Search Results

Search found 5262 results on 211 pages for 'operation'.

Page 193/211 | < Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >

• Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

  - by gWiz

  I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Java Best Practice for type resolution at runtime.

  - by Brian

  I'm trying to define a class (or set of classes which implement the same interface) that will behave as a loosely typed object (like JavaScript). They can hold any sort of data and operations on them depend on the underlying type. I have it working in three different ways but none seem ideal. These test versions only allow strings and integers and the only operation is add. Adding integers results in the sum of the integer values, adding strings concatenates the strings and adding an integer to a string converts the integer to a string and concatenates it with the string. The final version will have more types (Doubles, Arrays, JavaScript-like objects where new properties can be added dynamically) and more operations. Way 1: public interface DynObject1 { @Override public String toString(); public DynObject1 add(DynObject1 d); public DynObject1 addTo(DynInteger1 d); public DynObject1 addTo(DynString1 d); } public class DynInteger1 implements DynObject1 { private int value; public DynInteger1(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject1 add(DynObject1 d) { return d.addTo(this); } public DynObject1 addTo(DynInteger1 d) { return new DynInteger1(d.value + value); } public DynObject1 addTo(DynString1 d) { return new DynString1(d.toString()+Integer.toString(value)); } } ...and similar for DynString1 Way 2: public interface DynObject2 { @Override public String toString(); public DynObject2 add(DynObject2 d); } public class DynInteger2 implements DynObject2 { private int value; public DynInteger2(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject2 add(DynObject2 d) { Class c = d.getClass(); if(c==DynInteger2.class) { return new DynInteger2(value + ((DynInteger2)d).value); } else { return new DynString2(toString() + d.toString()); } } } ...and similar for DynString2 Way 3: public class DynObject3 { private enum ObjectType { Integer, String }; Object value; ObjectType type; public DynObject3(Integer v) { value = v; type = ObjectType.Integer; } public DynObject3(String v) { value = v; type = ObjectType.String; } @Override public String toString() { return value.toString(); } public DynObject3 add(DynObject3 d) { if(type==ObjectType.Integer && d.type==ObjectType.Integer) { return new DynObject3(Integer.valueOf(((Integer)value).intValue()+((Integer)value).intValue())); } else { return new DynObject3(value.toString()+d.value.toString()); } } } With the if-else logic I could use value.getClass()==Integer.class instead of storing the type but with more types I'd change this to use a switch statement and Java doesn't allow switch to use Classes. Anyway... My question is what is the best way to go about something thike this?

  Read the article

• Invalid Cross-Thread Operations from BackgroundWorker2_RunWorkerCompleted in C#

  - by Jim Fell

  Hello. I'm getting an error that does not make sense. Cross-thread operation not valid: Control 'buttonOpenFile' accessed from a thread other than the thread it was created on. In my application, the UI thread fires off backgroundWorker1, which when almost complete fires off backgroundWorker2 and waits for it to complete. backgroundWorker1 waits for backgroundWorker2 to complete, before it completes. AutoResetEvent variables are used to flag when each of the workers complete. In backgroundWorker2_RunWorkerComplete a function is called that resets the form controls. It is in this ResetFormControls() function where the exception is thrown. I thought it was safe to modify form controls in the RunWorkerCompleted function. Both background workers are instantiated from the UI thread. Here is a greatly summarized version of what I am doing: AutoResetEvent evtProgrammingComplete_c = new AutoResetEvent(false); AutoResetEvent evtResetComplete_c = new AutoResetEvent(false); private void ResetFormControls() { toolStripProgressBar1.Enabled = false; toolStripProgressBar1.RightToLeftLayout = false; toolStripProgressBar1.Value = 0; buttonInit.Enabled = true; buttonOpenFile.Enabled = true; // Error occurs here. buttonProgram.Enabled = true; buttonAbort.Enabled = false; buttonReset.Enabled = true; checkBoxPeripheryModule.Enabled = true; checkBoxVerbose.Enabled = true; comboBoxComPort.Enabled = true; groupBoxToolSettings.Enabled = true; groupBoxNodeSettings.Enabled = true; } private void buttonProgram_Click(object sender, EventArgs e) { while (backgroundWorkerProgram.IsBusy) backgroundWorkerProgram.CancelAsync(); backgroundWorkerProgram.RunWorkerAsync(); } private void backgroundWorkerProgram_DoWork(object sender, DoWorkEventArgs e) { // Does a bunch of stuff... if (tProgramStat_c == eProgramStat_t.DONE) { tProgramStat_c = eProgramStat_t.RESETTING; while (backgroundWorkerReset.IsBusy) backgroundWorkerReset.CancelAsync(); backgroundWorkerReset.RunWorkerAsync(); evtResetComplete_c.WaitOne(LONG_ACK_WAIT * 2); if (tResetStat_c == eResetStat_t.COMPLETED) tProgramStat_c = eProgramStat_t.DONE; } } private void backgroundWorkerProgram_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { // Updates form to report complete. No problems here. evtProgrammingComplete_c.Set(); backgroundWorkerProgram.Dispose(); } private void backgroundWorkerReset_DoWork(object sender, DoWorkEventArgs e) { // Does a bunch of stuff... if (tResetStat_c == eResetStat_t.COMPLETED) if (tProgramStat_c == eProgramStat_t.RESETTING) evtProgrammingComplete_c.WaitOne(); } private void backgroundWorkerReset_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { CloseAllComms(); ResetFormControls(); evtResetComplete_c.Set(); backgroundWorkerReset.Dispose(); } Any thoughts or suggestions you may have would be appreciated. I am using Microsoft Visual C# 2008 Express Edition. Thanks.

  Read the article

• Is order of parameters for database Command object really important?

  - by nawfal

  I was debugging a database operation code and I found that proper UPDATE was never happening though the code never failed as such. This is the code: condb.Open(); OleDbCommand dbcom = new OleDbCommand("UPDATE Word SET word=?,sentence=?,mp3=? WHERE id=? AND exercise_id=?", condb); dbcom.Parameters.AddWithValue("id", wd.ID); dbcom.Parameters.AddWithValue("exercise_id", wd.ExID); dbcom.Parameters.AddWithValue("word", wd.Name); dbcom.Parameters.AddWithValue("sentence", wd.Sentence); dbcom.Parameters.AddWithValue("mp3", wd.Mp3); But after some tweaking this worked: condb.Open(); OleDbCommand dbcom = new OleDbCommand("UPDATE Word SET word=?,sentence=?,mp3=? WHERE id=? AND exercise_id=?", condb); dbcom.Parameters.AddWithValue("word", wd.Name); dbcom.Parameters.AddWithValue("sentence", wd.Sentence); dbcom.Parameters.AddWithValue("mp3", wd.Mp3); dbcom.Parameters.AddWithValue("id", wd.ID); dbcom.Parameters.AddWithValue("exercise_id", wd.ExID); Why is it so important that the parameters in WHERE clause has to be given the last in case of OleDb connection? Having worked with MySQL previously, I could (and usually do) write parameters of WHERE clause first because that's more logical to me. Is parameter order important when querying database in general? Some performance concern or something? Is there a specific order to be maintained in case of other databases like DB2, Sqlite etc? Update: I got rid of ? and included proper names with and without @. The order is really important. In both cases only when WHERE clause parameters was mentioned last, actual update happened. To make matter worse, in complex queries, its hard to know ourselves which order is Access expecting, and in all situations where order is changed, the query doesnt do its intended duty with no warning/error!!

  Read the article

• Resize AIR app window while dragging

  - by matt lohkamp

  So I've noticed Windows 7 has a disturbing tendency to prevent you from dragging the title bar of windows off the top of the screen. If you try - in this case, using an air app with a draggable area at the bottom of the window, allowing you to push the top of the window up past the screen - it just kicks the window back down far enough that the title bar is at the top of what it considers the 'visible area.' One solution would be to resize the app window as it moves, so that the title bar is always where windows wants it. How would you resize the window while you're dragging it, though? Would you do it like this? dragHitArea.addEventListener(MouseEvent.MOUSE_DOWN, function(e:MouseEvent):void{ stage.nativeWindow.height += 50; stage.nativeWindow.startMove(); stage.nativeWindow.height -= 50; }); see what's going on there? When I click, I'm doing startMove(), which is hooking into the OS' function for dragging a window around. I'm also increasing and decreasing the height of the window by 50 pixels - which should give me no net increase, right? Wrong - the first '.height +=' gets executed, but the '.height -=' after the .startMove() never runs. Why? update - If you're curious, I'm programming an air widget with fly-out menus which expand rightwards and upwards - and since those element can only be displayed within the boundaries of the application window itself (even though the window is set to be chromeless and transparent) I have to expand the application's borders to include the area that the menu 'pops up' into. In the extreme case, with the widget positioned bottom left, and the menus expanded completely across to the right side and top edge of the screen, the application area could very well cover the entire desktop. The problem is, when it's expanded like this, if the user drags it up and to the right, it causes the 'title bar' area of the application window to move above the top edge of the desktop area, where it would normally be unreachable; and Windows automatically re-positions the window back below that edge once the .startMove() operation is completed. So what I want to do is continually resize the height of the application so that the visual effect will be the same for the user, but for the benefit of the operating system the window's title bar will never be above that top boundary of the desktop area.

  Read the article

• Using drawAtPoint with my CIImage not doing anything on screen

  - by Adam

  Stuck again. :( I have the following code crammed into a procedure invoked when I click on a button on my application main window. I'm just trying to tweak a CIIMage and then display the results. At this point I'm not even worried about exactly where / how to display it. I'm just trying to slam it up on the window to make sure my Transform worked. This code seems to work down through the drawAtPoint message. But I never see anything on the screen. What's wrong? Thanks. Also, as far as displaying it in a particular location on the window ... is the best technique to put a frame of some sort on the window, then get the coordinates of that frame and "draw into" that rectangle? Or use a specific control from IB? Or what? Thanks again. // earlier I initialize a NSImage from JPG file on disk. // then create NSBitmapImageRep from the NSImage. This all works fine. // then ... CIImage * inputCIimage = [[CIImage alloc] initWithBitmapImageRep:inputBitmap]; if (inputCIimage == Nil) NSLog(@"could not create CI Image"); else { NSLog (@"CI Image created. working on transform"); CIFilter *transform = [CIFilter filterWithName:@"CIAffineTransform"]; [transform setDefaults]; [transform setValue:inputCIimage forKey:@"inputImage"]; NSAffineTransform *affineTransform = [NSAffineTransform transform]; [affineTransform rotateByDegrees:3]; [transform setValue:affineTransform forKey:@"inputTransform"]; CIImage * myResult = [transform valueForKey:@"outputImage"]; if (myResult == Nil) NSLog(@"Transformation failed"); else { NSLog(@"Created transformation successfully ... now render it"); [myResult drawAtPoint: NSMakePoint ( 0,0 ) fromRect: NSMakeRect ( 0,0,128,128 ) operation: NSCompositeSourceOver fraction: 1.0]; //100% opaque [inputCIimage release]; } }

  Read the article

• C++ Beginner - 'friend' functions and << operator overloading: What is the proper way to overload an

  - by Francisco P.

  Hello, everyone! In a project I'm working on, I have a Score class, defined below in score.h. I am trying to overload it so, when a << operation is performed on it, _points + " " + _name is returned. Here's what I tried to do: ostream & Score::operator<< (ostream & os, Score right) { os << right.getPoints() << " " << right.scoreGetName(); return os; } Here are the errors returned: 1>c:\users\francisco\documents\feup\1a2s\prog\projecto3\projecto3\score.h(30) : error C2804: binary 'operator <<' has too many parameters (This error appears 4 times, actually) I managed to get it working by declaring the overload as a friend function: friend ostream & operator<< (ostream & os, Score right); And removing the Score:: from the function declaration in score.cpp (effectively not declaring it as a member). Why does this work, yet the code describe above doesn't? Thanks for your time! Below is the full score.h /////////////////////////////////////////////////////////// // Score.h // Implementation of the Class Score // Created on: 10-Mai-2010 11:43:56 // Original author: Francisco /////////////////////////////////////////////////////////// #ifndef SCORE_H_ #define SCORE_H_ #include <string> #include <iostream> #include <iostream> using std::string; using std::ostream; class Score { public: Score(string name); Score(); virtual ~Score(); void addPoints(int n); string scoreGetName() const; int getPoints() const; void scoreSetName(string name); bool operator>(const Score right) const; ostream & operator<< (ostream & os, Score right); private: string _name; int _points; }; #endif

  Read the article

• FILE_NOT_FOUND when trying to open COM port C++

  - by Moutabreath

  I am trying to open a com port for reading and writing using C++ but I can't seem to pass the first stage of actually opening it. I get an INVALID_HANDLE_VALUE on the handle with GetLastError FILE_NOT_FOUND. I have searched around the web for a couple of days I'm fresh out of ideas. I have searched through all the questions regarding COM on this website too. I have scanned through the existing ports (or so I believe) to get the name of the port right. I also tried combinations of _T("COM1") with the slashes, without the slashes, with colon, without colon and without the _T I'm using windows 7 on 64 bit machine. this is the code i got I'll be glad for any input on this void SendToCom(char* data, int len) { DWORD cbNeeded = 0; DWORD dwPorts = 0; EnumPorts(NULL, 1, NULL, 0, &cbNeeded, &dwPorts); //What will be the return value BOOL bSuccess = FALSE; LPCSTR COM1 ; BYTE* pPorts = static_cast<BYTE*>(malloc(cbNeeded)); bSuccess = EnumPorts(NULL, 1, pPorts, cbNeeded, &cbNeeded, &dwPorts); if (bSuccess){ PORT_INFO_1* pPortInfo = reinterpret_cast<PORT_INFO_1*>(pPorts); for (DWORD i=0; i<dwPorts; i++) { //If it looks like "COMX" then size_t nLen = _tcslen(pPortInfo->pName); if (nLen > 3) { if ((_tcsnicmp(pPortInfo->pName, _T("COM"), 3) == 0) ){ COM1 =pPortInfo->pName; //COM1 ="\\\\.\\COM1"; HANDLE m_hCommPort = CreateFile( COM1 , GENERIC_READ|GENERIC_WRITE, // access ( read and write) 0, // (share) 0:cannot share the COM port NULL, // security (None) OPEN_EXISTING, // creation : open_existing FILE_FLAG_OVERLAPPED, // we want overlapped operation NULL // no templates file for COM port... ); if (m_hCommPort==INVALID_HANDLE_VALUE) { DWORD err = GetLastError(); if (err == ERROR_FILE_NOT_FOUND) { MessageBox(hWnd,"ERROR_FILE_NOT_FOUND",NULL,MB_ABORTRETRYIGNORE); } else if(err == ERROR_INVALID_NAME) { MessageBox(hWnd,"ERROR_INVALID_NAME",NULL,MB_ABORTRETRYIGNORE); } else { MessageBox(hWnd,"unkown error",NULL,MB_ABORTRETRYIGNORE); } } else{ WriteAndReadPort(m_hCommPort,data); } } pPortInfo++; } } } }

  Read the article

• Using Selenium-IDE with a rich Javascript application?

  - by Darien

  Problem At my workplace, we're trying to find the best way to create automated-tests for an almost wholly javascript-driven intranet application. Right now we're stuck trying to find a good tradeoff between: Application code in reusable and nest-able GUI components. Tests which are easily created by the testing team Tests which can be recorded once and then automated Tests which do not break after small cosmetic changes to the site XPath expressions (or other possible expressions, like jQuery selectors) naively generated from Selenium-IDE are often non-repeatable and very fragile. Conversely, having the JS code generate special unique ID values for every important DOM-element on the page... well, that is its own headache, complicated by re-usable GUI components and IDs needing to be consistent when the test is re-run. What successes have other people had with this kind of thing? How do you do automated application-level testing of a rich JS interface? Limitations We are using JavascriptMVC 2.0, hopefully 3.0 soon so that we can upgrade to jQuery 1.4.x. The test-making folks are mostly trained to use Selenium IDE to directly record things. The test leads would prefer a page-unique HTML ID on each clickable element on the page... Training the testers to write or alter special expressions (such as telling them which HTML class-names are important branching points) is a no-go. We try to make re-usable javascript components, but this means very few GUI components can treat themselves (or what they contain) as unique. Some of our components already use HTML ID values in their operation. I'd like to avoid doing this anyway, but it complicates the idea of ID-based testing. It may be possible to add custom facilities (like a locator-builder or new locator method) to the Selenium-IDE installation testers use. Almost everything that goes on occurs within a single "page load" from a conventional browser perspective, even when items are saved Current thoughts I'm considering a system where a custom locator-builder (javascript code) for Selenium-IDE will talk with our application code as the tester is recording. In this way, our application becomes partially responsible for generating a mostly-flexible expression (XPath or jQuery) for any given DOM element. While this can avoid requiring more training for testers, I worry it may be over-thinking things.

  Read the article

• SQL Server - Get Inserted Record Identity Value when Using a View's Instead Of Trigger

  - by CuppM

  For several tables that have identity fields, we are implementing a Row Level Security scheme using Views and Instead Of triggers on those views. Here is a simplified example structure: -- Table CREATE TABLE tblItem ( ItemId int identity(1,1) primary key, Name varchar(20) ) go -- View CREATE VIEW vwItem AS SELECT * FROM tblItem -- RLS Filtering Condition go -- Instead Of Insert Trigger CREATE TRIGGER IO_vwItem_Insert ON vwItem INSTEAD OF INSERT AS BEGIN -- RLS Security Checks on inserted Table -- Insert Records Into Table INSERT INTO tblItem (Name) SELECT Name FROM inserted; END go If I want to insert a record and get its identity, before implementing the RLS Instead Of trigger, I used: DECLARE @ItemId int; INSERT INTO tblItem (Name) VALUES ('MyName'); SELECT @ItemId = SCOPE_IDENTITY(); With the trigger, SCOPE_IDENTITY() no longer works - it returns NULL. I've seen suggestions for using the OUTPUT clause to get the identity back, but I can't seem to get it to work the way I need it to. If I put the OUTPUT clause on the view insert, nothing is ever entered into it. -- Nothing is added to @ItemIds DECLARE @ItemIds TABLE (ItemId int); INSERT INTO vwItem (Name) OUTPUT INSERTED.ItemId INTO @ItemIds VALUES ('MyName'); If I put the OUTPUT clause in the trigger on the INSERT statement, the trigger returns the table (I can view it from SQL Management Studio). I can't seem to capture it in the calling code; either by using an OUTPUT clause on that call or using a SELECT * FROM (). -- Modified Instead Of Insert Trigger w/ Output CREATE TRIGGER IO_vwItem_Insert ON vwItem INSTEAD OF INSERT AS BEGIN -- RLS Security Checks on inserted Table -- Insert Records Into Table INSERT INTO tblItem (Name) OUTPUT INSERTED.ItemId SELECT Name FROM inserted; END go -- Calling Code INSERT INTO vwItem (Name) VALUES ('MyName'); The only thing I can think of is to use the IDENT_CURRENT() function. Since that doesn't operate in the current scope, there's an issue of concurrent users inserting at the same time and messing it up. If the entire operation is wrapped in a transaction, would that prevent the concurrency issue? BEGIN TRANSACTION DECLARE @ItemId int; INSERT INTO tblItem (Name) VALUES ('MyName'); SELECT @ItemId = IDENT_CURRENT('tblItem'); COMMIT TRANSACTION Does anyone have any suggestions on how to do this better? I know people out there who will read this and say "Triggers are EVIL, don't use them!" While I appreciate your convictions, please don't offer that "suggestion".

  Read the article

• Problem in suspending 2 threads at the same time in MFC!

  - by kiddo

  I am learning about threading and multithreading..so i just created a small application in which i will update the progressbar and a static text using threading.I vl get two inputs from the user, start and end values for how long the loop should rotate.I have 2threads in my application. Thread1- to update the progressbar(according to the loop) the static text which will show the count(loop count). Thread2 - to update the another static text which will just diplay a name Basically if the user clicks start, the progressbar steps up and at the same time filecount and the name are displayed parallely. There's is another operation where if the user clicks pause it(thread) has to suspend until the user clicks resume. The problem is,the above will not work(will not suspend and resume) for both thread..but works for a singlw thread. Please check the code to get an idea and reply me what can done! on button click start void CThreadingEx3Dlg::OnBnClickedStart() { m_ProgressBar.SetRange(start,end); myThread1 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction1,this); myThread2 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction2,this); } thread1 UINT MyThreadFunction1(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int intvalue =pthis->start;intvalue<=pthis->end; ++intvalue) { pthis->SendMessage(WM_MY_THREAD_MESSAGE1,intvalue); } return 0; } thread1 function LRESULT CThreadingEx3Dlg::OnThreadMessage1(WPARAM wparam,LPARAM lparam) { int nProgress= (int)wparam; m_ProgressBar.SetPos(nProgress); CString strStatus; strStatus.Format(L"Thread1:Processing item: %d", nProgress); m_Static.SetWindowText(strStatus); Sleep(100); return 0; } thread2 UINT MyThreadFunction2(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int i =pthis->start;i<=pthis->end;i++) { pthis->SendMessage(WM_MY_THREAD_MESSAGE2,i); } return 0; } thread2 function LRESULT CThreadingEx3Dlg::OnThreadMessage2(WPARAM wparam,LPARAM lparam) { m_Static1.GetDlgItem(IDC_STATIC6); m_Static1.SetWindowTextW(L"Thread2 Running"); Sleep(100); m_Static1.SetWindowTextW(L""); Sleep(100); return TRUE; } void CThreadingEx3Dlg::OnBnClickedPause() { // TODO: Add your control notification handler code here if(!m_Track) { m_Track = TRUE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Resume"); myThread1->SuspendThread(); WaitForSingleObject(myThread1->m_hThread,INFINITE); myThread2->SuspendThread(); m_Static.SetWindowTextW(L"Paused.."); } else { m_Track = FALSE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Pause"); myThread1->ResumeThread(); myThread2->ResumeThread(); /*myEventHandler.SetEvent(); WaitForSingleObject(myThread1->m_hThread,INFINITE);*/ } }

  Read the article

• Why is this statement treated as a string instead of its result?

  - by reve_etrange

  I am trying to perform some composition-based filtering on a large collection of strings (protein sequences). I wrote a group of three subroutines in order to take care of it, but I'm running into trouble in two ways - one minor, one major. The minor trouble is that when I use List::MoreUtils 'pairwise' I get warnings about using $a and $b only once and them being uninitialized. But I believe I'm calling this method properly (based on CPAN's entry for it and some examples from the web). The major trouble is an error "Can't use string ("17/32") as HASH ref while "strict refs" in use..." It seems like this can only happen if the foreach loop in &comp is giving the hash values as a string instead of evaluating the division operation. I'm sure I've made a rookie mistake, but can't find the answer on the web. The first time I even looked at perl code was last Wednesday... use List::Util; use List::MoreUtils; my @alphabet = ( 'A', 'R', 'N', 'D', 'C', 'Q', 'E', 'G', 'H', 'I', 'L', 'K', 'M', 'F', 'P', 'S', 'T', 'W', 'Y', 'V' ); my $gapchr = '-'; # Takes a sequence and returns letter = occurrence count pairs as hash. sub getcounts { my %counts = (); foreach my $chr (@alphabet) { $counts{$chr} = ( $[0] =~ tr/$chr/$chr/ ); } $counts{'gap'} = ( $[0] =~ tr/$gapchr/$gapchr/ ); return %counts; } # Takes a sequence and returns letter = fractional composition pairs as a hash. sub comp { my %comp = getcounts( $[0] ); foreach my $chr (@alphabet) { $comp{$chr} = $comp{$chr} / ( length( $[0] ) - $comp{'gap'} ); } return %comp; } # Takes two sequences and returns a measure of the composition difference between them, as a scalar. # Originally all on one line but it was unreadable. sub dcomp { my @dcomp = pairwise { $a - $b } @{ values( %{ comp( $[0] ) } ) }, @{ values( %{ comp( $[1] ) } ) }; @dcomp = apply { $_ ** 2 } @dcomp; my $dcomp = sqrt( sum( 0, @dcomp ) ) / 20; return $dcomp; } Much appreciation for any answers or advice!

  Read the article

• Is there a way to keep track of the ordering of items in a dictionary?

  - by Corpsekicker

  I have a Dictionary<Guid, ElementViewModel>. (ElementViewModel is our own complex type.) I add items to the dictionary with a stock standard items.Add(Guid.NewGuid, new ElementViewModel() { /*setters go here*/ });, At a later stage I remove some or all of these items. A simplistic view of my ElementViewModel is this: class ElementViewModel { Guid Id { get; set; } string Name { get; set; } int SequenceNo { get; set; } } It may be significant to mention that the SequenceNos are compacted within the collection after adding, in case other operations like moving and copying took place. {1, 5, 6} - {1, 2, 3} A simplistic view of my remove operation is: public void RemoveElementViewModel(IEnumerable<ElementViewModel> elementsToDelete) { foreach (var elementViewModel in elementsToDelete) items.Remove(elementViewModel.Id); CompactSequenceNumbers(); } I will illustrate the problem with an example: I add 3 items to the dictionary: var newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 1, Name = "Element 1" }); newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 2, Name = "Element 2" }); newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 3, Name = "Element 3" }); I remove 2 items RemoveElementViewModel(new List<ElementViewModel> { item2, item3 }); //imagine I had them cached somewhere. Now I want to add 2 other items: newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 2, Name = "Element 2, Part 2" }); newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 3, Name = "Element 3, Part 2" }); On evaluation of the dictionary at this point, I expected the order of items to be "Element 1", "Element 2, Part 2", "Element 3, Part 2" but it is actually in the following order: "Element 1", "Element 3, Part 2", "Element 2, Part 2" I rely on the order of these items to be a certain way. Why is it not as expected and what can I do about it?

  Read the article

• Conceptual inheritance implementation

  - by TheSENDER

  Hi there, I'm writing a spatial data structure and I have a doubt about what's the best NODE implementation. According to my design I have an abstract node entity and three classes which inherit from it: EMPTYNODE, FULLNODE, INTERNALNODE. The first one has no particular data. The second one has 1 reference to a generic element. The third one has 2 references to other nodes. I have found several ways to implement this situation (that I have already coded) but I can't decide what's the best. The first solution that I have found is to use a single class Node that potentially performs all the operation in this way: private static class Node { private Elem elem = null; private Node left = null, right = null; public Elem getElem() { assert isFull(); return elem; } public boolean isEmpty() { return elem == null && left == null; } public boolean isFull() { return elem != null; } public boolean isInternal() { return elem == null && left != null; } } The second solution is to write an explicit division by classes where every class offers only its methods. Obviously in this way we are obliged to perform several casts to the node objects. private static abstract class Node { public abstract boolean isEmpty(); public abstract boolean isFull(); public abstract boolean isInternal(); } private static class FullNode extends Node{ private ITriangle elem; @Override public boolean isEmpty() { return false; } @Override public final boolean isFull() { return true; } @Override public final boolean isInternal() { return false; } public Elem getElem() { return elem; } } The third one solution is to use the inheritance allowing every classes to offer all the methods, but the object type should by check by "isEmpty()" and similar methods. In case of wrong call we'll throw an exception. private static abstract class Node { public abstract boolean isEmpty(); public abstract boolean isFull(); public abstract boolean isInternal(); public abstract Elem getElem(); } private static class Empty extends Node{ @Override public boolean isEmpty() { return true; } @Override public final boolean isFull() { return false; } @Override public final boolean isInternal() { return false; } @Override public Elem getElem() { throw new AssertionError(); } } What do you think about these three solutions? Which one would you use? Any other ideas? Thanks for your help. Every idea will be appreciated.

  Read the article

• 'Timeout Expired' error against local SQL Express on only 2 LINQ Methods...

  - by Refracted Paladin

  I am going to sum up my problem first and then offer massive details and what I have already tried. Summary: I have an internal winform app that uses Linq 2 Sql to connect to a local SQL Express database. Each user has there own DB and the DB stay in sync through Merge Replication with a Central DB. All DB's are SQL 2005(sp2or3). We have been using this app for over 5 months now but recently our users are getting a Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Detailed: The strange part is they get that in two differnt locations(2 differnt LINQ Methods) and only the first time they fire in a given time period(~5mins). One LINQ method is pulling all records that match a FK ID and then Manipulating them to form a Heirarchy View for a TreeView. The second is pulling all records that match a FK ID and dumping them into a DataGridView. The only things I can find in common with the 2 are that the first IS an IEnumerable and the second converts itself from IQueryable - IEnumerable - DataTable... I looked at the query's in Profiler and they 'seemed' normal. They are not very complicated querys. They are only pulling back 10 - 90 records, from one table. Any thoughts, suggestions, hints whatever would be greatly appreciated. I am at my wit's end on this.... public IList<CaseNoteTreeItem> GetTreeViewDataAsList(int personID) { var myContext = MatrixDataContext.Create(); var caseNotesTree = from cn in myContext.tblCaseNotes where cn.PersonID == personID orderby cn.ContactDate descending, cn.InsertDate descending select new CaseNoteTreeItem { CaseNoteID = cn.CaseNoteID, NoteContactDate = Convert.ToDateTime(cn.ContactDate). ToShortDateString(), ParentNoteID = cn.ParentNote, InsertUser = cn.InsertUser, ContactDetailsPreview = cn.ContactDetails.Substring(0, 75) }; return caseNotesTree.ToList<CaseNoteTreeItem>(); } AND THIS ONE public static DataTable GetAllCNotes(int personID) { using (var context = MatrixDataContext.Create()) { var caseNotes = from cn in context.tblCaseNotes where cn.PersonID == personID orderby cn.ContactDate select new { cn.ContactDate, cn.ContactDetails, cn.TimeSpentUnits, cn.IsCaseLog, cn.IsPreEnrollment, cn.PresentAtContact, cn.InsertDate, cn.InsertUser, cn.CaseNoteID, cn.ParentNote }; return caseNotes.ToList().CopyLinqToDataTable(); } }

  Read the article

• Adding a clustered index to a SQL table: what dangers exist for a live production system?

  - by MoSlo

  Right, keep in mind i need to describe this by abstracting all possible confidential info: I've been put in charge of a 10-year old transactional system of which the majority business logic is implemented at database level (triggers, stored procedures etc). Win2000 server, MSSQL 2000 Enterprise. No immediate plans for replacing/updating the system are being considered :( The core process is a program that executes transactions - specifically, it executes a stored procedure with various parameters, lets call it sp_ProcessTrans. The program executes the stored procedure at asynchronous intervals. By itself, things work fine. But there are 30 instances of this program on remotely located workstations, all of them asynchronously executing sp_ProcessTrans and then retrieving data from the SQL server (execution is pretty regular - ranging 0 to 60 times a minute, depending on what items the program instance is responsible for) . Performance of the system has dropped considerably with 10 yrs of data growth: the reason is the deadlocks and specifically deadlock wait times. The deadlock is on the Employee table. I have discovered: In sp_ProcessTrans' execution, it selects from an Employee table 7 times (dont ask) The select is done on a field that is NOT the primary key No index exists on this field. Thus a table scan is performed. 7 times. per transaction So the reason for deadlocks is clear. I created a non-unique ordered clustered index on the field (field looks good, almost unique, NUM(7), very rarely changes). Immediate improvement in the test environment. The problem is that i cannot simulate the deadlocks in a test environment (I'd need 30 workstations; i'd need to simulate 'realistic' activity on those stations, so visualization is out). I need to know if i must schedule downtime. Creating an index shouldn't be a risky operation for MSSQL, but is there any danger (data corruption in transactions/select statements/extra wait time etc) to create this field index on the production database while the transactions are still taking place? (although i can select a time when transactions are fairly quiet through the 30 stations) Are there any hidden dangers i'm not seeing (not looking forward to needing to restore the DB if something goes wrong, restoring would take a lot of time with 10yrs of data).

  Read the article

• Is there a way to efficiently yield every file in a directory containing millions of files?

  - by Josh Smeaton

  I'm aware of os.listdir, but as far as I can gather, that gets all the filenames in a directory into memory, and then returns the list. What I want, is a way to yield a filename, work on it, and then yield the next one, without reading them all into memory. Is there any way to do this? I worry about the case where filenames change, new files are added, and files are deleted using such a method. Some iterators prevent you from modifying the collection during iteration, essentially by taking a snapshot of the state of the collection at the beginning, and comparing that state on each move operation. If there is an iterator capable of yielding filenames from a path, does it raise an error if there are filesystem changes (add, remove, rename files within the iterated directory) which modify the collection? There could potentially be a few cases that could cause the iterator to fail, and it all depends on how the iterator maintains state. Using S.Lotts example: filea.txt fileb.txt filec.txt Iterator yields filea.txt. During processing, filea.txt is renamed to filey.txt and fileb.txt is renamed to filez.txt. When the iterator attempts to get the next file, if it were to use the filename filea.txt to find it's current position in order to find the next file and filea.txt is not there, what would happen? It may not be able to recover it's position in the collection. Similarly, if the iterator were to fetch fileb.txt when yielding filea.txt, it could look up the position of fileb.txt, fail, and produce an error. If the iterator instead was able to somehow maintain an index dir.get_file(0), then maintaining positional state would not be affected, but some files could be missed, as their indexes could be moved to an index 'behind' the iterator. This is all theoretical of course, since there appears to be no built-in (python) way of iterating over the files in a directory. There are some great answers below, however, that solve the problem by using queues and notifications. Edit: The OS of concern is Redhat. My use case is this: Process A is continuously writing files to a storage location. Process B (the one I'm writing), will be iterating over these files, doing some processing based on the filename, and moving the files to another location. Edit: Definition of valid: Adjective 1. Well grounded or justifiable, pertinent. (Sorry S.Lott, I couldn't resist). I've edited the paragraph in question above.

  Read the article

• Device drivers and Windows

  - by b-gen-jack-o-neill

  Hi, I am trying to complete the picture of how the PC and the OS interacts together. And I am at point, where I am little out of guess when it comes to device drivers. Please, don´t write things like its too complicated, or you don´t need to know when using high programming laguage and winapi functions. I want to know, it´s for study purposes. So, the very basic structure of how OS and PC (by PC I mean of course HW) is how I see it is that all other than direct CPU commands, which can CPU do on itself (arithmetic operation, its registers access and memory access) must pass thru OS. Mainly becouse from ring level 3 you cannot use in and out intructions which are used for acesing other HW. I know that there is MMIO,but it must be set by port comunication first. It was not like this all the time. Even I am bit young to remember MSDOS, I know you could access HW directly, becouse there ws no limitation, no ring mode. So you could to write string to diplay use wheather DOS function, or directly acess video card memory and write it by yourself. But as OS developed, there is no longer this possibility. But it is fine, since OS now handles all the HW comunication, and frankly it more convinient and much more safe (I would say the only option) in multitasking environment. So nowdays you instead of using int instructions to use BIOS mapped function or DOS function you call dll which internally than handles everything you don´t need to know about. I understand this. I also undrstand that device drivers is the piece of code that runs in ring level 0, so it can do all the HW interactions. But what I don´t understand is connection between OS and device driver. Let´s take a example - I want to make a sound card make a sound. So I call windows API to acess sound card, but what happens than? Does windows call device drivers to do so? But if it does call device driver, does it mean, that all device drivers which can be called by winAPI function, must have routines named in some specific way? I mean, when I have new sound card, must its drivers have functions named same as the old one? So Windows can actually call the same function from its perspective? But if Windows have predefined sets of functions requored by device drivers, that it cannot use new drivers that doesent existed before last version of OS came out. Please, help me understand this mess. I am really getting mad. Thanks.

  Read the article

• execl doesn't work in a while(1) cicle, server side; C script

  - by Possa

  Hi guys, I have a problem with a little C script who should run as a server and launch a popup for every message arriving. The execl syntax is correct because if I try a little script with main() { execl(...); } it works. When I put it in a while(1) cicle it doesn't work. Everything else is working, like printf or string operation, but not the execl. Even if I fork it doesn't work. I really don't know what I can do ... can anyone help me? Thanks in advice for your help and sorry for my bad english. Here's the complete server C code. #include <arpa/inet.h> #include <netinet/in.h> #include <stdio.h> #include <stdlib.h> #include <sys/types.h> #include <sys/socket.h> #include <unistd.h> #include <string.h> #define BUFLEN 512 #define PORT 9930 void diep(char *s) { perror(s); exit(1); } int main() { struct sockaddr_in si_me, si_other; int s, i, slen=sizeof(si_other), broadcastPermission; char buf[100], zeni[BUFLEN]; if ((s=socket(AF_INET, SOCK_DGRAM, IPPROTO_UDP))==-1) diep("socket"); broadcastPermission = 1; if (setsockopt(s, SOL_SOCKET, SO_BROADCAST, (void *) &broadcastPermission, sizeof(broadcastPermission)) < 0) diep("setsockopt() failed"); memset((char *) &si_me, 0, sizeof(si_me)); si_me.sin_family = AF_INET; si_me.sin_port = htons(PORT); si_me.sin_addr.s_addr = htonl(INADDR_ANY); if (bind(s, &si_me, sizeof(si_me))==-1) diep("bind"); while (1) { if (recvfrom(s, buf, BUFLEN, 0, &si_other, &slen)==-1) diep("recvfrom()"); //printf("Received packet from %s:%d\nData: %s\n", inet_ntoa(si_other.sin_addr), ntohs(si_other.sin_port), buf); strcpy(zeni, ""); strcat(zeni, "zenity --warning --title Hack!! --text "); strcat(zeni, buf); printf("cmd: %s\n", zeni); //system (zeni); execl("/usr/bin/zenity", "/usr/bin/zenity", "--warning", "--title", "Warn!", "--text", buf, (char *) NULL); } close(s); return 0; }

  Read the article

• Query performs poorly unless a temp table is used

  - by Paul McLoughlin

  The following query takes about 1 minute to run, and has the following IO statistics: SELECT T.RGN, T.CD, T.FUND_CD, T.TRDT, SUM(T2.UNITS) AS TotalUnits FROM dbo.TRANS AS T JOIN dbo.TRANS AS T2 ON T2.RGN=T.RGN AND T2.CD=T.CD AND T2.FUND_CD=T.FUND_CD AND T2.TRDT<=T.TRDT JOIN TASK_REQUESTS AS T3 ON T3.CD=T.CD AND T3.RGN=T.RGN AND T3.TASK = 'UPDATE_MEM_BAL' GROUP BY T.RGN, T.CD, T.FUND_CD, T.TRDT (4447 row(s) affected) Table 'TRANSACTIONS'. Scan count 5977, logical reads 7527408, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'TASK_REQUESTS'. Scan count 1, logical reads 11, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. SQL Server Execution Times: CPU time = 58157 ms, elapsed time = 61437 ms. If I instead introduce a temporary table then the query returns quickly and performs less logical reads: CREATE TABLE #MyTable(RGN VARCHAR(20) NOT NULL, CD VARCHAR(20) NOT NULL, PRIMARY KEY([RGN],[CD])); INSERT INTO #MyTable(RGN, CD) SELECT RGN, CD FROM TASK_REQUESTS WHERE TASK='UPDATE_MEM_BAL'; SELECT T.RGN, T.CD, T.FUND_CD, T.TRDT, SUM(T2.UNITS) AS TotalUnits FROM dbo.TRANS AS T JOIN dbo.TRANS AS T2 ON T2.RGN=T.RGN AND T2.CD=T.CD AND T2.FUND_CD=T.FUND_CD AND T2.TRDT<=T.TRDT JOIN #MyTable AS T3 ON T3.CD=T.CD AND T3.RGN=T.RGN GROUP BY T.RGN, T.CD, T.FUND_CD, T.TRDT (4447 row(s) affected) Table 'Worktable'. Scan count 5974, logical reads 382339, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'TRANSACTIONS'. Scan count 4, logical reads 4547, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#MyTable________________________________________________________________000000000013'. Scan count 1, logical reads 2, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. SQL Server Execution Times: CPU time = 1420 ms, elapsed time = 1515 ms. The interesting thing for me is that the TASK_REQUEST table is a small table (3 rows at present) and statistics are up to date on the table. Any idea why such different execution plans and execution times would be occuring? And ideally how to change things so that I don't need to use the temp table to get decent performance? The only real difference in the execution plans is that the temp table version introduces an index spool (eager spool) operation.

  Read the article

• Spanning columns in HTML table.

  - by Tony

  I'm trying do to a very simple operation of merging two columns in a table. This seems easy with the colspan, but if I merge different columns without leaving at least one row without any merged columns, the sizing gets completely messed up. Please see the following example at http://www.allthingsdope.com/table.html or take a look at and try the following code: Good: <table width="700px"> <tr> <th width="100px">1: 100px</th> <td width="300px">2: 300px</td> <td width="200px">3: 200px</td> <td width="100px">4: 100px</td> </tr> <tr> <th width="100px">1: 100px</th> <td colspan=2 width="500px" >2 & 3: 500px</td> <td width="100px">4: 100px</td> </tr> <tr> <th width="100px">1: 100px</th> <td width="300px">2: 300px</td> <td colspan=2 width="300px">3 & 4: 300px</td> </tr> </table> Bad: <table width="700px"> <tr> <th width="100px">1: 100px</th> <td colspan=2 width="500px" >2 & 3: 500px</td> <td width="100px">4: 100px</td> </tr> <tr> <th width="100px">1: 100px</th> <td width="300px">2: 300px</td> <td colspan=2 width="300px">3 & 4: 300px</td> </tr> </table> This seems so simple but I can not figure it out!

  Read the article

• Exception from Response.Redirect?

  - by allencoded

  I keep getting an error: A first chance exception of type 'System.Threading.ThreadAbortException' occurred in mscorlib.dll An exception of type 'System.Threading.ThreadAbortException' occurred in mscorlib.dll but was not handled in user code The thread '' (0x27ee4) has exited with code 0 (0x0). I was told it was related to this: protected void Button1_Click(object sender, EventArgs e) { Response.Redirect("Results.aspx?Keywords=" + searchString.Text); } I figured it may help to include my complete code. The code above is the only C# code on my first asp page. That code relates to this code on this page. It is also the only C# code I have on my second page. I am simply just trying to pass a keyword from a search form to this block of code: if (Request.QueryString["Keywords"] != null){ string keywords = Request.QueryString["Keywords"]; string myAppID = "HIDDEN"; var xml = XDocument.Load("http://svcs.ebay.com/services/search/FindingService/v1?OPERATION-NAME=findItemsByKeywords&SERVICE-VERSION=1.0.0&SECURITY-APPNAME=" + myAppID + "&RESPONSE-DATA-FORMAT=XML&REST-PAYLOAD&keywords=" + keywords + "&paginationInput.entriesPerPage=5"); XNamespace ns = "http://www.ebay.com/marketplace/search/v1/services"; var titles = from item in xml.Root.Descendants(ns + "title") select new{ title = xml.Descendants(ns + "title").Select (x => x.Value), }; foreach (var item in titles){ Label1.Text += item; } } This block of code calls the keyword value and uses it in an api to perform a search. The code of the xml(api) formats like this: <findItemsByKeywordsResponse xmlns="http://www.ebay.com/marketplace/search/v1/services"> <searchReslut count="5"> <item> <title></title> </item> <item> <title></title> </item> <item> <title></title> </item> Why am I getting this error how do you fix it?

  Read the article

• Convert Object Hierachey to Object Array

  - by Killercam

  All, I want to create an object array foo[], where the constructor for Foo is public Foo(string name, string discription){} I have a database object which has a structure (not incuding stored procedures, functions or views for simplicity) like public class Database { public string name { get; set; } public string filename { get; set; } public List<Table> tables { get; set; } public Database(string name, string filename) { this.name = name; this.filename = filename; } } protected internal class Table { public string name { get; set; } public List<Column> columns { get; set;} public Table(string name, List<Column> columns) { this.name = name; this.columns = columns; } } protected internal class Column { public string name { get; set; } public string type { get; set; } public Column(string name, string type, int maxLength, bool isNullable) { this.name = name; this.type = type; } } I would like to know the quickest way to add Column and Table information to the Foo[] object array? Clearly I can do List<Foo> fooList = new List<Foo>(); foreach (Table t in database.tables) { fooList.Add(new Foo(t.Name, "Some Description")); foreach (Column c in t.columns) fooList.Add(new Foo(c.Name, "Some Description")); } Foo[] fooArr = fooList.ToArray<Foo>(); But is there a quicker way? Clearly LINQ is likely to be slower for a query that does a simalar operation, but I care allot about speed here so any advice would be appreciated. Perhaps the use of a HashSet would be the way to go as there will not be duplicate entries... Thanks for your time.

  Read the article

• Intersection() and Except() is too slow with large collections of custom objects

  - by Theo

  I am importing data from another database. My process is importing data from a remote DB into a List<DataModel> named remoteData and also importing data from the local DB into a List<DataModel> named localData. I am then using LINQ to create a list of records that are different so that I can update the local DB to match the data pulled from remote DB. Like this: var outdatedData = this.localData.Intersect(this.remoteData, new OutdatedDataComparer()).ToList(); I am then using LINQ to create a list of records that no longer exist in remoteData, but do exist in localData, so that I delete them from local database. Like this: var oldData = this.localData.Except(this.remoteData, new MatchingDataComparer()).ToList(); I am then using LINQ to do the opposite of the above to add the new data to the local database. Like this: var newData = this.remoteData.Except(this.localData, new MatchingDataComparer()).ToList(); Each collection imports about 70k records, and each of the 3 LINQ operation take between 5 - 10 minutes to complete. How can I make this faster? Here is the object the collections are using: internal class DataModel { public string Key1{ get; set; } public string Key2{ get; set; } public string Value1{ get; set; } public string Value2{ get; set; } public byte? Value3{ get; set; } } The comparer used to check for outdated records: class OutdatedDataComparer : IEqualityComparer<DataModel> { public bool Equals(DataModel x, DataModel y) { var e = string.Equals(x.Key1, y.Key1) && string.Equals(x.Key2, y.Key2) && ( !string.Equals(x.Value1, y.Value1) || !string.Equals(x.Value2, y.Value2) || x.Value3 != y.Value3 ); return e; } public int GetHashCode(DataModel obj) { return 0; } } The comparer used to find old and new records: internal class MatchingDataComparer : IEqualityComparer<DataModel> { public bool Equals(DataModel x, DataModel y) { return string.Equals(x.Key1, y.Key1) && string.Equals(x.Key2, y.Key2); } public int GetHashCode(DataModel obj) { return 0; } }

  Read the article

< Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >