Search Results

Search found 9400 results on 376 pages for 'special character'.

Page 19/376 | < Previous Page | 15 16 17 18 19 20 21 22 23 24 25 26  | Next Page >

  • How Can I Find Nth Character in Notepad++?

    - by Teno
    From the following text, I'd like to find a n th character. For example, the 10th character is "u"`. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Pellentesque ac arcu sit amet lorem mollis dignissim ac ut metus. Aliquam sed nulla ut risus sollicitudin luctus vitae eget quam. Nam velit diam, ullamcorper id tempus ac, iaculis sed arcu. According to this page, \w{10,} would work but when I type it in the Find what field of the Findwindow, it produces the message, 'Can't find the text: "\w{10,}"' Thanks in advance.

    Read the article

  • Best practice for organizing/storing character/monster data in an RPG?

    - by eclecto
    Synopsis: Attempting to build a cross-platform RPG app in Adobe Flash Builder and am trying to figure out the best class hierarchy and the best way to store the static data used to build each of the individual "hero" and "monster" types. My programming experience, particularly in AS3, is embarrassingly small. My ultra-alpha method is to include a "_class" object in the constructor for each instance. The _class, in turn, is a static Object pulled from a class created specifically for that purpose, so things look something like this: // Character.as package { public class Character extends Sprite { public var _strength:int; // etc. public function Character(_class:Object) { _strength = _class._strength; // etc. } } } // MonsterClasses.as package { public final class MonsterClasses extends Object { public static const Monster1:Object={ _strength:50, // etc. } // etc. } } // Some other class in which characters/monsters are created. // Create a new instance of Character var myMonster = new Character(MonsterClasses.Monster1); Another option I've toyed with is the idea of making each character class/monster type its own subclass of Character, but I'm not sure if it would be efficient or even make sense considering that these classes would only be used to store variables and would add no new methods. On the other hand, it would make creating instances as simple as var myMonster = new Monster1; and potentially cut down on the overhead of having to read a class containing the data for, at a conservative preliminary estimate, over 150 monsters just to fish out the one monster I want (assuming, and I really have no idea, that such a thing might cause any kind of slowdown in execution). But long story short, I want a system that's both efficient at compile time and easy to work with during coding. Should I stick with what I've got or try a different method? As a subquestion, I'm also assuming here that the best way to store data that will be bundled with the final game and not read externally is simply to declare everything in AS3. Seems to me that if I used, say, XML or JSON I'd have to use the associated AS3 classes and methods to pull in the data, parse it, and convert it to AS3 object(s) anyway, so it would be inefficient. Right?

    Read the article

  • Create a special folder within an outlook PST file

    - by Tony Dallimore
    Original question I have two problems caused by missing special folders. I added a second email address for which Outlook created a new PST file with an Inbox to which emails are successfully imported. But there is no Deleted Items folder. If I attempt to delete an unwanted email it is struck out. If move an email to a different PST file it is copied. I created a new PST file using Data File Management. This PST file has no Drafts folder. This is not important but I fail to see why I cannot have Drafts folder if I want. Any suggestions for solving these problems, particularly the first, gratefully received. Update Thanks to Ramhound and Dave Rook for their helpful responses to my original question. I assumed the problem of not have a Drafts folder in an Archive PST file and not having a Deleted Items folder associated with an Inbox were part of the same problem or I would not have mentioned the Drafts folder issue since I have an easy work-around. Perhaps my question should have been: How to I load emails from an IMAP account and be able to delete the spam?

    Read the article

  • Dual boot windows 8 pro and windows 7 on XPS 8500 Special Edition

    - by Jesse
    I am trying to install a dual boot with windows 7 premium and windows 8 Pro on an XPS 8500 special edition. I created a new primary partition on my C: drive, inserted the windows 8 install disk, and rebooted my computer from DVD. I select custom install and the dialog box saying "Where do you want to install windows at?" pops up but none of my drives are listed. Please help me determine what is going on. I don't understand why none of my drives are showing up on this menu. Not even the original drive. When I go to load driver and click on the partition I created it tells me "No signed device drivers were found. Make sure the installation media contains the correct drivers, and then click OK." resolved above issue by running setup from the source folder on the install disk instead of booting from DVD. Was able to locate my new partition and start install. It completes the first step of "Copying windows files" just fine but then on the next step "Getting files ready for installation" my computer restarts and attempts to load windows 8 but keeps telling me my pc needs to restart. This keeps going on in an infinite boot loop. Please help, this has been a nightmare!

    Read the article

  • Windows 8 doubling accents and diacritical marks

    - by Time Sheep
    I don't know what I installed, but I must have installed something that caused Windows to act this way. Normally when I press the button with either of the characters below ¨ ^ ~ ´ ` Windows types 2 of the character. Because of this, I cannot type in accented characters without using a keymap. Since my surname contains a diarhesis (U-umlaut), this feature is quite essential to me. Several of my friends claim to have had this problem before using Windows 7 as well, but never found a solution apart from reinstalling Windows. How do I get my beloved accented characters back?

    Read the article

  • Cannot type backquote or backtick in xterm

    - by Cocoro Cara
    Ubuntu 10.10, XTerm(261), Keyboard layout = Canadian Somehow, the backquote (backtick = `) character can't be input does not get entered in XTerm. I type it and nothing happens. The cursor does not move forward. I know it works because I can input it in Terminal (gnome-terminal). The only strange thing is that I have to type the key twice for it to appear. Just to test it, I tried typing it in other applications, and the same thing happens. Have to type it twice in FF, gedit, etc. One more strange thing, I could not input it into this textbox in which I am typing this message. But I can input it in the URL bar, search bar, etc. Someone please help me solve this mystery. I like to use XTerm and I need the backquotes.

    Read the article

  • Text after Control Sequence

    - by SPAM SPAM SPAM SPAM
    I am trying to parse the output of a command that expects to be writing to the screen. It has data separated by move-to-origin control sequences (for the VT220, ESC[1;1H). I only need the last part (i.e. after the last move-to-origin). I have tried doing this multiple ways (primarily awk and sed), but the problem is always that parts of the control sequence have special meaning (to the program, not just to the shell), and I cannot quote them when I substitute tput's output. Any suggestions?

    Read the article

  • Lucene and Special Characters

    - by Brandon
    I am using Lucene.Net 2.0 to index some fields from a database table. One of the fields is a 'Name' field which allows special characters. When I perform a search, it does not find my document that contains a term with special characters. I index my field as such: Directory DALDirectory = FSDirectory.GetDirectory(@"C:\Indexes\Name", false); Analyzer analyzer = new StandardAnalyzer(); IndexWriter indexWriter = new IndexWriter(DALDirectory, analyzer, true, IndexWriter.MaxFieldLength.UNLIMITED); Document doc = new Document(); doc.Add(new Field("Name", "Test (Test)", Field.Store.YES, Field.Index.TOKENIZED)); indexWriter.AddDocument(doc); indexWriter.Optimize(); indexWriter.Close(); And I search doing the following: value = value.Trim().ToLower(); value = QueryParser.Escape(value); Query searchQuery = new TermQuery(new Term(field, value)); Searcher searcher = new IndexSearcher(DALDirectory); TopDocCollector collector = new TopDocCollector(searcher.MaxDoc()); searcher.Search(searchQuery, collector); ScoreDoc[] hits = collector.TopDocs().scoreDocs; If I perform a search for field as 'Name' and value as 'Test', it finds the document. If I perform the same search as 'Name' and value as 'Test (Test)', then it does not find the document. Even more strange, if I remove the QueryParser.Escape line do a search for a GUID (which, of course, contains hyphens) it finds documents where the GUID value matches, but performing the same search with the value as 'Test (Test)' still yields no results. I am unsure what I am doing wrong. I am using the QueryParser.Escape method to escape the special characters and am storing the field and searching by the Lucene.Net's examples. Any thoughts?

    Read the article

  • Control characters as delimiters

    - by Gio Borje
    I have a nodejs TCP server and a client. Basic network communication happens. Client sends "data + STX_CHARACTER + data + ETX_CHARACTER" (just an example). How do I split the string using the STX Control Character as a delimiter or how do I reference the character at all in Javascript.

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Drupal node_save and special characters.

    - by Pierre
    Hello, i'm trying to create nodes and taxonomy terms through a custom php script by using the node_save() function. I'm working on drupal 6. It's working well (thanks to previous questions on stackoverflow) except for accented letters. Indeed, when a title or a taxonomy term contain "é", "è" or "à", the sentence is cut before those special characters. For example, a title like that: "Bonjour les éléphants" will create a node with "Bonjour les " as title. I don't know if it's linked to my database or if i have to use a special encoding in php (iconv() blabla) The fact is, for drupal titles, i can not use html encoding (for example: é is é in html) because drupal will render &eacute and not é... When i create a taxonomy or a title manually, i have no problems and the accented letter is saved in the database as "é". Soo if you can help me to create terms and title with accented letters, that will be great : ) Thank you !

    Read the article

  • TSQL Query: Escaping Special Characters

    - by Abs
    Hello all, I am trying to escape special characters in a TSQL query. I have done this before: SELECT columns FROM table WHERE column LIKE '%\%%' ESCAPE '\' And it has worked. Now I have tried to do this now: UPDATE match SET rule_name='31' ESCAPE '\' But it has failed. I know none of the vlaues have a \ but it should still work. I am guessing its because it needs a LIKE statement but how else can I escape characters that I am adding to a database? In addition, does anyone have a link to all the special characters that should be escaped, I couldn't find any documentation on this! Thanks all for any help

    Read the article

  • WPF Localization Using LocBaml: Handling Special Symbols

    - by Aryeh
    Hello, I’m dealing with localization of a WPF application (Visual Studio 2010 under Windows 7). I’ve just accomplished the whole process of localization using LocBaml tool, as explained in WPF Globalization and Localization Overview and in related posts. The target language is Italian (it-IT culture). When I run my application in Italian, I have a problem with interpretation of the special symbols of © and ™: they both appear there as a white question sign upon a black diamond-shaped background. The symbols © and ™ appear identically in both English and Italian CSV-files. I tried also the special letters (such as È, à etc.) that are present in Italian but absent in English, and they also are interpreted as the above diamond-shaped question. In Region and Language, I changed the system locale to Italian[Italy], restarted the PC and ran the application again – this helped me in the past to cope with a similar problem in localization of C++ applications under Windows XP, but now it didn’t help, either. Has somebody any idea what is the catch here?

    Read the article

  • XPath and special characters

    - by Bryan
    I am having an issue with an XPath query I'm performing for a Sitecore CMS system. This query works fine: /root/content/Meta-Data/Tips/* But when I try this: /root/content/Meta-Data/Tips/*[@SomeAttribute='somekey'] I get an error which says "End of string expected at position 22" which is where the dash character is found. I was under the impression that the dash was not a special character in XML... am I doing something wrong here? Do I need to encode this in some way? Or is this a bug in the XPath parser? Any suggested workarounds?

    Read the article

  • php strpos special characters

    - by Radu
    I'm using PHP Version 5.1.6 I have a string (session file) and need to extract a value from it, so i'm searching for a needle in the string but it returns false, I reduced the code to this: $string = ';SERVER_NAME|s:17:"stackoverflow.com";REMOTE_ADDR|s:13:"69.59.196.211";'; $start = strpos($string, ';SERVER_NAME|s:"'); echo $start; // prints nothing because $start = false $start = strpos($string, 'SERVER_NAME|s:'); echo $start; // prints 1; As you noticed if I have the character ';' or the character '"' in the needle, the search returns false, I tryed to use chr() for all characters in the needle but had the same result, If I remove the ';' and the '"' from the string if finds the needle in the string. How can I search special characters in a string using PHP ?

    Read the article

  • .NET Web Service Proxy is adding special characters in XML

    - by xkingpin
    My web service proxy seems to be adding special characters like "*" and "#" etc. within the xml nodes. My proxy created lists using arrays of objects. I am trying to create a generic list and then doing list.ToArray() to set the proxy MyProxyObject[] object. Is this the cause of the problem I am having? I plan on running fiddler on the request later but it is over SSL and I do not have access to the URL at the moment. Here is an example of the XML that is generated: <soap:Envelope xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> * <soap:Body> o I'm a little concerned because the special characters are even occuring before the array nodes

    Read the article

< Previous Page | 15 16 17 18 19 20 21 22 23 24 25 26  | Next Page >