Search Results

Search found 10707 results on 429 pages for 'scroll position'.

Page 193/429 | < Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >

  • JQuery fadeIn() moving other CSS elements on fadeIn()

    - by Infiniti Fizz
    Hi, I've just been learning some jQUery to get a basic image gallery going on a website I'm creating for a hotel but it's currently not going to plan. I've got it so the arrows will cycle through images (no animation yet) but I decided that the arrows should fade in when the image is hovered over and fade out when not but this is messing up the CSS somehow. The arrows start faded out by calling: $('.arrowRight').fadeOut(0);$('.arrowLeft').fadeOut(0); at the start of the jQuery ready() function. This is fine, but when you hover over the image and the arrows fade in, the image shifts to the right and I don't know why. I suppose it could be because the left arrow now fading in means it is getting pushed over by it but the arrow has the following css: position:relative; top: -90px; left: 25px; Should a relative element be able to alter a normal element's position? If you need to try it out, just hover over the large (placeholder) image and they image will jump across when the arrows fade in and jump back when they fade out. Any ideas why this is happening? I'm a jQuery noob. Here is a link to the page: BeanSheaf Hotel Temporary Space Thanks for your time, InfinitiFizz

    Read the article

  • Android ViewPager Displaying TextView in Layout

    - by Ammonious
    I'm having a problem getting my viewpager to work correctly. Currently the bottom part of my layout will page across but the remaining part will not Here's my code that I have in my PageAdapter public class MyPageAdapter extends PagerAdapter { public int getCount() { return 31; } public Object instantiateItem(View collection, int position) { LayoutInflater inflater = (LayoutInflater) collection.getContext() .getSystemService(Context.LAYOUT_INFLATER_SERVICE); int resId = 0; switch (position) { case 0: resId = R.layout.main_menu; break; case 1: resId = R.layout.article1; break; case 2: resId = R.layout.article2; break; .... .... View view = inflater.inflate(resId, null); ((ViewPager) collection).addView(view, 0); return view; This is what I have for my XML <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="match_parent" android:layout_height="match_parent" android:orientation="vertical" android:background="@drawable/background" android:clickable="true" android:id="@+id/layout13" android:weightSum="0"> <TextView android:id="@+id/textView01" android:layout_width="match_parent" android:layout_height="wrap_content" android:gravity="center_vertical|center_horizontal" android:padding="12dp" android:text="@string/article13" android:textAppearance="?android:attr/textAppearanceLarge" android:textColor="#000000" /> <TextView android:id="@+id/textView02" android:layout_width="match_parent" android:layout_height="302dp" android:gravity="center_vertical|center_horizontal" android:text="@string/body13" android:textAppearance="?android:attr/textAppearanceLarge" android:textColor="#000000" /> <android.support.v4.view.ViewPager android:layout_width="match_parent" android:layout_height="wrap_content" android:id="@id/viewPager" > </android.support.v4.view.ViewPager> </LinearLayout> I've tried Moving the around in my XML layout to right underneath my LinearLayout and i get the full screen but all my text disappears. It's probably something simple i'm missing but any help on this would be greatly appreciated!

    Read the article

  • In WPF 3D, why can't a perspective camera's LookDirection be straight down?

    - by DanM
    I'm attempting to position my perspective camera 30 units above the origin and pointing straight down. If I set the LookDirection of the camera to "0,0,-1", however, everything disappears. I have to make it "0.01,0.01,-1" for it to work. Why? <Window x:Class="ThreeDeeTester.Window1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="Window1" Height="300" Width="300"> <Grid> <Viewport3D> <Viewport3D.Camera> <PerspectiveCamera Position="0,0,30" LookDirection="0.01,0.01,-1" UpDirection="0,0,1" /> <!-- LookDirection="0,0,-1" doesn't work...why? --> </Viewport3D.Camera> <ModelVisual3D> <ModelVisual3D.Content> <Model3DGroup> <DirectionalLight Color="White" Direction="1,-1,-1" /> <GeometryModel3D> <GeometryModel3D.Geometry> <MeshGeometry3D Positions="0,0,10 -5,-5,0 -5,5,0 5,5,0 5,-5,0" TriangleIndices="2 1 0 2 0 3 4 3 0 1 4 0" /> </GeometryModel3D.Geometry> <GeometryModel3D.Material> <DiffuseMaterial Brush="Red" /> </GeometryModel3D.Material> </GeometryModel3D> </Model3DGroup> </ModelVisual3D.Content> </ModelVisual3D> </Viewport3D> </Grid> </Window>

    Read the article

  • Why does this code send the form input to the URL?

    - by marcamillion
    How do I get this form input to be stored in a variable, that I can then use later - rather than being appended to the end of the URL? <script type="text/javascript"> $(function() { var tag_box = $("<div>").appendTo("body").css({ "width": "40px", "height":"40px", "border":"4px solid #000000", "position":"absolute", "display":"none", "padding":"15px" }); var comment_box = $("<form action='#'><input id='comment' type='text' name='comment' placeholder='Add comment'></form>").appendTo(tag_box).css({"position":"absolute"}); $("#image-wrapper").live("click", function(e) { tag_box.css({ "left": e.pageX - 40, "top": e.pageY - 40, "display": "block" }) .after(comment_box.css({ "left": e.pageX - 65, "top": e.pageY + 40 })); return false; }); }); </script> <body> <div align="center"> <img src="images/ror1.gif" width="760" height="182" alt="Ror1" id="image-wrapper"> </div> </body>

    Read the article

  • Latex: Listings with monospace fonts

    - by Nils
    This is what the code looks in Xcode. And this in my listing created with texlive. And yes I used basicstyle=\ttfamily . Having looked at the manual of listings I haven't found anything about fixed-with or monospace fonts.. Example to reproduce \documentclass[ article, a4paper, a4wide, %draft, smallheadings ]{book} % Packages below \usepackage{graphicx} \usepackage{verbatim} % used to display code \usepackage{hyperref} \usepackage{fullpage} \usepackage[ansinew]{inputenc} % german umlauts \usepackage[usenames,dvipsnames]{color} \usepackage{float} \usepackage{subfig} \usepackage{tikz} \usetikzlibrary{calc,through,backgrounds} \usepackage{fancyvrb} \usepackage{acronym} \usepackage{amsthm} % Uuhhh yet another package \VerbatimFootnotes % Required, otherwise verbatim does not work in footnotes! \usepackage{listings} \definecolor{Brown}{cmyk}{0,0.81,1,0.60} \definecolor{OliveGreen}{cmyk}{0.64,0,0.95,0.40} \definecolor{CadetBlue}{cmyk}{0.62,0.57,0.23,0} \definecolor{lightlightgray}{gray}{0.9} \begin{document} \lstset{ language=C, % Code langugage basicstyle=\ttfamily, % Code font, Examples: \footnotesize, \ttfamily keywordstyle=\color{OliveGreen}, % Keywords font ('*' = uppercase) commentstyle=\color{gray}, % Comments font numbers=left, % Line nums position numberstyle=\tiny, % Line-numbers fonts stepnumber=1, % Step between two line-numbers numbersep=5pt, % How far are line-numbers from code backgroundcolor=\color{lightlightgray}, % Choose background color frame=none, % A frame around the code tabsize=2, % Default tab size captionpos=b, % Caption-position = bottom breaklines=true, % Automatic line breaking? breakatwhitespace=false, % Automatic breaks only at whitespace? showspaces=false, % Dont make spaces visible showtabs=false, % Dont make tabls visible columns=flexible, % Column format morekeywords={__global__, __device__}, % CUDA specific keywords } \begin{lstlisting} As[threadRow][threadCol] = A[ threadCol + threadRow * Awidth // Adress of the thread in the current block + i * BLOCK_SIZE // Pick a block further left for i+1 + blockRow * BLOCK_SIZE * Awidth // for blockRow +1 go one blockRow down ]; \end{lstlisting} \end{document}

    Read the article

  • div insert in div

    - by lolalola
    Hi, what's wrong with this code? Now disappear background and div after this code show incorrect. But why when i delete "float: left", everything looks good. <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html> <head> <style type="text/css"> #first{ width: 200px; background-color: #345752; } #left_b{ background:transparent url('img/left.png'); background-position: left top; background-repeat: repeat-y; min-height: 30px; } #right_b{ background:transparent url('img/right.png'); background-position: right top; background-repeat: repeat-y; } #text{ float: left; width: 50px; height: 30px; } #text2{ float: left; width: 70px; height: 30px; } </style> </head> <body> <div id = "first"> <div id = "left_b"> <div id = "right_b"> <div id = "text"> text 1 </div> <div id = "text2"> text 2 </div> </div> </div> </div> </body> </html>

    Read the article

  • how to export bind and keyframe bone poses from blender to use in OpenGL

    - by SaldaVonSchwartz
    EDIT: I decided to reformulate the question in much simpler terms to see if someone can give me a hand with this. Basically, I'm exporting meshes, skeletons and actions from blender into an engine of sorts that I'm working on. But I'm getting the animations wrong. I can tell the basic motion paths are being followed but there's always an axis of translation or rotation which is wrong. I think the problem is most likely not in my engine code (OpenGL-based) but rather in either my misunderstanding of some part of the theory behind skeletal animation / skinning or the way I am exporting the appropriate joint matrices from blender in my exporter script. I'll explain the theory, the engine animation system and my blender export script, hoping someone might catch the error in either or all of these. The theory: (I'm using column-major ordering since that's what I use in the engine cause it's OpenGL-based) Assume I have a mesh made up of a single vertex v, along with a transformation matrix M which takes the vertex v from the mesh's local space to world space. That is, if I was to render the mesh without a skeleton, the final position would be gl_Position = ProjectionMatrix * M * v. Now assume I have a skeleton with a single joint j in bind / rest pose. j is actually another matrix. A transform from j's local space to its parent space which I'll denote Bj. if j was part of a joint hierarchy in the skeleton, Bj would take from j space to j-1 space (that is to its parent space). However, in this example j is the only joint, so Bj takes from j space to world space, like M does for v. Now further assume I have a a set of frames, each with a second transform Cj, which works the same as Bj only that for a different, arbitrary spatial configuration of join j. Cj still takes vertices from j space to world space but j is rotated and/or translated and/or scaled. Given the above, in order to skin vertex v at keyframe n. I need to: take v from world space to joint j space modify j (while v stays fixed in j space and is thus taken along in the transformation) take v back from the modified j space to world space So the mathematical implementation of the above would be: v' = Cj * Bj^-1 * v. Actually, I have one doubt here.. I said the mesh to which v belongs has a transform M which takes from model space to world space. And I've also read in a couple textbooks that it needs to be transformed from model space to joint space. But I also said in 1 that v needs to be transformed from world to joint space. So basically I'm not sure if I need to do v' = Cj * Bj^-1 * v or v' = Cj * Bj^-1 * M * v. Right now my implementation multiples v' by M and not v. But I've tried changing this and it just screws things up in a different way cause there's something else wrong. Finally, If we wanted to skin a vertex to a joint j1 which in turn is a child of a joint j0, Bj1 would be Bj0 * Bj1 and Cj1 would be Cj0 * Cj1. But Since skinning is defined as v' = Cj * Bj^-1 * v , Bj1^-1 would be the reverse concatenation of the inverses making up the original product. That is, v' = Cj0 * Cj1 * Bj1^-1 * Bj0^-1 * v Now on to the implementation (Blender side): Assume the following mesh made up of 1 cube, whose vertices are bound to a single joint in a single-joint skeleton: Assume also there's a 60-frame, 3-keyframe animation at 60 fps. The animation essentially is: keyframe 0: the joint is in bind / rest pose (the way you see it in the image). keyframe 30: the joint translates up (+z in blender) some amount and at the same time rotates pi/4 rad clockwise. keyframe 59: the joint goes back to the same configuration it was in keyframe 0. My first source of confusion on the blender side is its coordinate system (as opposed to OpenGL's default) and the different matrices accessible through the python api. Right now, this is what my export script does about translating blender's coordinate system to OpenGL's standard system: # World transform: Blender -> OpenGL worldTransform = Matrix().Identity(4) worldTransform *= Matrix.Scale(-1, 4, (0,0,1)) worldTransform *= Matrix.Rotation(radians(90), 4, "X") # Mesh (local) transform matrix file.write('Mesh Transform:\n') localTransform = mesh.matrix_local.copy() localTransform = worldTransform * localTransform for col in localTransform.col: file.write('{:9f} {:9f} {:9f} {:9f}\n'.format(col[0], col[1], col[2], col[3])) file.write('\n') So if you will, my "world" matrix is basically the act of changing blenders coordinate system to the default GL one with +y up, +x right and -z into the viewing volume. Then I also premultiply (in the sense that it's done by the time we reach the engine, not in the sense of post or pre in terms of matrix multiplication order) the mesh matrix M so that I don't need to multiply it again once per draw call in the engine. About the possible matrices to extract from Blender joints (bones in Blender parlance), I'm doing the following: For joint bind poses: def DFSJointTraversal(file, skeleton, jointList): for joint in jointList: bindPoseJoint = skeleton.data.bones[joint.name] bindPoseTransform = bindPoseJoint.matrix_local.inverted() file.write('Joint ' + joint.name + ' Transform {\n') translationV = bindPoseTransform.to_translation() rotationQ = bindPoseTransform.to_3x3().to_quaternion() scaleV = bindPoseTransform.to_scale() file.write('T {:9f} {:9f} {:9f}\n'.format(translationV[0], translationV[1], translationV[2])) file.write('Q {:9f} {:9f} {:9f} {:9f}\n'.format(rotationQ[1], rotationQ[2], rotationQ[3], rotationQ[0])) file.write('S {:9f} {:9f} {:9f}\n'.format(scaleV[0], scaleV[1], scaleV[2])) DFSJointTraversal(file, skeleton, joint.children) file.write('}\n') Note that I'm actually grabbing the inverse of what I think is the bind pose transform Bj. This is so I don't need to invert it in the engine. Also note I went for matrix_local, assuming this is Bj. The other option is plain "matrix", which as far as I can tell is the same only that not homogeneous. For joint current / keyframe poses: for kfIndex in keyframes: bpy.context.scene.frame_set(kfIndex) file.write('keyframe: {:d}\n'.format(int(kfIndex))) for i in range(0, len(skeleton.data.bones)): file.write('joint: {:d}\n'.format(i)) currentPoseJoint = skeleton.pose.bones[i] currentPoseTransform = currentPoseJoint.matrix translationV = currentPoseTransform.to_translation() rotationQ = currentPoseTransform.to_3x3().to_quaternion() scaleV = currentPoseTransform.to_scale() file.write('T {:9f} {:9f} {:9f}\n'.format(translationV[0], translationV[1], translationV[2])) file.write('Q {:9f} {:9f} {:9f} {:9f}\n'.format(rotationQ[1], rotationQ[2], rotationQ[3], rotationQ[0])) file.write('S {:9f} {:9f} {:9f}\n'.format(scaleV[0], scaleV[1], scaleV[2])) file.write('\n') Note that here I go for skeleton.pose.bones instead of data.bones and that I have a choice of 3 matrices: matrix, matrix_basis and matrix_channel. From the descriptions in the python API docs I'm not super clear which one I should choose, though I think it's the plain matrix. Also note I do not invert the matrix in this case. The implementation (Engine / OpenGL side): My animation subsystem does the following on each update (I'm omitting parts of the update loop where it's figured out which objects need update and time is hardcoded here for simplicity): static double time = 0; time = fmod((time + elapsedTime),1.); uint16_t LERPKeyframeNumber = 60 * time; uint16_t lkeyframeNumber = 0; uint16_t lkeyframeIndex = 0; uint16_t rkeyframeNumber = 0; uint16_t rkeyframeIndex = 0; for (int i = 0; i < aClip.keyframesCount; i++) { uint16_t keyframeNumber = aClip.keyframes[i].number; if (keyframeNumber <= LERPKeyframeNumber) { lkeyframeIndex = i; lkeyframeNumber = keyframeNumber; } else { rkeyframeIndex = i; rkeyframeNumber = keyframeNumber; break; } } double lTime = lkeyframeNumber / 60.; double rTime = rkeyframeNumber / 60.; double blendFactor = (time - lTime) / (rTime - lTime); GLKMatrix4 bindPosePalette[aSkeleton.jointsCount]; GLKMatrix4 currentPosePalette[aSkeleton.jointsCount]; for (int i = 0; i < aSkeleton.jointsCount; i++) { F3DETQSType& lPose = aClip.keyframes[lkeyframeIndex].skeletonPose.joints[i]; F3DETQSType& rPose = aClip.keyframes[rkeyframeIndex].skeletonPose.joints[i]; GLKVector3 LERPTranslation = GLKVector3Lerp(lPose.t, rPose.t, blendFactor); GLKQuaternion SLERPRotation = GLKQuaternionSlerp(lPose.q, rPose.q, blendFactor); GLKVector3 LERPScaling = GLKVector3Lerp(lPose.s, rPose.s, blendFactor); GLKMatrix4 currentTransform = GLKMatrix4MakeWithQuaternion(SLERPRotation); currentTransform = GLKMatrix4TranslateWithVector3(currentTransform, LERPTranslation); currentTransform = GLKMatrix4ScaleWithVector3(currentTransform, LERPScaling); GLKMatrix4 inverseBindTransform = GLKMatrix4MakeWithQuaternion(aSkeleton.joints[i].inverseBindTransform.q); inverseBindTransform = GLKMatrix4TranslateWithVector3(inverseBindTransform, aSkeleton.joints[i].inverseBindTransform.t); inverseBindTransform = GLKMatrix4ScaleWithVector3(inverseBindTransform, aSkeleton.joints[i].inverseBindTransform.s); if (aSkeleton.joints[i].parentIndex == -1) { bindPosePalette[i] = inverseBindTransform; currentPosePalette[i] = currentTransform; } else { bindPosePalette[i] = GLKMatrix4Multiply(inverseBindTransform, bindPosePalette[aSkeleton.joints[i].parentIndex]); currentPosePalette[i] = GLKMatrix4Multiply(currentPosePalette[aSkeleton.joints[i].parentIndex], currentTransform); } aSkeleton.skinningPalette[i] = GLKMatrix4Multiply(currentPosePalette[i], bindPosePalette[i]); } Finally, this is my vertex shader: #version 100 uniform mat4 modelMatrix; uniform mat3 normalMatrix; uniform mat4 projectionMatrix; uniform mat4 skinningPalette[6]; uniform lowp float skinningEnabled; attribute vec4 position; attribute vec3 normal; attribute vec2 tCoordinates; attribute vec4 jointsWeights; attribute vec4 jointsIndices; varying highp vec2 tCoordinatesVarying; varying highp float lIntensity; void main() { tCoordinatesVarying = tCoordinates; vec4 skinnedVertexPosition = vec4(0.); for (int i = 0; i < 4; i++) { skinnedVertexPosition += jointsWeights[i] * skinningPalette[int(jointsIndices[i])] * position; } vec4 skinnedNormal = vec4(0.); for (int i = 0; i < 4; i++) { skinnedNormal += jointsWeights[i] * skinningPalette[int(jointsIndices[i])] * vec4(normal, 0.); } vec4 finalPosition = mix(position, skinnedVertexPosition, skinningEnabled); vec4 finalNormal = mix(vec4(normal, 0.), skinnedNormal, skinningEnabled); vec3 eyeNormal = normalize(normalMatrix * finalNormal.xyz); vec3 lightPosition = vec3(0., 0., 2.); lIntensity = max(0.0, dot(eyeNormal, normalize(lightPosition))); gl_Position = projectionMatrix * modelMatrix * finalPosition; } The result is that the animation displays wrong in terms of orientation. That is, instead of bobbing up and down it bobs in and out (along what I think is the Z axis according to my transform in the export clip). And the rotation angle is counterclockwise instead of clockwise. If I try with a more than one joint, then it's almost as if the second joint rotates in it's own different coordinate space and does not follow 100% its parent's transform. Which I assume it should from my animation subsystem which I assume in turn follows the theory I explained for the case of more than one joint. Any thoughts?

    Read the article

  • Actionscript: NetStream stutters after buffering.

    - by meandmycode
    Using NetStream to stream content from http, I've noticed that esp with certain exported h264's, if the player encounters an empty buffer, it will stop and buffer to the requested length (as expected). However once the buffer is full, the playback doesn't resume, but instead jumps ahead, as such- instantly playing the buffered duration in a brief moment, and thusly triggering an empty buffer again.. this will then continue over and over. Presumably when the netstream pauses to buffer, the playhead position continues, and the player is attempting to snap to that position on resume- however given it could take 5 seconds to build a 2 second buffer- it ends up with a useless buffer again.. (this is an assumption) I've attempted to work around this by listening for an empty buffer netstatus event, pausing the stream, and at the same time setting up a loop to check the current buffer length vs the requested buffer length.. and resuming once the buffer length is greater than or equal to the requested buffer.. however this causes problems when there isn't enough of the video remaining.. for example, a 10 second buffer with only 5 seconds remaining, the loop just sits there waiting for a buffer length of 10 seconds when theres only 5 left... You would think that you could simply check which was smaller, the time left or the requested buffer length.. however the times flash gives are not accurate.. If you add the net streams current time index, plus the buffered time, the total is not the entire duration of the movie (when at the end).. it is close but not the same. This brings me back to the original problem, and if there is another way to fix this, clearly flash knows when the buffer is ready, so how can i get flash pause when it buffers, and resume once the buffer is ready? currently it doesn't.. it pauses and then once the buffer is full- it plays the entire buffered content in about .1 of a second. Thanks in advance, Stephen.

    Read the article

  • Input boxes with transparent background are not clickable in IE8

    - by Viliam
    I have an absolutely positioned input box in a form. The input box has transparent background: .form-page input[type="text"] { border: none; background-color: transparent; /* Other stuff: font-weight, font-size */ } Surprisingly, I cannot select this input box by clicking on it in IE8. It works perfectly in Firefox however. The same happens for background: none. When I change the background color: background-color: red; It works fine, so this is issue associated with transparent background. Setting a border makes the input box selectable by clicking on its border only. Is there a workaround to have clickable input box with transparent background working in IE8? Update: Example. Uncomment background-color and the inputbox is selectable. You can also click on the select box, and focus the input box by pressing Shift+Tab. <!DOCTYPE HTML PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html><head></head><body> <style type="text/css"> input[type="text"] { border: none; background: transparent; /*background-color: blue;*/ } #elem528 { position:absolute; left:155px; top:164px; width:60px; height:20px; } #elem529 { position:absolute; left:218px; top:164px; width:40px; height:20px; } </style> <img src="xxx.png" alt="" width="1000" height="1000"> <input id="elem528" maxlength="7" type="text"> <select id="elem529"></select> </body></html>

    Read the article

  • Problem with javascript onclick function string

    - by StealthRT
    Hey all, i have been trying for a few minutes on this problem and i can not seem to figure out how to correct it. I tend to have the hardest time doing stuff like this when it involves more than one varable within the function. Here is the code: var tempString = "thePrompt('Are you sure you wish to delete this?', 'theDel('" + IDnum + "', '" + theTitle + "', \'" + temperDay + "\', \'" + temperMonth + "\', \'" + temperYear + "\', \'" + DDiff + "\')"; html += "<div id='theTable" + IDnum + "' class='fc-event fc-event-hori fc-corner-left fc-corner-right' style='position:absolute; margin-top: 15px; z-index:8;left:"+left+"px'><div id='apDEL' style='position:relative;width:0px;height:0px;z-index:1000; top:-13px; left:2px; float:left;'><img src='img/xCal.png' width='15' height='15' alt='' border='0' onclick=\"" + tempString + "\" /></div>" + (ETC ETC...) The error i keep getting is this: Error: missing ) after argument list Line: 1, Column: 68 Source Code: thePrompt('Are you sure you wish to delete this posting?', 'theDel('105', '50 points for visiting us today!!!!', '13', '3', '2010', '2') And its pointing to the '105'. As always, any help would be wonderful! :o) David

    Read the article

  • XML Serialize and Deserialize Problem XML Structure

    - by Ph.E
    Camarades, I'm having the following problem. Caught a list Struct, Serialize (Valid W3C) and send to a WebService. In the WebService I receive, transform to a string, valid by the W3C and then Deserializer, but when I try to run it, always occurs error, saying that some objects were not closed. Any help? Sent Code: #region ListToXML private XmlDocument ListToXMLDocument(object __Lista) { XmlDocument _ListToXMLDocument = new XmlDocument(); try { XmlDocument _XMLDoc = new XmlDocument(); MemoryStream _StreamMem = new MemoryStream(); XmlSerializer _XMLSerial = new XmlSerializer(__Lista.GetType()); StreamWriter _StreamWriter = new StreamWriter(_StreamMem, Encoding.UTF8); _XMLSerial.Serialize(_StreamWriter, __Lista); _StreamMem.Position = 0; _XMLDoc.Load(_StreamMem); if (_XMLDoc.ChildNodes.Count > 0) _ListToXMLDocument = _XMLDoc; } catch (Exception __Excp) { new uException(__Excp).GerarLogErro(CtNomeBiblioteca); } return _ListToXMLDocument; } #endregion Receive Code: #region XMLDocumentToTypedList private List<T> XMLDocumentToTypedList<T>(string __XMLDocument) { List<T> _XMLDocumentToTypedList = new List<T>(); try { XmlSerializer _XMLSerial = new XmlSerializer(typeof(List<T>)); MemoryStream _MemStream = new MemoryStream(); StreamWriter _StreamWriter = new StreamWriter(_MemStream, Encoding.UTF8); _StreamWriter.Write(__XMLDocument); _MemStream.Position = 0; _XMLDocumentToTypedList = (List<T>)_XMLSerial.Deserialize(_MemStream); return _XMLDocumentToTypedList; } catch (Exception _Ex) { new uException(_Ex).GerarLogErro(CtNomeBiblioteca); throw _Ex; } } #endregion

    Read the article

  • Pros and cons of making database IDs consistent and "readable"

    - by gmale
    Question Is it a good rule of thumb for database IDs to be "meaningless?" Conversely, are there significant benefits from having IDs structured in a way where they can be recognized at a glance? What are the pros and cons? Background I just had a debate with my coworkers about the consistency of the IDs in our database. We have a data-driven application that leverages spring so that we rarely ever have to change code. That means, if there's a problem, a data change is usually the solution. My argument was that by making IDs consistent and readable, we save ourselves significant time and headaches, long term. Once the IDs are set, they don't have to change often and if done right, future changes won't be difficult. My coworkers position was that IDs should never matter. Encoding information into the ID violates DB design policies and keeping them orderly requires extra work that, "we don't have time for." I can't find anything online to support either position. So I'm turning to all the gurus here at SA! Example Imagine this simplified list of database records representing food in a grocery store, the first set represents data that has meaning encoded in the IDs, while the second does not: ID's with meaning: Type 1 Fruit 2 Veggie Product 101 Apple 102 Banana 103 Orange 201 Lettuce 202 Onion 203 Carrot Location 41 Aisle four top shelf 42 Aisle four bottom shelf 51 Aisle five top shelf 52 Aisle five bottom shelf ProductLocation 10141 Apple on aisle four top shelf 10241 Banana on aisle four top shelf //just by reading the ids, it's easy to recongnize that these are both Fruit on Aisle 4 ID's without meaning: Type 1 Fruit 2 Veggie Product 1 Apple 2 Banana 3 Orange 4 Lettuce 5 Onion 6 Carrot Location 1 Aisle four top shelf 2 Aisle four bottom shelf 3 Aisle five top shelf 4 Aisle five bottom shelf ProductLocation 1 Apple on aisle four top shelf 2 Banana on aisle four top shelf //given the IDs, it's harder to see that these are both fruit on aisle 4 Summary What are the pros and cons of keeping IDs readable and consistent? Which approach do you generally prefer and why? Is there an accepted industry best-practice?

    Read the article

  • JQUERY: Setting Active state on animated menu tabs

    - by Tony
    I have image sprites that use JQuery to set the BG position on mouseover and mouseout events. When I set the active state BG position using JQUERY it works fine until I move my cursor away from the active 'tab' which then fires the mouseout event animation. What I want is the mouseClick event to stop the animation on the active tab but still allow the animation effect to work on the other tabs, and when another tab is clicked for the active state to be removed from the current tab to the new 'active' tab. JQuery $(function(){ /* This script changes main nav links hover state*/ $('.navigation a') .css( {backgroundPosition: "-1px -120px"} ) .mouseover(function(){ $(this).stop().animate({backgroundPosition:"(-1px -240px)"}, {duration:400}) }) .mouseout(function(){ $(this).stop().animate({backgroundPosition:"(-1px -120px)"}, {duration:400, complete:function (){ $(this).css({backgroundPosition: "-1px -120px"}) }}) }) }); $(document).ready(function(){ $("a").click(function(){ $(this).css({backgroundPosition: "-1px -235px"}); }); }); HTML <ul class="navigation"> <li><a href="#index" tabindex="10" title="Home" id="homeButton"></a></li> <li><a href="#about" tabindex="20" title="About us" id="aboutButton"></a></li> <li><a href="#facilities" tabindex="30" title="Our facilities and opening Times" id="facilitiesButton"></a></li> <li><a href="#advice" tabindex="40" title="Advice and useful links" c id="adviceButton"></a></li> <li><a href="#find" tabindex="50" title="How to find Us" id="findButton"></a></li> <li><a href="#contact" tabindex="60" title="Get in touch with us" id="contactButton"></a></li> </ul> You can see what I've got so far here Thanks in advance for any help

    Read the article

  • A problem of trying to implement scrolling inertia with jQuery

    - by gargantaun
    I'm trying to add some iPhone style scrolling inertia to a web page that will only be viewed on the iPad. I have the scrolling working in one direction (scrollLeft), but it doesn't work in the other direction. It's a pretty simple function function onTouchEnd(event){ event.preventDefault(); inertia = (oldMoveX - touchMoveX); // Inertia Stuff if( Math.abs(inertia) > 10 ){ $("#feedback").html(inertia); $("#container").animate({ 'scrollLeft': $("#container").scrollLeft() + (inertia * 10) }, inertia * 20); }else{ $("#feedback").html("No Inertia"); } } I've bound it to the 'touchend' event on the body. The intertia is the difference betweent he old moveX position and the latest moveX position when a touch ends. I then try to animate the scrollLeft property of a div that contains a bunch of thumbnails. As I've said, this works when scrolling to the left, but not when scrolling to the right. You can view the full source code (all in one page) or test it on your iPhone or iPad (or in the simulator) here http://www.appliedworks.co.uk/files/times/swipegal.html Any ideas?

    Read the article

  • How to write a decent process filter?

    - by konr
    Hi there, I'm building a program that communicates with Emacs, and one of the challenges I'm facing is writing Emacs's process filter function. Its input string is a series of s-expressions to be evaluated. Here is a sample: (gimme-append-to-buffer "25 - William Christie dir, Les Arts Florissants - Scene 2. Prelude - Les Arts Florissants\n") (gimme-append-to-buffer "26 - William Christie dir, Les Arts Florissants - Cybele: 'Je Veux Joindre' - Les Arts Florissants\n") (gimme-append-to-buffer "27 - William Christie dir, Les Arts Florissants - Scene 3. Cybele: 'Tu T'Etonnes, Melisse' - Les Arts Florissants\n") (gimme-append-to-buffer "28 - William Christie dir, Les Arts Florissants - Cybele: 'Que Les Plus Doux Zephyrs'. Scene 4. - Les Arts Florissants\n") (gimme-append-to-buffer "29 - William Christie dir, Les Arts Florissants - Entree Des Nations - Les Arts Florissants\n") (gimme-append-to-buffer "30 - William Christie dir, Les Arts Florissants - Entree Des Zephyrs - Les Arts Florissants\n") (gimme-append-to-buffer "31 - William Christie dir, Les Arts Florissants - Choeur Des Nations' 'Que Devant Vous' - Les Arts Florissants\n") (gimme-append-to-buffer "32 - William Christie dir, Les Arts Florissants - Atys: 'Indigne Que Je Suis' - Les Arts Florissants\n") (gimme-append-to-buffer "33 - William Christie dir, Les Arts Florissants - Reprise Du Choeur Des Nations : 'Que Devant Nous' - Les Arts Florissants\n") (gimme-append-to-buffer "34 - William Christie dir, Les Arts Flor*emphasized text*issants - Reprise De L'Air Des Zephyrs - Les Arts Florissants\n") The first problem that I've faced is that the string is somehow not fully formed when the function is so called, so writing something like (mapcar 'eval (format "(%s)" input-string)) won't work. To deal with this first problem, I was using a loop. The full function I wrote is: (defun eval-all-sexps (s) (loop for x = (ignore-errors (read-from-string s)) then (ignore-errors (read-from-string (substring s position))) while x summing (or (cdr x) 0) into position doing (eval (car x)))) Now the second problem that showed up is that the function is called twice with a somewhat large input, first with valid but partial content, then with what looks like pieces of the remaining data. To solve this problem, I'm considering using a junk variable to hold up what remains from a loop and then concatenating it to the input of the next call, but I was wondering if you guys have any other suggestions on how to deal with such a problem more elegantly. Thanks!

    Read the article

  • Saving/Associating slider values with a pop-up menu

    - by James
    Hi, Following on from a question I posted yesterday about GUIs, I have another problem I've been working with. This question related to calculating the bending moment on a beam under different loading conditions. On the GUI I have developed so far, I have a number of sliders (which now work properly) and a pop-up menu which defines the load case. I would like to be able to select the load case from the pop-up menu and position the loads as appropriate, in order to define each load case in turn. The output that I need is an array defining the load case number (the rows) and a number of loading parameters (the itensity and position of the loads, which are controlled by the sliders). The problem I am having is that I can produce this array (of the size I need) and define the loading for one load case (by selecting the pop-up menu) using the sliders, but when I change the popup menu again, the array only keeps the loading for the load case selected by the pop-up menu. Can anyone suggest an approach I can take with (specifically to store the variables from each load case) or an example that illustrates a similar solution to the problem? The probem may be a bit vague, so please let me know if anything needs clearing up. Many Thanks, James

    Read the article

  • Cannot find symbol - variable

    - by Ben Garside
    I'm new to Java, and I'm trying to get user input, store each line of input as a variable and then return each value so that it can be passed on somewhere else. When I try and compile it is telling me that it can't find the variable magnitude. I'm assuming it won't find the others either. I'm guessing that this is because I've declare the variables inside of the "try" but don't know how to get it so that the return statement accepts them. Code is as follows: public Earthquake userAddEarthquake() { Scanner scanner = new Scanner(System.in); try{ // convert the string read from the scanner into Integer type System.out.println("Please Enter An Earthquake Magnitude: "); Double magnitude = Double.parseDouble(scanner.nextLine()); System.out.println("Please Enter The Earthquakes Latitude Position: "); scanner = new Scanner(System.in); Double positionLatitude = Double.parseDouble(scanner.nextLine()); System.out.print("Please Enter The Earthquakes Longitude Position: "); scanner = new Scanner(System.in); Double positionLongitude = Double.parseDouble(scanner.nextLine()); System.out.print("Please Enter The Year That The Earthquake Occured: "); scanner = new Scanner(System.in); int year = Integer.parseInt(scanner.nextLine()); System.out.println("Magnitude = " + magnitude); } catch(NumberFormatException ne){ System.out.println("Invalid Input"); } finally{ scanner.close(); } return new Earthquake(magnitude, positionLatitude, positionLongitude, year); }

    Read the article

  • Dropdown menu disappears in IE7

    - by Justine
    A weird problem with a dropdown menu in IE7: http://screenr.com/SNM The dropdown disappears when the mouse moves to a part that hovers above other layers. The HTML structure looks like this: <div class="header"> <ul class="nav> <li><a href="">item</a> <ul><li><a href="">sub-item</a></li></ul> </li> </ul> </div><!-- /header--> <div class="featured"></div> <div class="content"></div> The sub-menu is positioned absolutely and has visibility:hidden, then it's set to visible using jQuery, like so: $(".header ul.nav li").hover(function(){ $(this).addClass("hover"); $('ul:first',this).css('visibility', 'visible'); }, function(){ $(this).removeClass("hover"); $('ul:first',this).css('visibility', 'hidden'); }); I had a problem with the dropdown hiding under other content in IE7, fixed easily by giving the z-index to its parent and other divs: *:first-child+html .header { position: relative; z-index: 2 !important; } *:first-child+html .content, *:first-child+html .main, *:first-child+html .primary *:first-child+html .featured { position: relative; z-index: 1 !important; } Now, I have no idea why the menu disappears when hovered over other divs, you can view the site live here: http://dev.gentlecode.net/ama/ubezpieczenia.html I would love any help, been staring at this code for ages now without any solution. I guess it's just me tunnel visioning already... Thanks in advance for any help!

    Read the article

  • Javascript: Collision detection

    - by jack moore
    Hello, could someone please help me to understand how collision detection works in JS? I can't use jQuery or gameQuery - already using prototype - so, I'm looking for something very simple. Not asking for complete solution, just point me to the right direction. Let's say there's: <div id="ball"></div> and <div id="someobject0"></div> Now the ball is moving (any direction). "Someobject"(0-X) is already pre-defined and there's 20-60 of them randomly positioned like this: #someobject {position: absolute; top: RNDpx; left: RNDpx;} I can create an array with "someobject(X)" positions and test collision while the "ball" is moving... Something like: for(var c=0; c<objposArray.length; c++){ ........ and code to check ball's current position vs all objects one by one.... } But I guess this would be a "noob" solution and it looks pretty slow. Is there anything better?

    Read the article

  • CSS Menu disappear

    - by WtFudgE
    Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

    Read the article

  • Java & android: Help linking an item in a listView to its correct view, but not the way i know of.

    - by Capsud
    Hi, i'm developing an android app, and what i have is a String array of restaurants in one class... static final String[] AtoZ = new String[] { "Ananda", "Brambles Cafe", "Brannigans", "Buona Sera", "Cafe Mao", "Cafe Mimo", "Dante", "Eddie Rockets", "Frango's World Cuisine", "Nando's", "Overends Restaurant @ Airfield House", "Pizza Hut", "Roly Saul", "Siam Thai","Smokey Joes","Sohag Tandoori", "TGI Friday","The Rockfield Lounge", "Winters Bar", "Al Boschetto","Baan Thai", "Bella Cuba", "Bellamys","Bianconis","Canal Bank Cafe", "Canalettos Restaurant","Chandni Restaurant", "Chill Out Cafe", "Crowes", "Da Vincenzo", "Druids", "Dylan", "Epic Restaurant", "Jewel in the Crown", "Juniors", "Kanum Thai","Kites", "Koishi","Maia Restaurant", "Mangetu Restaurant", "Millers Pizza Kitchens", "O'Connells Restaurant", "Ocras Restaurant", "Orchid Szechuan Restaurant", "Roly's Bistro", "Ryans Beggars Bush", }; i have created a view for each of these restaurants aswell in my layouts folder. so this array is going to be displayed in a listView in my android app. What i want to know is what is the quickest way of linking the item clicked to its correct view, without having to type out each position in the array and have a serious of if statements which would take a year with this! i dont want to be doing something like this if(position == 1){ setContentView(R.layout.bentleys); as it would take a year doing that for each one... Please help. thanks alot.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Finding distance to the closest point in a point cloud on an uniform grid

    - by erik
    I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

    Read the article

  • How do I get uri of HTTP packet with winpcap?

    - by Gtker
    Based on this article I can get all incoming packets. /* Callback function invoked by libpcap for every incoming packet */ void packet_handler(u_char *param, const struct pcap_pkthdr *header, const u_char *pkt_data) { struct tm *ltime; char timestr[16]; ip_header *ih; udp_header *uh; u_int ip_len; u_short sport,dport; time_t local_tv_sec; /* convert the timestamp to readable format */ local_tv_sec = header->ts.tv_sec; ltime=localtime(&local_tv_sec); strftime( timestr, sizeof timestr, "%H:%M:%S", ltime); /* print timestamp and length of the packet */ printf("%s.%.6d len:%d ", timestr, header->ts.tv_usec, header->len); /* retireve the position of the ip header */ ih = (ip_header *) (pkt_data + 14); //length of ethernet header /* retireve the position of the udp header */ ip_len = (ih->ver_ihl & 0xf) * 4; uh = (udp_header *) ((u_char*)ih + ip_len); /* convert from network byte order to host byte order */ sport = ntohs( uh->sport ); dport = ntohs( uh->dport ); /* print ip addresses and udp ports */ printf("%d.%d.%d.%d.%d -> %d.%d.%d.%d.%d\n", ih->saddr.byte1, ih->saddr.byte2, ih->saddr.byte3, ih->saddr.byte4, sport, ih->daddr.byte1, ih->daddr.byte2, ih->daddr.byte3, ih->daddr.byte4, dport); } But how do I extract URI information in packet_handler?

    Read the article

  • SEM/SEO tasks doubts

    - by Josemalive
    Hello, Actually i think that i have an strong knowledge of SEO, but im having some doubts about the following: I will have to increase the position in Google of certain product pages of a company in the next months. I supposed that not only will be sufficient the following tasks: Improve usability of those pages. Change the pages title. Add meta description and keywords. Url's in a REST way. 301's http header to dont lose page rank for the new URLS Optimizing content for Google. Configure links of the website (follow and no follow attributes) Get more inbounds links (Link building tasks). Create RSS. Put main website in Twitter (using twitter feed) using the RSS. Put main website in Facebook. Create a Youtube channel. Invest in Adwords. Invest in other online advertising companies. Use sitemap.xml and Google Webmaster tools. Use Google Trends to analyze the volume of searches of certain keywords. Use Google Analytics to analyze weak points and good points of your site, and find new oportunities in keywords. Use tools to find new keywords related with your content. Do you have some internet links, or knowledge about all the tasks that a SEO Expert should do? Could you share some knowledge about what kind of business could be do with another companies (B2B) to increase the search engine position of those product pages. Do you know more tecniques about how to get more inbound links? (i only know the link interchange) Thanks in advance. Best Regards. Jose.

    Read the article

< Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >