to replace only when the Html.Resource("key") occurs inside certain tags like td and div else I need not replace it. Thanks in advance

    Read the article

  • Does UNIQ constraint mean also an index on that field(s)?

    - by Gremo
    As title, should i defined a separate index on email column (for searching purposes) or the index is "automatically" added along with UNIQ_EMAIL_USER constraint? CREATE TABLE IF NOT EXISTS `customer` ( `id` int(11) NOT NULL AUTO_INCREMENT, `user_id` int(11) NOT NULL, `first` varchar(255) NOT NULL, `last` varchar(255) NOT NULL, `slug` varchar(255) NOT NULL, `email` varchar(255) NOT NULL, `created_at` datetime NOT NULL, `updated_at` datetime NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `UNIQ_SLUG` (`slug`), UNIQUE KEY `UNIQ_EMAIL_USER` (`email`,`user_id`), KEY `IDX_USER` (`user_id`) ) ENGINE=InnoDB;

    Read the article

  • C# - Inserting and Removing from Cache

    - by Nir
    1 - If I insert to Cache by assigning the value: Cache["key"] = value; what's the expiration time? 2 - Removing the same value from Cache: I want to check if the value is in Cache by if(Cache["key"]!=null), is it better to remove it from Cache by Cache.Remove("key") or Cache["key"]=null ?

    Read the article

  • Des Encrypion...

    - by SunilRai86
    i have done Des encryption which requires 64 bit key .the main problem is that when i insert any 64 bit key it decrypted .(the key used in encryption and the key for decryption is not same).

    Read the article

  • SQL Alter: add multiple FKs?

    - by acidzombie24
    From here ALTER TABLE ORDERS ADD FOREIGN KEY (customer_sid) REFERENCES CUSTOMER(SID); How do i add several keys with SQL Server? is it something like the below? (I cant test ATM and unfortunately i have no way to test queries unless i run it through code) ALTER TABLE ORDERS ADD FOREIGN KEY (customer_sid) REFERENCES CUSTOMER(SID), ADD FOREIGN KEY (customer_sid2) REFERENCES CUSTOMER(SID2); or is it like ALTER TABLE ORDERS ADD FOREIGN KEY (customer_sid, customer_sid2) REFERENCES CUSTOMER(SID, SID2)

    Read the article

  • Allocating Entities within an Entity System

    - by miguel.martin
    I'm quite unsure how I should allocate/resemble my entities within my entity system. I have various options, but most of them seem to have cons associated with them. In all cases entities are resembled by an ID (integer), and possibly has a wrapper class associated with it. This wrapper class has methods to add/remove components to/from the entity. Before I mention the options, here is the basic structure of my entity system: Entity An object that describes an object within the game Component Used to store data for the entity System Contains entities with specific components Used to update entities with specific components World Contains entities and systems for the entity system Can create/destroy entites and have systems added/removed from/to it Here are my options, that I have thought of: Option 1: Do not store the Entity wrapper classes, and just store the next ID/deleted IDs. In other words, entities will be returned by value, like so: Entity entity = world.createEntity(); This is much like entityx, except I see some flaws in this design. Cons There can be duplicate entity wrapper classes (as the copy-ctor has to be implemented, and systems need to contain entities) If an Entity is destroyed, the duplicate entity wrapper classes will not have an updated value Option 2: Store the entity wrapper classes within an object pool. i.e. Entities will be return by pointer/reference, like so: Entity& e = world.createEntity(); Cons If there is duplicate entities, then when an entity is destroyed, the same entity object may be re-used to allocate another entity. Option 3: Use raw IDs, and forget about the wrapper entity classes. The downfall to this, I think, is the syntax that will be required for it. I'm thinking about doing thisas it seems the most simple & easy to implement it. I'm quite unsure about it, because of the syntax. i.e. To add a component with this design, it would look like: Entity e = world.createEntity(); world.addComponent<Position>(e, 0, 3); As apposed to this: Entity e = world.createEntity(); e.addComponent<Position>(0, 3); Cons Syntax Duplicate IDs

    Read the article

  • IIS SSL Certificate Renewal Pain

    - by Rick Strahl
    I’m in the middle of my annual certificate renewal for the West Wind site and I can honestly say that I hate IIS’s certificate system.  When it works it’s fine, but when it doesn’t man can it be a pain. Because I deal with public certificates on my site merely once a year, and you have to perform the certificate dance just the right way, I seem to run into some sort of trouble every year, thinking that Microsoft surely must have addressed the issues I ran into previously – HA! Not so. Don’t ever use the Renew Certificate Feature in IIS! The first rule that I should have never forgotten is that certificate renewals in IIS (7 is what I’m using but I think it’s no different in 7.5 and 8), simply don’t work if you’re submitting to get a public certificate from a certificate authority. I use DNSimple for my DNS domain management and SSL certificates because they provide ridiculously easy domain management and good prices for SSL certs – especially wildcard certificates, which is what I use on west-wind.com. Certificates in IIS can be found pegged to the machine root. If you go into the IIS Manager, go to the machine root the tree and then click on certificates and you then get various certificate options: Both of these options create a new Certificate request (CSR), which is just a text file. But if you’re silly enough like me to click on the Renew button on your old certificate, you’ll find that you end up generating a very long Certificate Request that looks nothing like the original certificate request and the format that’s used for this is not accepted by most certificate authorities. While I’m not sure exactly what the problem is, it simply looks like IIS is respecting none of your original certificate bit size choices and is generating a huge certificate request that is 3 times the size of a ‘normal’ certificate request. The end result is (and I’ve done this at least twice now) is that the certificate processor is likely to fail processing those renewals. Always create a new Certificate While it’s a little more work and you have to remember how to fill out the certificate request properly, this is the safe way to make sure your certificate generates properly. First comes the Distinguished Name Properties dialog: Ah yes you have to love the nomenclature of this stuff. Distinguished name, Common name – WTF is a common name? It doesn’t look common to me! Make sure this form gets filled out correctly. Common NameThis is the domain name of the Web site. In my case I’m creating a wildcard certificate so I’m using the * prefix. If you’re purchasing a certificate for a specific domain use www.west-wind.com or store.west-wind.com for example. Make sure this matches the EXACT domain you’re trying to use secure access on because that’s all the certificate is going to work on unless you get a wildcard certificate. Organization Is the name of your company or organization. Depending on the kind of certificate you purchase this name will show up on your certificate. Most low end SSL certificates (ie. those that cost under $100 for single domains) don’t list the organization, the higher signature certificates that also require extensive validation by the cert authority do. Regardless you should make sure this matches the right company/organization. Organizational Unit This can be anything. Not really sure what this is for, but traditionally I’ve always set this to Web because – well this is a Web thing after all right? I’ve never seen this used anywhere that I can tell other than to internally reference the cert. State and CountryPretty obvious. Should reflect the location of the business/organization/person or site.   Next you have to configure the bit size used for the certificate: The default on this dialog is 1024, but I’ve found that most providers these days request a minimum bit length of 2048, as did my DNSimple provider. Again check with the provider when you submit to make sure. Bit length mismatches can cause problems if you use a size that isn’t supported by the provider. I had that happen last year when I submitted my CSR and it got rejected quite a bit later, when the certs usually are issued within an hour or less. When you’re done here, the certificate is saved to disk as a .txt file and it should look something like this (this is a 2048 bit length CSR):-----BEGIN NEW CERTIFICATE REQUEST----- MIIEVGCCAz0CAQAwdjELMAkGA1UEBhMCVVMxDzANBgNVBAgMBkhhd2FpaTENMAsG A1UEBwwEUGFpYTEfMB0GA1UECgwWV2VzdCBXaW5kIFRlY2hub2xvZ2llczEMMAoG B1UECwwDV2ViMRgwFgYDVQQDDA8qLndlc3Qtd2luZC5jb20wggEiMA0GCSqGSIb3 DQEBAQUAA4IBDwAwggEKAoIBAQDIPWOFMkMVRp2Ftj9w/cCVV4OYYhoZYtl+8lTk oqDwKca0xWHLgioX/9v0rZLS6a82MHqKEBxVXu+cuCmSE4AQtB/1YH9lS4tpc/be OZDvnTotP6l4MCEzzAfROcw4CiIg6X0RMSnl8IATAvv2V5LQM9TDdt9oDdMpX2IY +vVC9RZ7PMHBmR9kwI2i/lrKitzhQKaHgpmKcRlM6iqpALUiX28w5HJaDKK1MDHN 607tyFJLHijuJKx7PdTqZYf50KkC3NupfZ2avVycf18Q13jHWj59tvwEOczoVzRL l4LQivAqbhyiqMpWnrZunIOUZta5aGm+jo7O1knGWJjxuraTAgMBAAGgggGYMBoG CisGAQQBgjcNAgMxDBYKNi4yLjkyMDAuMjA0BgkrBgEEAYI3FRQxJzAlAgEFDAZS QVNYUFMMC1JBU1hQU1xSaWNrDAtJbmV0TWdyLmV4ZTByBgorBgEEAYI3DQICMWQw YgIBAR5aAE0AaQBjAHIAbwBzAG8AZgB0ACAAUgBTAEEAIABTAEMAaABhAG4AbgBl AGwAIABDAHIAeQBwAHQAbwBnAHIAYQBwAGgAaQBjACAAUAByAG8AdgBpAGQAZQBy AwEAMIHPBgkqhkiG9w0BCQ4xgcEwgb4wDgYDVR0PAQH/BAQDAgTwMBMGA1UdJQQM MAoGCCsGAQUFBwMBMHgGCSqGSIb3DQEJDwRrMGkwDgYIKoZIhvcNAwICAgCAMA4G CCqGSIb3DQMEAgIAgDALBglghkgBZQMEASowCwYJYIZIAWUDBAEtMAsGCWCGSAFl AwQBAjALBglghkgBZQMEAQUwBwYFKw4DAgcwCgYIKoZIhvcNAwcwHQYDVR0OBBYE FD/yOsTbXE+GVFCFMmldzQvyloz9MA0GCSqGSIb3DQEBBQUAA4IBAQCK6LlsCuIM 1AU0niB6QZ9v0FTsGFxP1dYvVUnJyY6VEKNiGFiQjZac7UCs0p58yScdXWEFOE8V OsjAYD3xYNc05+ckyD67UHRGEUAVB9RBvbKW23KeR/8kBmEzc8PemD52YOgExxAJ 57xWmAwEHAvbgYzQvhO8AOzH3TGvvHbg5UKM1pYgNmuwZq5DkL/IDoeIJwfk/wrI wghNTuxxIFgbH4YrgLgv4PRvrS/LaTCRBdboaCgzATMczaOb1nd/DVNR+3fCtMhM W0psTAjzRbmXF3nJyAQa7jF/52gkY0RfFX2lG5tJnG+XDsVNvKNvh9Qa5Tlmkm06 ILKCm9ciWCKk -----END NEW CERTIFICATE REQUEST----- You can take that certificate request and submit that to your certificate provider. Since this is base64 encoded you can typically just paste it into a text box on the submission page, or some providers will ask you to upload the CSR as a file. What does a Renewal look like? Note the length of the CSR will vary somewhat with key strength, but compare this to a renewal request that IIS generated from my existing site:-----BEGIN NEW CERTIFICATE REQUEST----- MIIPpwYFKoZIhvcNAQcCoIIPmDCCD5QCAQExCzAJBgUrDgMCGgUAMIIIqAYJKoZI hvcNAQcBoIIImQSCCJUwggiRMIIH+gIBADBdMSEwHwYDVQQLDBhEb21haW4gQ29u dHJvbCBWYWxpFGF0ZWQxHjAcBgNVBAsMFUVzc2VudGlhbFNTTCBXaWxkY2FyZDEY MBYGA1UEAwwPKi53ZXN0LXdpbmQuY29tMIGfMA0GCSqGSIb3DQEBAQUAA4GNADCB iQKBgQCK4OuIOR18Wb8tNMGRZiD1c9X57b332Lj7DhbckFqLs0ys8kVDHrTXSj+T Ye9nmAvfPpZmBtE5p9qRNN79rUYugAdl+qEtE4IJe1bRfxXzcKa1SXa8+TEs3zQa zYSmcR2dDuC8om1eAdeCtt0NnkvANgm1VLwGOor/UHMASaEhCQIDAQABoIIG8jAa BgorBgEEAYI3DQIDMQwWCjYuMi45MjAwLjIwNAYJKwYBBAGCNxUUMScwJQIBBQwG UkFTWFBTDAtSQVNYUFNcUmljawwLSW5ldE1nci5leGUwZgYKKwYBBAGCNw0CAjFY MFYCAQIeTgBNAGkAYwByAG8AcwBvAGYAdAAgAFMAdAByAG8AbgBnACAAQwByAHkA cAB0AG8AZwByAGEAcABoAGkAYwAgAFAAcgBvAHYAaQBkAGUAcgMBADCCAQAGCSqG SIb3DQEJDjGB8jCB7zAOBgNVHQ8BAf8EBAMCBaAwDAYDVR0TAQH/BAIwADA0BgNV HSUELTArBggrBgEFBQcDAQYIKwYBBQUHAwIGCisGAQQBgjcKAwMGCWCGSAGG+EIE ATBPBgNVHSAESDBGMDoGCysGAQQBsjEBAgIHMCswKQYIKwYBBQUHAgEWHWh0dHBz Oi8vc2VjdXJlLmNvbW9kby5jb20vQ1BTMAgGBmeBDAECATApBgNVHREEIjAggg8q Lndlc3Qtd2luZC5jb22CDXdlc3Qtd2luZC5jb20wHQYDVR0OBBYEFEVLAyO8gDiv lsfovKrx9mHPyrsiMIIFMAYJKwYBBAGCNw0BMYIFITCCBR0wggQFoAMCAQICEQDu 1E1T5Jvtkm5LOfSHabWlMA0GCSqGSIb3DQEBBQUAMHIxCzAJBgNVBAYTAkdCMRsw GQYDVQQIExJHcmVhdGVyIE1hbmNoZXN0ZXIxEDAOBgNVBAcTB1NhbGZvcmQxGjAY BgNVBAoTEUNPTU9ETyBDQSBMaW1pdGVkMRgwFgYDVQQDEw9Fc3NlbnRpYWxTU0wg Q0EwHhcNMTQwNTA3MDAwMDAwWhcNMTUwNjA2MjM1OTU5WjBdMSEwHwYDVQQLExhE b21haW4gQ29udHJvbCBWYWxpZGF0ZWQxHjAcBgNVBAsTFUVzc2VudGlhbFNTTCBX aWxkY2FyZDEYMBYGA1UEAxQPKi53ZXN0LXdpbmQuY29tMIIBIjANBgkqhkiG9w0B AQEFAAOCAQ8AMIIBCgKCAQEAiyKfL66XB51DlUfm6xXqJBcvMU2qorRHxC+WjEpB amvg8XoqNfCKzDAvLMbY4BLhbYCTagqtslnP3Gj4AKhXqRKU0n6iSbmS1gcWzCJM CHufZ5RDtuTuxhTdJxzP9YqZUfKV5abWQp/TK6V1ryaBJvdqM73q4tRjrQODtkiR PfZjxpybnBHFJS8jYAf8jcOjSDZcgN1d9Evc5MrEJCp/90cAkozyF/NMcFtD6Yj8 UM97z3MzDT2JPDoH3kAr3cCgpUNyQ2+wDNCnL9eWYFkOQi8FZMsZol7KlZ5NgNfO a7iZMVGbqDg6rkS//2uGe6tSQJTTs+mAZB+na+M8XT2UqwIDAQABo4IBwTCCAb0w HwYDVR0jBBgwFoAU2svqrVsIXcz//CZUzknlVcY49PgwHQYDVR0OBBYEFH0AmLiL RSEL9+sQD/n5O4N7/nnqMA4GA1UdDwEB/wQEAwIFoDAMBgNVHRMBAf8EAjAAMDQG A1UdJQQtMCsGCCsGAQUFBwMBBggrBgEFBQcDAgYKKwYBBAGCNwoDAwYJYIZIAYb4 QgQBME8GA1UdIARIMEYwOgYLKwYBBAGyMQECAgcwKzApBggrBgEFBQcCARYdaHR0 cHM6Ly9zZWN1cmUuY29tb2RvLmNvbS9DUFMwCAYGZ4EMAQIBMDsGA1UdHwQ0MDIw MKAuoCyGKmh0dHA6Ly9jcmwuY29tb2RvY2EuY29tL0Vzc2VudGlhbFNTTENBLmNy bDBuBggrBgEFBQcBAQRiMGAwOAYIKwYBBQUHMAKGLGh0dHA6Ly9jcnQuY29tb2Rv Y2EuY29tL0Vzc2VudGlhbFNTTENBXzIuY3J0MCQGCCsGAQUFBzABhhhodHRwOi8v b2NzcC5jb21vZG9jYS5jb20wKQYDVR0RBCIwIIIPKi53ZXN0LXdpbmQuY29tgg13 ZXN0LXdpbmQuY29tMA0GCSqGSIb3DQEBBQUAA4IBAQBqBfd6QHrxXsfgfKARG6np 8yszIPhHGPPmaE7xq7RpcZjY9H+8l6fe4jQbGFjbA5uHBklYI4m2snhPaW2p8iF8 YOkm2V2hEsSTnkf5/flw9mZtlCFEDFXSsBxBdNz8RYTthPMu1h09C0XuDB30sztg nR692FrxJN5/bXsk+MC9nEweTFW/t2HW+XZ8bhM7vsAS+pZionR4MyuQ0mYIt/lD csZVZ91KxTsIm8rNMkkYGFoSIXjQ0+0tCbxMF0i2qnpmNRpA6PU8l7lxxvPkplsk 9KB8QIPFrR5p/i/SUAd9vECWh5+/ktlcrfFP2PK7XcEwWizsvMrNqLyvQVNXSUPT MA0GCSqGSIb3DQEBBQUAA4GBABt/NitwMzc5t22p5+zy4HXbVYzLEjesLH8/v0ot uLQ3kkG8tIWNh5RplxIxtilXt09H4Oxpo3fKUN0yw+E6WsBfg0sAF8pHNBdOJi48 azrQbt4HvKktQkGpgYFjLsormjF44SRtToLHlYycDHBNvjaBClUwMCq8HnwY6vDq xikRoIIFITCCBR0wggQFoAMCAQICEQDu1E1T5Jvtkm5LOfSHabWlMA0GCSqGSIb3 DQEBBQUAMHIxCzAJBgNVBAYTAkdCMRswGQYDVQQIExJHcmVhdGVyIE1hbmNoZXN0 ZXIxEDAOBgNVBAcTB1NhbGZvcmQxGjAYBgNVBAoTEUNPTU9ETyBDQSBMaW1pdGVk MRgwFgYDVQQDEw9Fc3NlbnRpYWxTU0wgQ0EwHhcNMTQwNTA3MDAwMDAwWhcNMTUw NjA2MjM1OTU5WjBdMSEwHwYDVQQLExhEb21haW4gQ29udHJvbCBWYWxpZGF0ZWQx HjAcBgNVBAsTFUVzc2VudGlhbFNTTCBXaWxkY2FyZDEYMBYGA1UEAxQPKi53ZXN0 LXdpbmQuY29tMIIBIjANBgkqhkiG9w0BAQEFAAOCAQ8AMIIBCgKCAQEAiyKfL66X B51DlUfm6xXqJBcvMU2qorRHxC+WjEpBamvg8XoqNfCKzDAvLMbY4BLhbYCTagqt slnP3Gj4AKhXqRKU0n6iSbmS1gcWzCJMCHufZ5RDtuTuxhTdJxzP9YqZUfKV5abW Qp/TK6V1ryaBJvdqM73q4tRjrQODtkiRPfZjxpybnBHFJS8jYAf8jcOjSDZcgN1d 9Evc5MrEJCp/90cAkozyF/NMcFtD6Yj8UM97z3MzDT2JPDoH3kAr3cCgpUNyQ2+w DNCnL9eWYFkOQi8FZMsZol7KlZ5NgNfOa7iZMVGbqDg6rkS//2uGe6tSQJTTs+mA ZB+na+M8XT2UqwIDAQABo4IBwTCCAb0wHwYDVR0jBBgwFoAU2svqrVsIXcz//CZU zknlVcY49PgwHQYDVR0OBBYEFH0AmLiLRSEL9+sQD/n5O4N7/nnqMA4GA1UdDwEB /wQEAwIFoDAMBgNVHRMBAf8EAjAAMDQGA1UdJQQtMCsGCCsGAQUFBwMBBggrBgEF BQcDAgYKKwYBBAGCNwoDAwYJYIZIAYb4QgQBME8GA1UdIARIMEYwOgYLKwYBBAGy MQECAgcwKzApBggrBgEFBQcCARYdaHR0cHM6Ly9zZWN1cmUuY29tb2RvLmNvbS9D UFMwCAYGZ4EMAQIBMDsGA1UdHwQ0MDIwMKAuoCyGKmh0dHA6Ly9jcmwuY29tb2Rv Y2EuY29tL0Vzc2VudGlhbFNTTENBLmNybDBuBggrBgEFBQcBAQRiMGAwOAYIKwYB BQUHMAKGLGh0dHA6Ly9jcnQuY29tb2RvY2EuY29tL0Vzc2VudGlhbFNTTENBXzIu Y3J0MCQGCCsGAQUFBzABhhhodHRwOi8vb2NzcC5jb21vZG9jYS5jb20wKQYDVR0R BCIwIIIPKi53ZXN0LXdpbmQuY29tgg13ZXN0LXdpbmQuY29tMA0GCSqGSIb3DQEB BQUAA4IBAQBqBfd6QHrxXsfgfKARG6np8yszIPhHGPPmaE7xq7RpcZjY9H+8l6fe 4jQbGFjbA5uHBklYI4m2snhPaW2p8iF8YOkm2V2hEsSTnkf5/flw9mZtlCFEDFXS sBxBdNz8RYTthPMu1h09C0XuDB30sztgnR692FrxJN5/bXsk+MC9nEweTFW/t2HW +XZ8bhM7vsAS+pZionR4MyuQ0mYIt/lDcsZVZ91KxTsIm8rNMkkYGFoSIXjQ0+0t CbxMF0i2qnpmNRpA6PU8l7lxxvPkplsk9KB8QIPFrR5p/i/SUAd9vECWh5+/ktlc rfFP2PK7XcEwWizsvMrNqLyvQVNXSUPTMYIBrzCCAasCAQEwgYcwcjELMAkGA1UE BhMCR0IxGzAZBgNVBAgTEkdyZWF0ZXIgTWFuY2hlc3RlcjEQMA4GA1UEBxMHU2Fs Zm9yZDEaMBgGA1UEChMRQ09NT0RPIENBIExpbWl0ZWQxGDAWBgNVBAMTD0Vzc2Vu dGlhbFNTTCBDQQIRAO7UTVPkm+2Sbks59IdptaUwCQYFKw4DAhoFADANBgkqhkiG 9w0BAQEFAASCAQB8PNQ6bYnQpWfkHyxnDuvNKw3wrqF2p7JMZm+SuN2qp3R2LpCR mW2LrGtQIm9Iob/QOYH+8houYNVdvsATGPXX2T8gzn+anof4tOG0vCTK1Bp9bwf9 MkRP+1c8RW/vkYmUW4X5/C+y3CZpMH5dDTaXBIpXFzjX/fxNpH/rvLzGiaYYL3Cn OLO+aOADr9qq5yoqwpiYCSfYNNYKTUNNGfYIidQwYtbHXEYhSukB2oR89xD2sZZ4 bOqFjUPgTa5SsERLDDeg3omMKiIXVYGxlqBEq51Kge6IQt4qQV9P9VgInW7cWmKe dTqNHI9ri3ttewdEnT++TKGKKfTjX9SR8Waj -----END NEW CERTIFICATE REQUEST----- Clearly there’s something very different between this an my original request! And it didn’t work. IIS creates a custom CSR that is encoded in a format that no certificate authority I’ve ever used uses. If you want the gory details of what’s in there look at this ServerFault question (thanks to Mika in the comments). In the end it doesn’t matter  though – no certificate authority knows what to do with this CSR. So create a new CSR and skip the renewal. Always! Use the same Server Keep in mind that on IIS at least you should always create your certificate on a single server and then when you receive the final certificate from your provider import it on that server. IIS tracks the CSR it created and requires it in order to import the final certificate properly. So if for some reason you try to install the certificate on another server, it won’t work. I’ve also run into trouble trying to install the same certificate twice – this time around I didn’t give my certificate the proper friendly name and IIS failed to allow me to assign the certificate to any of my Web sites. So I removed the certificate and tried to import again, only to find it failed the second time around. There are other ways to fix this, but in my case I had to have the certificate re-issued to work – not what you want to do. Regardless of what you do though, when you import make sure you do it right the first time by crossing all your t’s and dotting your i's– it’ll save you a lot of grief! You don’t actually have to use the server that the certificate gets installed on to generate the CSR and first install it, but it is generally a good idea to do so just so you can get the certificate installed into the right place right away. If you have access to the server where you need to install the certificate you might as well use it. But you can use another machine to generated the and install the certificate, then export the certificate and move it to another machine as needed. So you can use your Dev machine to create a certificate then export it and install it on a live server. More on installation and back up/export later. Installing the Certificate Once you’ve submitted a CSR request your provider will process the request and eventually issue you a new final certificate that contains another text file with the final key to import into your certificate store. IIS does this by combining the content in your certificate request with the original CSR. If all goes well your new certificate shows up in the certificate list and you’re ready to assign the certificate to your sites. Make sure you use a friendly name that matches domain name of your site. So use *.mysite.com or www.mysite.com or store.mysite.com to ensure IIS recognizes the certificate. I made the mistake of not naming my friendly name this way and found that IIS was unable to link my sites to my wildcard certificate. It needed to have the *. as part of the certificate otherwise the Hostname input field was blanked out. Changing the Friendly Name If you by accidentally used an invalid friendly name you can change it later in the Windows certificate store. Bring up a Run Box Type MMC File | Add/Remove Snap In Add Certificates | Computer Account | Local Computer Drill into Certificates | Personal | Certificates Find your Certificate | Right Click | Properties Edit the Friendly Name | Click OK Backing up your Certificate The first thing you should do once your certificate is successfully installed is to back it up! In case your server crashes or you otherwise lose your configuration this will ensure you have an easy way to recover and reinstall your certificate either on the same server or a different one. If you’re running a server farm or using a wildcard certificate you also need to get the certificate onto other machines and a PFX file import is the easiest way to do this. To back up your certificate select your certificate and choose Export from the context or sidebar menu: The Export Certificate option allows you to export a password protected binary file that you can import in a single step. You can copy the resulting binary PFX file to back up or copy to other machines to install on. Importing the certificate on another machine is as easy as pointing at the PFX file and specifying the password. IIS handles the rest. Assigning a new certificate to your Site Once you have the new certificate installed, all that’s left to do is assign it to your site. In IIS select your Web site and bring up the Site Bindings from the right sidebar. Add a new binding for https, bind it to port 443, specify your hostname and pick the certificate from the pick list. If you’re using a root site make sure to set up your certificate for www.yoursite.com and also for yoursite.com so that both work properly with SSL. Note that you need to explicitly configure each hostname for a certificate if you plan to use SSL. Luckily if you update your SSL certificate in the following year, IIS prompts you and asks whether you like to update all other sites that are using the existing cert to the newer cert. And you’re done. So what’s the Pain? So, all of this is old hat and it doesn’t look all that bad right? So what’s the pain here? Well if you follow the instructions and do everything right, then the process is about as straight forward as you would expect it to be. You create a cert request, you import it and assign it to your sites. That’s the basic steps and to be perfectly fair it works well – if nothing goes wrong. However, renewing tends to be the problem. The first unintuitive issue is that you simply shouldn’t renew but create a new CSR and generate your new certificate from that. Over the years I’ve fallen prey to the belief that Microsoft eventually will fix this so that the renewal creates the same type of CSR as the old cert, but apparently that will just never happen. Booo! The other problem I ran into is that I accidentally misnamed my imported certificate which in turn set off a chain of events that caused my originally issued certificate to become uninstallable. When I received my completed certificate I installed it and it installed just fine, but the friendly name was wrong. As a result IIS refused to assign the certificate to any of my host headered sites. That’s strike number one. Why the heck should the friendly name have any effect on the ability to attach the certificate??? Next I uninstalled the certificate because I figured that would be the easiest way to make sure I get it right. But I found that I could not reinstall my certificate. I kept getting these stop errors: "ASN1 bad tag value met" that would prevent the installation from completion. After searching around for this error and reading countless long messages on forums, I found that this error supposedly does not actually mean the install failed, but the list wouldn’t refresh. Commodo has this to say: Note: There is a known issue in IIS 7 giving the following error: "Cannot find the certificate request associated with this certificate file. A certificate request must be completed on the computer where it was created." You may also receive a message stating "ASN1 bad tag value met". If this is the same server that you generated the CSR on then, in most cases, the certificate is actually installed. Simply cancel the dialog and press "F5" to refresh the list of server certificates. If the new certificate is now in the list, you can continue with the next step. If it is not in the list, you will need to reissue your certificate using a new CSR (see our CSR creation instructions for IIS 7). After creating a new CSR, login to your Comodo account and click the 'replace' button for your certificate. Not sure if this issue is fixed in IIS 8 but that’s an insane bug to have crop up. As it turns out, in my case the refresh didn’t work and the certificate didn’t show up in the IIS list after the reinstall. In fact when looking at the certificate store I could see my certificate was installed in the right place, but the private key is missing which is most likely why IIS is not picking it up. It looks like IIS could not match the final cert to the original CSR generated. But again some sort of message to that affect might be helpful instead of ASN1 bad tag value met. Recovering the Private Key So it turns out my original problem was that I received the published key, but when I imported the private key was missing. There’s a relatively easy way to recover from this. If your certificate doesn’t show up in IIS check in the certificate store for the local machine (see steps above on how to bring this up). If you look at the certificate in Certificates/Personal/Certificates make sure you see the key as shown in the image below: if the key is missing it means that the certificate is missing the private key most likely. To fix a certificate you can do the following: Double click the certificate Go to the Details Tab Copy down the Serial number You can copy the serial number from the area blurred out above. The serial number will be in a format like ?00 a7 9b a1 a4 9d 91 63 57 d6 9f 26 b8 ee 79 b5 cb and you’ll need to strip out the spaces in order to use it in the next step. Next open up an Administrative command prompt and issue the following command: certutil -repairstore my 00a79ba1a49d916357d69f26b8ee79b5cb You should get a confirmation message that the repair worked. If you now go back to the certificate store you should now see the key icon show up on the certificate. Your certificate is fixed. Now go back into IIS Manager and refresh the list of certificates and if all goes well you should see all the certificates that showed in the cert store now: Remember – back up the key first then map to your site… Summary I deal with a lot of customers who run their own IIS servers, and I can’t tell you how often I hear about botched SSL installations. When I posted some of my issues on Twitter yesterday I got a hell storm of “me too” responses. I’m clearly not the only one, who’s run into this especially with renewals. I feel pretty comfortable with IIS configuration and I do a lot of it for support purposes, but the SSL configuration is one that never seems to go seamlessly. This blog post is meant as reminder to myself to read next time I do a renewal. So I can dot my i's and dash my t’s before I get caught in the mess I’m dealing with today. Hopefully some of you find this useful as well.© Rick Strahl, West Wind Technologies, 2005-2014Posted in IIS7  Security   Tweet !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs"); (function() { var po = document.createElement('script'); po.type = 'text/javascript'; po.async = true; po.src = 'https://apis.google.com/js/plusone.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(po, s); })();

    Read the article

< Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >