Search Results

Search found 12753 results on 511 pages for 'small'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 180/511 | < Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Form validation with optional File Upload field callback

    - by MotiveKyle
    I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

    Read the article

  • Minimalist Wiki like script

    - by arthurprs
    I'm trying to find a simple wiki like script to setup a personal directory, browser favorites simply doesn't do anymore and i have lots of small files on my flash drive Desired features file upload not bloated works on a common webhost (aka php) Thanks in advance

    Read the article

  • What is the most efficient procedure for implementing a sortable ajax list on the backend?

    - by HenryL
    The most common method is to assign a sequential order field for each item in the list and do an update that maintains the sequence with every ajax sort operation. Unfortunately, this requires an update to each item of the list every time someone sorts. This is fine for small lists, but what's the best way to implement sorting for larger lists that are constantly updated? I am looking for something that minimizes DB IO.

    Read the article

  • I'm tired of JButtons, how can I make a nicer GUI in java ?

    - by Jules Olléon
    So far I've only build "small" graphical applications, using swing and JComponents as I learned at school. Yet I can't bear ugly JButtons anymore. I've tried to play with the different JButton methods, like changing colors, putting icons etc. but I'm still not satisfied. How do you make a nicer GUI in java ? I'm looking for not-too-heavy alternatives (like, without big frameworks or too complicated libraries).

    Read the article

  • Iframe covers navigation bar, needs close, open to fix?

    - by kuyanatan
    I have a small webpage with a form, iframe-d in. When I put invalid input inside the form, the iframe covers up the navigation bar and I can't get the navigation bar back without closing and opening the page again. Here is where I am (temporarily) hosting the webpage: dl.dropbox.com/u/1144456/rlp/v2/demo.html the css stylesheet: dl.dropbox.com/u/1144456/rlp/v2/contact-us.htm To recreate this problem, click the last tab and just click submit.

    Read the article

  • Changing background image of a Drupal page based on user's selection...?

    - by Sambo
    Hi I'm trying to give my users the functionality to change what the background image used on a page is. The list of background images will be a small number that won't really change. I thought I could add a few Taxonomy terms...one for each background type...then apply a class to the body tag when the page is viewed. Does this sound feasible and if so how would I go about doing it? Thanks Sam

    Read the article

  • How can I disable mouse click event system wide using C#?

    - by mazzzzz
    Hey guys, I have a laptop with a very sensitive touch pad, and wanted to code a small program that could block the mouse input when I was typing a paper or something. I didn't think it would be hard to do, considering everything I've seen on low-level hooks, but I was wrong (astounding, right?). I looked at a few examples, but the examples I've seen either block both keyboard and mouse, or just hide the mouse. Any help with this would be great.

    Read the article

  • Documentation on System.Deployment

    - by krisnam
    I have a Win Application which is publish using ClickOnce deployment (go though VS IDE). I want to develop another small application (Web) to do this deployment process without going though VS IDE. I heard about System.Deployment and Microsoft.Build.BuildEngine name spaces. But I count find good doc to solve my problem. If you have one please send me any references.

    Read the article

  • Amazon Web Services Apache Server

    - by Samnsparky
    I am trying to get a feel for the costs imposed by running apache on AWS continually. Assuming that the service is scarcely used, does anyone know how many cpu hours that would eat up in a month just by sitting there and running? I understand that this is slightly impractical but I am trying to figure out what the cost of entry is to deploy an application on this platform (as compared to GAE). I suspect it to be small but I would like to know.

    Read the article

  • Histogram in Matplotlib with input file

    - by Arkapravo
    I wish to make a Histogram in Matplotlib from an input file containing the raw data (.txt). I am facing issues in referring to the input file. I guess it should be a rather small program. Any Matplotlib gurus, any help ? I am not asking for the code, some inputs should put me on the right way !

    Read the article

  • Run javascript function after Server-Side validation is complete.

    - by Ed Woodcock
    Ok, I've got a lightbox with a small form (2 fields) in it, inside an UpdatePanel, and I want to close this lightbox (must be done via javascript) when the 'Save' button is pressed. However, there is a need to have a server-side CustomValidator on the page, and I only want to close the lightbox if this returns as valid. Does anyone know a way to trigger javascript (or jQuery) code from a server-side validator?

    Read the article

  • Wordpress: How to be redirected to the page when inserting it's page ID into numeric form input with

    - by Daniel
    I would like to know if there's exists some simple code to get to the page i know its ID , I would like to create small input (no matter where in templates)from where the people can easily get to the page if they know it's page ID (4numeric ID is better to remember - permalink name you can mistake . I have the girls portfolio in wordpress - portfolio=pages x jobs in clubs offers=posts , I would like the girls portfolios to be easily findable by ID(s) , if possible the same for the posts=jobs in clubs The best solution little 4-5numeric input and send=go button in sidebar.php - index.php etc

    Read the article

  • Redirection in Rails

    - by Cyborgo
    Hi, I have a small question regarding rails. I have a search controller which searches for a name in database, if found shows the details about it or else I am redirecting to the new name page. Is there anyway after redirection that the name searched for to automatically appear in the new form page? Thanks in advance.

    Read the article

  • .NET / WPF Alternative

    - by eWolf
    I know the .NET framework and WPF pretty well, but I think the whole thing has gotten too blown up, especially for small apps as the whole .NET framework 3.5 weighs 197 MB by now. I am looking for a language/framework/library that provides functionality similar to that of WPF (animations, gradients, a.s.o.) and the .NET framework (of course not everything, but the basic features) and which is faster and more lightweight than the .NET framework and creates smaller and faster applications than the ones using .NET. Do you have any suggestions?

    Read the article

  • Why should I use "Web 2.0"-style URLs?

    - by hydrapheetz
    In short, why use something like http://stackoverflow.com/badges/6/supporter instead of something "simpler" (and subjectively, at that) like http://stackoverflow.com/badges/6/. Even on my own site I've just been using /post/6/ to reference posts (by IDs, even though I still store a slug.) Instead of /post/6/small-rant-on-urls, and in some cases, they can get even more absurd, much more so than is really necessary.

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • Optimizing list comprehension to find pairs of co-prime numbers

    - by user3685422
    Given A,B print the number of pairs (a,b) such that GCD(a,b)=1 and 1<=a<=A and 1<=b<=B. Here is my answer: return len([(x,y) for x in range(1,A+1) for y in range(1,B+1) if gcd(x,y) == 1]) My answer works fine for small ranges but takes enough time if the range is increased. such as 1 <= A <= 10^5 1 <= B <= 10^5 is there a better way to write this or can this be optimized?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >