Search Results

Search found 17336 results on 694 pages for 'richard long'.

Page 182/694 | < Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >

  • Php index page utitlizing an idea for a superswitch...

    - by Matt
    I dont know if this is a great idea...or a crap one. But I was thinking I may use one page to display all my pages using includes. Here is what my index.php would look like...on the functions include there is a function called "superSwitch" which will determine what requested page will be included....for instance if I do a get ?a=a it will goto the function superSwitch(a) superSwitch will take it and associate it with (login.php) then respond with such... here is the code for the index.php...please let me know if this makes sense and might work, or should I just stick to long blocks of code (which is why I am trying this because I hate long pages full of code...) of course as you can tell it is not actually including anything yet...the print is for debugging purposes. :) Thanks, Matt <?php //includes Functions include_once('inc/func.inc.php'); //set superget variable $superget = @$_GET['a']; //check if superget is set or null if (!$superget) { echo "Nothing Requested :)"; } else { //sanitizes the superget request $supergetr = supergetSanitize($superget) //uses the result "good" or "nogood" to determine what happens if ( $supergetr == "good" ) { //pulls superSwitch value of the request $ssresult = superSwitch($superget); print_r ($ssresult); } //if the sanitize is nogood else { //the superSwitch is instructed to respond with a 404 page $superget = "404" $ssresult = superSwitch($superget); print_r ($ssresult); } } ?>

    Read the article

  • JFLAP Turing Machine shortcut problem

    - by Robert Lamb
    In JFLAP (http://jflap.org), there are some shortcuts for Turing machine transitions. One of these shortcuts allows you to transition as long as the current tape symbol isn't the indicated symbol. For example, the transition !g,x;R basically says "Take this transition if the current tape symbol is not g". So far, so good. But the transition I want is !?,~;R which basically says "Move right as long as the current symbol is not the end-of-string (empty cell) symbol". The problem is I cannot figure out how to type in "!?". The JFLAP online documentation (http://www.jflap.org/tutorial/turing/one/index.html#syntax) has this to say: The first shortcut is that there exists the option of using the “!” character to convey the meaning of “any character but this character.” For example, concerning the transition (!a; x, R), if the head encounters any character but an “a”, it will replace the character with an “x” and move right. To write the expression “!?”, just type a “1” in when inputting a command. My question is...how do I actually do what that last sentence is trying to explain to me? Thanks for your help! Robert

    Read the article

  • Lost with hibernate - OneToMany resulting in the one being pulled back many times..

    - by Andy
    I have this DB design: CREATE TABLE report ( ID MEDIUMINT PRIMARY KEY NOT NULL AUTO_INCREMENT, user MEDIUMINT NOT NULL, created TIMESTAMP NOT NULL, state INT NOT NULL, FOREIGN KEY (user) REFERENCES user(ID) ON UPDATE CASCADE ON DELETE CASCADE ); CREATE TABLE reportProperties ( ID MEDIUMINT NOT NULL, k VARCHAR(128) NOT NULL, v TEXT NOT NULL, PRIMARY KEY( ID, k ), FOREIGN KEY (ID) REFERENCES report(ID) ON UPDATE CASCADE ON DELETE CASCADE ); and this Hibernate Markup: @Table(name="report") @Entity(name="ReportEntity") public class ReportEntity extends Report{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name="ID") private Integer ID; @Column(name="user") private Integer user; @Column(name="created") private Timestamp created; @Column(name="state") private Integer state = ReportState.RUNNING.getLevel(); @OneToMany(mappedBy="pk.ID", fetch=FetchType.EAGER) @JoinColumns( @JoinColumn(name="ID", referencedColumnName="ID") ) @MapKey(name="pk.key") private Map<String, ReportPropertyEntity> reportProperties = new HashMap<String, ReportPropertyEntity>(); } and @Table(name="reportProperties") @Entity(name="ReportPropertyEntity") public class ReportPropertyEntity extends ReportProperty{ @Embeddable public static class ReportPropertyEntityPk implements Serializable{ /** * long#serialVersionUID */ private static final long serialVersionUID = 2545373078182672152L; @Column(name="ID") protected int ID; @Column(name="k") protected String key; } @EmbeddedId protected ReportPropertyEntityPk pk = new ReportPropertyEntityPk(); @Column(name="v") protected String value; } And i have inserted on Report and 4 Properties for that report. Now when i execute this: this.findByCriteria( Order.asc("created"), Restrictions.eq("user", user.getObject(UserField.ID)) ) ); I get back the report 4 times, instead of just the once with a Map with the 4 properties in. I'm not great at Hibernate to be honest, prefer straight SQL but I must learn, but i can't see what it is that is wrong.....? Any suggestions?

    Read the article

  • Getting zeros between data while reading a binary file in C

    - by indiajoe
    I have a binary data which I am reading into an array of long integers using a C programme. hexdump of the binary data shows, that after first few data points , it starts again at a location 20000 hexa adresses away. hexdump output is as shown below. 0000000 0000 0000 0000 0000 0000 0000 0000 0000 * 0020000 0000 0000 0053 0000 0064 0000 006b 0000 0020010 0066 0000 0068 0000 0066 0000 005d 0000 0020020 0087 0000 0059 0000 0062 0000 0066 0000 ........ and so on... But when I read it into an array 'data' of long integers. by the typical fread command fread(data,sizeof(*data),filelength/sizeof(*data),fd); It is filling up with all zeros in my data array till it reaches the 20000 location. After that it reads in data correctly. Why is it reading regions where my file is not there? Or how will I make it read only my file, not anything inbetween which are not in file? I know it looks like a trivial problem, but I cannot figure it out even after googling one night.. Can anyone suggest me where I am doing it wrong? Other Info : I am working on a gnu/linux machine. (slax-atma distro to be specific) My C compiler is gcc.

    Read the article

  • From where starts the process' memory space and where does it end?

    - by nhaa123
    Hi, I'm trying to dump memory from my application where the variables lye. Here's the function: void MyDump(const void *m, unsigned int n) { const unsigned char *p = reinterpret_cast<const unsigned char *(m); char buffer[16]; unsigned int mod = 0; for (unsigned int i = 0; i < n; ++i, ++mod) { if (mod % 16 == 0) { mod = 0; std::cout << " | "; for (unsigned short j = 0; j < 16; ++j) { switch (buffer[j]) { case 0xa: case 0xb: case 0xd: case 0xe: case 0xf: std::cout << " "; break; default: std::cout << buffer[j]; } } std::cout << "\n0x" << std::setfill('0') << std::setw(8) << std::hex << (long)i << " | "; } buffer[i % 16] = p[i]; std::cout << std::setw(2) << std::hex << static_cast<unsigned int(p[i]) << " "; if (i % 4 == 0 && i != 1) std::cout << " "; } } Now, how can I know from which address starts my process memory space, where all the variables are stored? And how do I now, how long the area is? For instance: MyDump(0x0000 /* <-- Starts from here? */, 0x1000 /* <-- This much? */); Best regards, nhaa123

    Read the article

  • C++ Problems with #import of .NET out-of-proc server.

    - by jm
    In C++ program, I am trying to #import TLB of .NET out of proc server. I get errors like: z:\server.tlh(111) : error C2146: syntax error : missing ';' before identifier 'GetType' z:\server.tlh(111) : error C2501: 'TypePtr' : missing storage-class or type specifiers z:\server.tli(74) : error C2143: syntax error : missing ';' before 'tag::id' z:\server.tli(74) : error C2433: 'TypePtr' : 'inline' not permitted on data declarations z:\server.tli(74) : error C2501: '_TypePtr' : missing storage-class or type specifiers z:\server.tli(74) : fatal error C1004: unexpected end of file found The TLH looks like: ... _bstr_t GetToString ( ); VARIANT_BOOL Equals ( const _variant_t & obj ); long GetHashCode ( ); _TypePtr GetType ( ); long Open ( ); ... I am not really interested in the having the base object .NET object methods like GetType(), Equals(), etc. But GetType() seems to be causing problems. Some google research indicates I could #import MSCORLIB.TLB (or put it in path), but I can't get that to compile either. Any tips?

    Read the article

  • Google App Engine how to get an object from the servlet ?

    - by Frank
    I have the following class objects in Google App Engine's dadastore, I can see them from the "Datastore Viewer " : import javax.jdo.annotations.IdGeneratorStrategy; import javax.jdo.annotations.IdentityType; import javax.jdo.annotations.PersistenceCapable; import javax.jdo.annotations.Persistent; import javax.jdo.annotations.PrimaryKey; @PersistenceCapable(identityType=IdentityType.APPLICATION) public class Contact_Info_Entry implements Serializable { @PrimaryKey @Persistent(valueStrategy=IdGeneratorStrategy.IDENTITY) Long Id; public static final long serialVersionUID=26362862L; String Contact_Id="",First_Name="",Last_Name="",Company_Name="",Branch_Name="",Address_1="",Address_2="",City="",State="",Zip="",Country=""; double D_1,D_2; boolean B_1,B_2; Vector<String> A_Vector=new Vector<String>(); public Contact_Info_Entry() { } ...... } How can my java applications get the object from a servlet url ? For instance if have an instance of Contact_Info_Entry who's Contact_Id is "ABC-123", and my App Id is : nm-java When my java program accesses the url : "http://nm-java.appspot.com/Check_Contact_Info?Contact_Id=ABC-123 How will the Check_Contact_Info servlet get the object from datastore and return it to my app ? public class Check_Contact_Info_Servlet extends HttpServlet { static boolean Debug=true; public void doGet(HttpServletRequest request,HttpServletResponse response) throws IOException { } ... protected void doPost(HttpServletRequest request,HttpServletResponse response) throws ServletException,IOException { doGet(request,response); } } Frank

    Read the article

  • How to hand-over a TCP listening socket with minimal downtime?

    - by Shtééf
    While this question is tagged EventMachine, generic BSD-socket solutions in any language are much appreciated too. Some background: I have an application listening on a TCP socket. It is started and shut down with a regular System V style init script. My problem is that it needs some time to start up before it is ready to service the TCP socket. It's not too long, perhaps only 5 seconds, but that's 5 seconds too long when a restart needs to be performed during a workday. It's also crucial that existing connections remain open and are finished normally. Reasons for a restart of the application are patches, upgrades, and the like. I unfortunately find myself in the position that, every once in a while, I need to do this kind of thing in production. The question: I'm looking for a way to do a neat hand-over of the TCP listening socket, from one process to another, and as a result get only a split second of downtime. I'd like existing connections / sockets to remain open and finish processing in the old process, while the new process starts servicing new connectinos. Is there some proven method of doing this using BSD-sockets? (Bonus points for an EventMachine solution.) Are there perhaps open-source libraries out there implementing this, that I can use as is, or use as a reference? (Again, non-Ruby and non-EventMachine solutions are appreciated too!)

    Read the article

  • Crash generated during destruction of hash_map

    - by Alien01
    I am using hash_map in application as typedef hash_map<DWORD,CComPtr<IInterfaceXX>> MapDword2Interface; In main application I am using static instance of this map static MapDword2Interface m_mapDword2Interface; I have got one crash dump from one of the client machines which point to the crash in clearing this map I opened that crash dump and here is assembly during debugging > call std::list<std::pair<unsigned long const ,ATL::CComPtr<IInterfaceXX> >,std::allocator<std::pair<unsigned long const ,ATL::CComPtr<IInterfaceXX> > > >::clear > mov eax,dword ptr [CMainApp::m_mapDword2Interface+8 (49XXXXX)] Here is code where crash dump is pointing. Below code is from stl:list file void clear() { // erase all #if _HAS_ITERATOR_DEBUGGING this->_Orphan_ptr(*this, 0); #endif /* _HAS_ITERATOR_DEBUGGING */ _Nodeptr _Pnext; _Nodeptr _Pnode = _Nextnode(_Myhead); _Nextnode(_Myhead) = _Myhead; _Prevnode(_Myhead) = _Myhead; _Mysize = 0; for (; _Pnode != _Myhead; _Pnode = _Pnext) { // delete an element _Pnext = _Nextnode(_Pnode); this->_Alnod.destroy(_Pnode); this->_Alnod.deallocate(_Pnode, 1); } } Crash is pointing to the this->_Alnod.destroy(_Pnode); statement in above code. I am not able to guess it, what could be reason. Any ideas??? How can I make sure, even is there is something wrong with the map , it should not crash?

    Read the article

  • How can you get the call tree with python profilers?

    - by Oliver
    I used to use a nice Apple profiler that is built into the System Monitor application. As long as your C++ code was compiled with debug information, you could sample your running application and it would print out an indented tree telling you what percent of the parent function's time was spent in this function (and the body vs. other function calls). For instance, if main called function_1 and function_2, function_2 calls function_3, and then main calls function_3: main (100%, 1% in function body): function_1 (9%, 9% in function body): function_2 (90%, 85% in function body): function_3 (100%, 100% in function body) function_3 (1%, 1% in function body) I would see this and think, "Something is taking a long time in the code in the body of function_2. If I want my program to be faster, that's where I should start." Does anyone know how I can most easily get this exact profiling output for a python program? I've seen people say to do this: import cProfile, pstats prof = cProfile.Profile() prof = prof.runctx("real_main(argv)", globals(), locals()) stats = pstats.Stats(prof) stats.sort_stats("time") # Or cumulative stats.print_stats(80) # 80 = how many to print but it's quite messy compared to that elegant call tree. Please let me know if you can easily do this, it would help quite a bit. Cheers!

    Read the article

  • Presentation Issue in an Unordered List

    - by phreeskier
    I'm having an issue with correctly presenting items in an unordered list. The labels are floating left and the related spans that are long in length are wrapping and showing below the label. I need a solution that keeps the related spans in their respective columns. In other words, I don't want long spans to show under the labels. What property can I take advantage of so that I get the desired layout in all of the popular browsers, including IE6? Thanks in advance for the help. My code is as follows: <ul> <li> <label>Name</label> <span><%= Html.Encode(Model.Name) %></span> </li> <li> <label>Entity</label> <span><%= Html.Encode(Model.Entity) %></span> </li> <li> <label>Phone</label> <span><%= Html.Encode(Model.Phone) %></span> </li> </ul> My CSS styling is as follows: ul { display:block; list-style-type:none; margin:0; padding:0; } ul li label { float:left; width:100px; }

    Read the article

  • .NET consumer of ActiveX throwing TargetParameterCountException

    - by DevSolo
    I have a .NET (3.5 w/ Dev Studio 2008) app that hosts a visual Active X (written in C++ w/ Dev Studio 2003). Have access to all sources, but can't easily move the Active X control up to 2008. This as worked fine in the past. Made some changes to the Active X control and now, when calling one method on the Active X, I'm getting a TargetParameterCountException 100% of the time. The signature of the Active X method is: LONG CMyActive::License(LPCTSTR string1, LPCTSTR string2, LONG long1, LPCTSTR string3, LPCTSTR string4); When viewing the method in object browser of reflector, .NET sees it as: public virtual int License(string string1, string string2, int long1, string string3, string string4) I renamed the parameters for demonstration purpose (boss gets twitchy about any code). I left the method name, as it could be relevant. There are method calls prior that work. I just can't seen to figure out why I'm all of a sudden getting this exception. The HRESULT is 0x8002000e and a quick search seems to indicate that's a general one. Thanks to all for reading.

    Read the article

  • JPA 2.0 Provider Hibernate

    - by Rooh
    I have very strange problem we are using jpa 2.0 with hibernate annotations based Database generated through JPA DDL is true and MySQL as Database; i will provide some reference classes and then my porblem. @MappedSuperclass public abstract class Common implements serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; @ManyToOne @JoinColumn private Address address; //with all getter and setters //as well equal and hashCode } @Entity public class Parent extends Common{ private String name; @OneToMany(cascade = {CascadeType.MERGE,CascadeType.PERSIST}, mappedBy = "parent") private List<Child> child; //setters and rest of class } @Entity public class Child extends Common{ //some properties with getter/setters } @Entity public class Address implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; private String street; //rest of class with get/setter } as in code you can see that parents and child classes extends Common class so both have address property and id , the problem occurs when change the address refference in parent class it reflect same change in all child objects in list and if change address refference in child class then on merge it will change address refference of parent as well i am not able to figure out is it is problem of jpa or hibernate

    Read the article

  • IF-block brackets: best practice

    - by MasterPeter
    I am preparing a short tutorial for level 1 uni students learning JavaScript basics. The task is to validate a phone number. The number must not contain non-digits and must be 14 digits long or less. The following code excerpt is what I came up with and I would like to make it as readable as possible. if ( //set of rules for invalid phone number phoneNumber.length == 0 //empty || phoneNumber.length > 14 //too long || /\D/.test(phoneNumber) //contains non-digits ) { setMessageText(invalid); } else { setMessageText(valid); } A simple question I can not quite answer myself and would like to hear your opinions on: How to position the surrounding (outermost) brackets? It's hard to see the difference between a normal and a curly bracket. Do you usually put the last ) on the same line as the last condition? Do you keep the first opening ( on a line by itself? Do you wrap each individual sub-condition in brackets too? Do you align horizontally the first ( with the last ), or do you place the last ) in the same column as the if? Do you keep ) { on a separate line or you place the last ) on the same line with the last sub-condition and then place the opening { on a new line? Or do you just put the ) { on the same line as the last sub-condition? Community wiki.

    Read the article

  • Facing error in apple multitasking code

    - by user366584
    Actually I am working for multitasking and facing error please assist me, as I need to work on background application and also in foreground application - (void)applicationDidEnterBackground:(UIApplication *)application { UIApplication* app = [UIApplication sharedApplication]; // Request permission to run in the background. Provide an // expiration handler in case the task runs long. NSAssert(bgTask == UIBackgroundTaskInvalid, nil); bgTask = [app beginBackgroundTaskWithExpirationHandler:^{ // Synchronize the cleanup call on the main thread in case // the task actually finishes at around the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }]; // Start the long-running task and return immediately. dispatch_async(dispatch_get_global_queue(DISPATCH_QUEUE_PRIORITY_DEFAULT, 0), ^{ // Do the work associated with the task. // Synchronize the cleanup call on the main thread in case // the expiration handler is fired at the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }); }

    Read the article

  • Can't get KnownType to work with WCF

    - by Kelly Cline
    I have an interface and a class defined in separate assemblies, like this: namespace DataInterfaces { public interface IPerson { string Name { get; set; } } } namespace DataObjects { [DataContract] [KnownType( typeof( IPerson ) ) ] public class Person : IPerson { [DataMember] public string Name { get; set; } } } This is my Service Interface: public interface ICalculator { [OperationContract] IPerson GetPerson ( ); } When I update my Service Reference for my Client, I get this in the Reference.cs: public object GetPerson() { return base.Channel.GetPerson(); I was hoping that KnownType would give me IPerson instead of "object" here. I have also tried [KnownType( typeof( Person ) ) ] with the same result. I have control of both client and server, so I have my DataObjects (where Person is defined) and DataInterfaces (where IPerson is defined) assemblies in both places. Is there something obvious I am missing? I thought KnownType was the answer to being able to use interfaces with WCF. ----- FURTHER INFORMATION ----- I removed the KnownType from the Person class and added [ServiceKnownType( typeof( Person ) ) ] to my service interface, as suggested by Richard. The client-side proxy still looks the same, public object GetPerson() { return base.Channel.GetPerson(); , but now it doesn't blow up. The client just has an "object", though, so it has to cast it to IPerson before it is useful. var person = client.GetPerson ( ); Console.WriteLine ( ( ( IPerson ) person ).Name );

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • Asp.net mvc retriev images from db and display on Page

    - by Trey Carroll
    //Inherits="System.Web.Mvc.ViewPage<FilmFestWeb.Models.ListVideosViewModel>" <h2>ListVideos</h2> <% foreach(BusinessObjects.Video vid in Model.VideoList){%> <div class="videoBox"> <%= Html.Encode(vid.Name) %> <img src="<% vid.ThumbnailImage; %>" /> </div> <%} %> //ListVideosViewModel public class ListVideosViewModel { public IList<Video> VideoList { get; set; } } //Video public class Video { public long VideoId { get; set; } public long TeamId { get; set; } public string Name { get; set; } public string Tags { get; set; } public string TeamMembers { get; set; } public string TranscriptFileName { get; set; } public string VideoFileName { get; set; } public int TotalNumRatings { get; set; } public int CumulativeTotalScore { get; set; } public string VideoUri { get; set; } public Image ThumbnailImage { get; set; } } I am getting the "red x" that I usually associate with image file not found. I have verified that my database table shows <binary data> after the stored proc that uploads the image executes. Any insight or advice would be greatly appreciated.

    Read the article

  • wsdl xml parsing , maxlength problem after encoding of text

    - by MichaelD
    We are working together with another firm. our application communicates with the other application through WCF on our side and a custom implemented java wsdl handler on the other side. They specify the wsdl format and one of the rules is that a specific string cannot contain more then 15 characters. (normally it's 60, but i take 15 for easy example reasons) When we try to send the following string to them we get an error that the string is too long according to the wsdl: "example & test" this is a string of 14 characters, so it should be allowed the microsoft wcf parser translates this to "example &amp; test" . This encoded string is 18 characters long. Now what is the standaard behavior to check a maxlength defined in a message? Is it the encoded message or the decoded message? I would think it's the decoded message , but i ain't sure. If it is the encoded message, how should we handle this so we would know how we have to split the string?

    Read the article

  • Unit Testing Private Method in Resource Managing Class (C++)

    - by BillyONeal
    I previously asked this question under another name but deleted it because I didn't explain it very well. Let's say I have a class which manages a file. Let's say that this class treats the file as having a specific file format, and contains methods to perform operations on this file: class Foo { std::wstring fileName_; public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it //Long method to figure out what checksum it is. //Return the checksum. } }; Let's say I'd like to be able to unit test the part of this class that calculates the checksum. Unit testing the parts of the class that load in the file and such is impractical, because to test every part of the getChecksum() method I might need to construct 40 or 50 files! Now lets say I'd like to reuse the checksum method elsewhere in the class. I extract the method so that it now looks like this: class Foo { std::wstring fileName_; static int calculateChecksum(const std::vector<unsigned char> &fileBytes) { //Long method to figure out what checksum it is. } public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it return calculateChecksum( something ); } void modifyThisFileSomehow() { //Perform modification int newChecksum = calculateChecksum( something ); //Apply the newChecksum to the file } }; Now I'd like to unit test the calculateChecksum() method because it's easy to test and complicated, and I don't care about unit testing getChecksum() because it's simple and very difficult to test. But I can't test calculateChecksum() directly because it is private. Does anyone know of a solution to this problem?

    Read the article

  • Setting acquired location to a text view: How to maintain?

    - by Mark
    Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • How accurately (in terms of time) does Windows play audio?

    - by MusiGenesis
    Let's say I play a stereo WAV file with 317,520,000 samples, which is theoretically 1 hour long. Assuming no interruptions of the playback, will the file finish playing in exactly one hour, or is there some occasional tiny variation in the playback speed such that it would be slightly more or slightly less (by some number of milliseconds) than one hour? I am trying to synchronize animation with audio, and I am using a System.Diagnostics.Stopwatch to keep the frames matching the audio. But if the playback speed of WAV audio in Windows can vary slightly over time, then the audio will drift out of sync with the Stopwatch-driven animation. Which leads to a second question: it appears that a Stopwatch - while highly granular and accurate for short durations - runs slightly fast. On my laptop, a Stopwatch run for exactly 24 hours (as measured by the computer's system time and a real stopwatch) shows an elapsed time of 24 hours plus about 5 seconds (not milliseconds). Is this a known problem with Stopwatch? (A related question would be "am I crazy?", but you can try it for yourself.) Given its usage as a diagnostics tool, I can see where a discrepancy like this would only show up when measuring long durations, for which most people would use something other than a Stopwatch. If I'm really lucky, then both Stopwatch and audio playback are driven by the same underlying mechanism, and thus will stay in sync with each other for days on end. Any chance this is true?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to produce 64 bit masks?

    - by egiakoum1984
    Based on the following simple program the bitwise left shit operator works only for 32 bits. Is it true? #include <iostream> #include <stdlib.h> using namespace std; int main(void) { long long currentTrafficTypeValueDec; int input; cout << "Enter input:" << endl; cin >> input; currentTrafficTypeValueDec = 1 << (input - 1); cout << currentTrafficTypeValueDec << endl; cout << (1 << (input - 1)) << endl; return 0; } The output of the program: Enter input: 30 536870912 536870912 Enter input: 62 536870912 536870912 How could I produce 64-bit masks?

    Read the article

< Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >