Search Results

Search found 30347 results on 1214 pages for 'jamie read'.

Page 182/1214 | < Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >

  • problem with Double and Rational Number

    - by altair211
    Hi, I am writing a function in which I need to read a string contains floating point number and turn it back to Rational. But When I do toRational (read input :: Double), it will not turn for eg: 0.9 into 9 % 10 as expected, but instead 81..... % 9007... Thx

    Read the article

  • What does Error 3112 indicate when compacting an MDB file?

    - by Craig Johnston
    What does Error 3112 indicate when compacting an MDB file? The Error description is "Records can't be read; no read permission on 'xyz123.mdb'" There is a known issue with the Compact function on some versions of Access MDBs. Is the solution in this case to run the Microsoft utility JETCOMP.EXE on this file? What are the other possible causes of this error?

    Read the article

  • Flash caroussel xml parse html link

    - by Marvin
    Hello I am trying to modify a carousel script I have in flash. Its normal function is making some icons rotate and when clicked they zoom in, fade all others and display a little text. On that text I would like to have a link like a "read more". If I use CDATA it wont display a thing, if I use alt char like &#60;a href=&#34;www.google.com&#34;&#62; Read more + &#60;/a&#62; It just displays the text as: <a href="www.google.com"> Read more + </a>. The flash dynamic text box wont render it as html. I dont enough as2 to figure out how to add this. My code: var xml:XML = new XML(); xml.ignoreWhite = true; //definições do xml xml.onLoad = function() { var nodes = this.firstChild.childNodes; numOfItems = nodes.length; for(var i=0;i<numOfItems;i++) { var t = home.attachMovie("item","item"+i,i+1); t.angle = i * ((Math.PI*2)/numOfItems); t.onEnterFrame = mover; t.toolText = nodes[i].attributes.tooltip; t.content = nodes[i].attributes.content; t.icon.inner.loadMovie(nodes[i].attributes.image); t.r.inner.loadMovie(nodes[i].attributes.image); t.icon.onRollOver = over; t.icon.onRollOut = out; t.icon.onRelease = released; } } And the xml: <?xml version="1.0" encoding="UTF-8"?> <icons> <icon image="images/product.swf" tooltip="Product" content="Hello this is some random text &#60;a href=&#34;www.google.com&#34;&#62; Read More + &#60;/a&#62; "/> </icons> Any suggestions? Thanks.

    Read the article

  • Problem with reading data from plist iphone sdk

    - by neha
    Hi all, I'm creating a myDb.plist file in my resources folder and trying to read it, but it's not getting read. I'm using the following code. NSString* plistPath = [[NSBundle mainBundle] pathForResource:@"myDb" ofType:@"plist"]; contentArray = [NSArray arrayWithContentsOfFile:plistPath]; contentArray is showing null. Can anybody please help me? Thanx in advance.

    Read the article

  • Outlook Crashes with Event ID 1000

    - by Deepak N
    We deployed a VSTO addin for outlook 2003. After installing the addin one of the user's outlook crashes when a contact is opened, i.e, when ItemProperties of the contact are read.Some theses properties are read using MAPI.There is no exception being logged even though we have try/catch and logging in all methods. The event log has following message The description for Event ID 1000 from source Microsoft Office 11 cannot be found Source : Microsoft Office 11 The following information was included with the event: outlook.exe 11.0.8312.0 4a403990 msvcr80.dll 8.0.50727.3053 4889d619 0 0001500a

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to set/get Gtk "Style Properties".

    - by PP
    How to set gtk "Style Properties" listed in gtk documentation? like for GtkWidget there are Style Properties: "separator-height" gint : Read "separator-width" gint : Read So how to get and set them? using GTK+ and C. Thanks, PP.

    Read the article

  • Ship maritime AIS information API

    - by James Cadd
    Is there an API or Web Service that can be used to read AIS data? Most links I read starting at Wikipedia (http://en.wikipedia.org/wiki/Automatic_Identification_System) say that AIS data is freely available but I'm having a hard time finding a provider of the data. A C# example or language agnostic web service would be helpful.

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • How can i interpret a time value in ascii into a numerical value?

    - by Bilal
    I have a file which is as follows: 15:03:21 II 0.88 0.64 15:03:31 II 0.88 0.64 15:03:42 II 0.40 0.40 etc. after loading the file in matlab, I want to be able to read the first column (which corresponds to time) and interpret them as numerical values. At the moment, they are interpreted as a string of ascii characters and i can't perform any mathematical operations on them. Does anyone have any suggestions as to how i can read the time as numbers instead of a string of ascii characters?

    Read the article

  • Easy way to convert a string of 0's and 1's into a character? Plain C

    - by Nick
    I'm doing a steganography project where I read in bytes from a ppm file and add the least significant bit to an array. So once 8 bytes are read in, I would have 8 bits in my array, which should equal some character in a hidden message. Is there an easy way to convert an array of 0's and 1's into an ascii value? For example, the array: char bits[] = "0,1,1,1,0,1,0,0" would equal 't'. Plain C

    Read the article

  • Reading path in templates

    - by DJPython
    Hello, is it any way to read path to current page? For example, I am at www.example.com/foo/bar/ - and I want to read '/foo/bar/'. But, all have to be done in template file without modyficating views. I have to many view files to edit each one. Sorry for my english, hope everyone understand. Cheers.

    Read the article

  • How to prevent arbitrary code execution vulnerability in our programs?

    - by Calmarius
    You always read in changelogs when your system or browser or any program updates that they fixed a bug that made possible that an attacker can execute any code in your computer with a forged website, or attacking your computer with carefully forged packets, etc... Because you read it so often that means any program can have similar vulnerabilites... What causes this? how to design our programs to prevent similar issues?

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • dynamically scan pictures in a folder and display using jquery slideshow

    - by Nazmin
    guys, anyone know how to scan a folder using jquery or javascript code snippet, after that get a picture file name and embed in <li></li> or <div></div>, i've used php code to read through the folder and loop through the element to display the thumbnails and all, but it's not work well. I've try on galleria, gallerific, galleryView jquery slideshow plugin but those might not work well with php processing because of predefined configuration or something, can anyone tweak or hack these gallery to dynamically read an image from a folder?

    Read the article

  • Django Piston - how can I create custom methods?

    - by orokusaki
    I put my questions in the code comments for clarity: from piston.handler import AnonymousBaseHandler class AnonymousAPITest(AnonymousBaseHandler): fields = ('update_subscription',) def update_subscription(self, request, months): # Do some stuff here to update a subscription based on the # number of months provided. # How the heck can I call this method? return {'msg': 'Your subscription has been updated!'} def read(self, request): return { 'msg': 'Why would I need a read() method on a fully custom API?' }

    Read the article

  • Different cache concurrent strategies for root entity and its collection (Hibernate with EHCache)?

    - by grigory
    Given example from Hibernate docs and modifying it so that root level entity (Customer) is read-only while one of its collections (tickets) is read-write: @Entity @Cache(usage = CacheConcurrencyStrategy.READ_ONLY) public class Customer { ... @OneToMany(...) @Cache(usage = CacheConcurrencyStrategy.READ_WRITE) public SortedSet<Ticket> getTickets() { return tickets; } ... } Would collection of tickets get refreshed when accessing customer from cache?

    Read the article

  • Combining FileStream and MemoryStream to avoid disk accesses/paging while receiving gigabytes of data?

    - by w128
    I'm receiving a file as a stream of byte[] data packets (total size isn't known in advance) that I need to store somewhere before processing it immediately after it's been received (I can't do the processing on the fly). Total received file size can vary from as small as 10 KB to over 4 GB. One option for storing the received data is to use a MemoryStream, i.e. a sequence of MemoryStream.Write(bufferReceived, 0, count) calls to store the received packets. This is very simple, but obviously will result in out of memory exception for large files. An alternative option is to use a FileStream, i.e. FileStream.Write(bufferReceived, 0, count). This way, no out of memory exceptions will occur, but what I'm unsure about is bad performance due to disk writes (which I don't want to occur as long as plenty of memory is still available) - I'd like to avoid disk access as much as possible, but I don't know of a way to control this. I did some testing and most of the time, there seems to be little performance difference between say 10 000 consecutive calls of MemoryStream.Write() vs FileStream.Write(), but a lot seems to depend on buffer size and the total amount of data in question (i.e the number of writes). Obviously, MemoryStream size reallocation is also a factor. Does it make sense to use a combination of MemoryStream and FileStream, i.e. write to memory stream by default, but once the total amount of data received is over e.g. 500 MB, write it to FileStream; then, read in chunks from both streams for processing the received data (first process 500 MB from the MemoryStream, dispose it, then read from FileStream)? Another solution is to use a custom memory stream implementation that doesn't require continuous address space for internal array allocation (i.e. a linked list of memory streams); this way, at least on 64-bit environments, out of memory exceptions should no longer be an issue. Con: extra work, more room for mistakes. So how do FileStream vs MemoryStream read/writes behave in terms of disk access and memory caching, i.e. data size/performance balance. I would expect that as long as enough RAM is available, FileStream would internally read/write from memory (cache) anyway, and virtual memory would take care of the rest. But I don't know how often FileStream will explicitly access a disk when being written to. Any help would be appreciated.

    Read the article

  • How can i get the between cell addresses.

    - by Sathish
    I have a function which accepts fromRange and ToRange of an Excel cell. basically i want to read cell by cell values from the range. suppose if i pass E2 and E9 i want to read in a loop something like Range(E2).value, Range(E3).value and so on till E9 How can i get the between cell addresses. Please help

    Read the article

  • Image compatibility in iphone and android

    - by damodar
    I developed UI for iphone apps and now want to use the same UI in Android apps. I read that Android use dip for image resolution and i also read that 1 dip=1.5 pixel.I simply multiply the image size by 1.5px. Now the problem is that the image is blur and not as clear as in iphone apps.So will some body suggest me how should i make a design so that it could be used in iphone and android.

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • Encrypt file using M2Crypto

    - by Bear
    It is known that I can read the whole file content in memory and encrypt it using the following code. contents = fin.read() cipher = M2Crypto.EVP.Cipher(alg="aes_128_cbc", key = aes_key, iv = aes_iv, op = 1) encryptedContents = cipher.update(contents) encryptedContents += cipher.final() But what if the file size is large, is there a way for me to pass the input stream to M2Crypto instead of reading the whole file first?

    Read the article

  • how can i get the file permission of a directory with java

    - by user571652
    i try to check the permission granted to a directory in linux, i mean i have a directory with permission 755 berty@berty-laptop:~$ ls -l / |grep directory drwxr-xr-x 3 root root 4096 2011-01-10 12:33 directory how can i read that permission with java? I've tried using FilePermission but though i have a directory with all the permissions (777) the FilePermission class always returns an exception java.security.AccessControlException: Access denied (java.io.FilePermission /home/directory read) at java.security.AccessController.checkPermission(AccessController.java:103) at com.snippets.Check4DirectoryPermission.checker(Check4DirectoryPermission.java:50) at com.snippets.Check4DirectoryPermission.main(Check4DirectoryPermission.java:70) is there another way to do this?

    Read the article

< Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >