Search Results

Search found 9695 results on 388 pages for 'vincent mac'.

Page 193/388 | < Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >

  • OpenGLES Add User Interactions

    - by mac
    http://www.switchonthecode.com/tutorials/getting-started-with-opengl-es-for-the-iphone From the above link they created tutorial by No Nib File. But i need to add User interactions like , adding Progress View. Please help me. i am new to iphone OpenGLES. Thanks In Advance.

    Read the article

  • problem in displaying a slug with dash

    - by Mac Taylor
    hey guys i made a slug with dash for my stories urls such as : http://stackoverflow.com/questions/482636/fetching-records-with-slug-instead-of-id this is my code to create slug : function Slugit($title) { $title = strip_tags($title); // Preserve escaped octets. $title = preg_replace('|%([a-fA-F0-9][a-fA-F0-9])|', '---$1---', $title); // Remove percent signs that are not part of an octet. $title = str_replace('%', '', $title); // Restore octets. $title = preg_replace('|---([a-fA-F0-9][a-fA-F0-9])---|', '%$1', $title); $title = remove_accents($title); if (seems_utf8($title)) { if (function_exists('mb_strtolower')) { $title = mb_strtolower($title, 'UTF-8'); } $title = utf8_uri_encode($title, 500); } $title = strtolower($title); $title = preg_replace('/&.+?;/', '', $title); // kill entities $title = str_replace('.', '-', $title); $title = preg_replace('/[^%a-z0-9 _-]/', '', $title); $title = preg_replace('/\s+/', '-', $title); $title = preg_replace('|-+|', '-', $title); $title = trim($title, '-'); return $title; } as you can see dashes , up to here , everything is fine but when i click on the link , it can not open and find it my database as it's saved in normal and with no dashes so i wrote something to remove dashes $string = str_replace('-', '&nbsp;', $string); but when there is ? or . in url , then it can not dispaly ! any help to retrieve back the original url ?!

    Read the article

  • Mutating XML in Clojure

    - by mac
    Clojures clojure.xml/parse, clojure.zip/xml-zip and clojure.contrib.zip-filter.xml/xml- are excellent tools for pulling values out of xml, but what if I want to change the xml (the result of clojure.zip/xml-zip) based on what I learn from xml- "queries" and write the result back out as xml? I would have expected that (clojure.contrib.prxml/prxml (clojure.xml/parse xml-content)) spit back xml, but that is not the case.

    Read the article

  • Zend DB MYSQL Wrapper

    - by Vincent
    All, I have a PHP application written in Zend Framework with MVC style. I plan to use Zend_DB to connect to the MySQL database and process queries. I am looking for a wrapper class which makes it easy to use Zend_DB class. This wrapper class will have a constructor that connects to the Mysql db using Zend_DB. It will also have a method to return a singleton instance for each and every db connection made. Something like: $pptDB = PPTDB::getInstance(); $pptDB->setFetchMode(PPTDB::FETCH_OBJ); $result = $pptDB->fetchRow('SELECT * FROM bugs WHERE bug_id = 2'); echo $result->bug_description; Where class PPTDB extends Zend_DB Is this something feasible to have? If not, how ls would you use Zend_DB in a major application? Thanks,

    Read the article

  • UVA #10410 Tree Reconstruction

    - by Vincent
    I have worked on UVA 10410 Tree Reconstruction several days. But I can't get the correct answer unitl now. I have used an algorithm similar to the one which we always use to recovery a binary tree through the preorder traversal and the inorder traversal. But it can't work. Can anyone help me? Thanks in advance.

    Read the article

  • CURL - HTTPS Wierd error

    - by Vincent
    All, I am having trouble requesting info from HTTPS site using CURL and PHP. I am using Solaris 10. It so happens that sometimes it works and sometimes it doesn't. I am not sure what is the cause. If it doesn't work, this is the entry recorded in the verbose log: * About to connect() to 10.10.101.12 port 443 (#0) * Trying 10.10.101.12... * connected * Connected to 10.10.101.12 (10.10.101.12) port 443 (#0) * error setting certificate verify locations, continuing anyway: * CAfile: /etc/opt/webstack/curl/curlCA CApath: none * error:80089077:lib(128):func(137):reason(119) * Closing connection #0 If it works, this is the entry recorded in the verbose log: * About to connect() to 10.10.101.12 port 443 (#0) * Trying 10.10.101.12... * connected * Connected to 10.10.101.12 (10.10.101.12) port 443 (#0) * error setting certificate verify locations, continuing anyway: * CAfile: /etc/opt/webstack/curl/curlCA CApath: none * SSL connection using DHE-RSA-AES256-SHA * Server certificate: * subject: C=CA, ST=British Columnbia, L=Vancouver, O=google, OU=FDN, CN=g.googlenet.com, [email protected] * start date: 2007-07-24 23:06:32 GMT * expire date: 2027-09-07 23:06:32 GMT * issuer: C=US, ST=California, L=Sunnyvale, O=Google, OU=Certificate Authority, CN=support, [email protected] * SSL certificate verify result: unable to get local issuer certificate (20), continuing anyway. > POST /gportal/gpmgr HTTP/1.1^M Host: 10.10.101.12^M Accept: */*^M Accept-Encoding: gzip,deflate^M Content-Length: 1623^M Content-Type: application/x-www-form-urlencoded^M Expect: 100-continue^M ^M < HTTP/1.1 100 Continue^M < HTTP/1.1 200 OK^M < Date: Wed, 28 Apr 2010 21:56:15 GMT^M < Server: Apache^M < Cache-Control: no-cache^M < Pragma: no-cache^M < Vary: Accept-Encoding^M < Content-Encoding: gzip^M < Content-Length: 1453^M < Content-Type: application/json^M < ^M * Connection #0 to host 10.10.101.12 left intact * Closing connection #0 My CURL options are as under: $ch = curl_init(); $devnull = fopen('/tmp/curlcookie.txt', 'w'); $fp_err = fopen('/tmp/verbose_file.txt', 'ab+'); fwrite($fp_err, date('Y-m-d H:i:s')."\n\n"); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,120); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); curl_setopt($ch, CURLOPT_VERBOSE,1); curl_setopt($ch, CURLOPT_FAILONERROR, true); curl_setopt($ch, CURLOPT_STDERR, $fp_err); $ret = curl_exec($ch); Anybody has any idea, why it works sometimes but fails mostly? Thanks

    Read the article

  • Zend Server with xampp MySQL

    - by Vincent
    I am running Zend Server,Zend Studio (Trial versions) on Ubuntu 9.10. I am also using xampp to do most of my development. I plan to use Zend Server only to do URL profiling to know function level performance of my code. Is it possible to configure Zend Server to use XAMPP's MySQL database instead of installing a new mysql instance for Zend Server? Thanks

    Read the article

  • SSRS- Bar Chart with single bar needs to display Percentage data

    - by Mac
    Hi All, I have a requirement to show percentages in bar chart on a single bar using SSRS. For example, I want to show a employees by Age in a percentage in an SSRS report. 1.How many % employees between age 20 and 30? 2.How many % employees between age 30 and 40? 3.How many % employees between age 40 and 50? All this on a chart which has only single bar chart in percentage? Is it possible? Thanks

    Read the article

  • Genetic Programming in C#

    - by Mac
    I've been looking for some good genetic programming examples for C#. Anyone knows of good online/book resources? Wonder if there is a C# library out there for Evolutionary/Genetic programming?

    Read the article

  • 'License expired' error when dynamically generating Excel docs in ASP.NET

    - by Mac
    Anyone familiar with error below? When I run my webapp to generate a dynamic excel doc from my local machine it works fine but when the same piece of code is invoked on the server I get the below error. It seems like it's a permissions issues since it works on my machine but not the server but I don't know where to start in order to pinpoint the problem. Any guidance/help is greatly appreciated! Server Error in '/' Application. -------------------------------------------------------------------------------- This command is unavailable because the license to use this application has expired. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Runtime.InteropServices.COMException: This command is unavailable because the license to use this application has expired. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [COMException (0x800a03ec): This command is unavailable because the license to use this application has expired.] Microsoft.Office.Interop.Excel.Workbooks.Add(Object Template) +0 PaymentsReport.Page_Load(Object sender, EventArgs e) +70 System.Web.Util.CalliHelper.EventArgFunctionCaller(IntPtr fp, Object o, Object t, EventArgs e) +15 System.Web.Util.CalliEventHandlerDelegateProxy.Callback(Object sender, EventArgs e) +34 System.Web.UI.Control.OnLoad(EventArgs e) +99 System.Web.UI.Control.LoadRecursive() +47 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1061 Office/Excel is installed on the server and I can open/save excel docs on the server. Could it be the version of excel on the server vs. my local machine? If so how can I make sure I have the latest on the server?

    Read the article

  • CURL - https - solaris

    - by Vincent
    All, I am receiving the following error when I use PHP to curl to a https site. Both PHP and the https site are hosted on Solaris. This error seems to occur occassionally but frequently. error:80089077:lib(128):func(137):reason(119) This is the curl code I am using: $ch = curl_init(); $devnull = fopen('/tmp/cookie.txt', 'w'); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,800); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); $retVal = curl_exec($ch); print_r(curl_error($ch)); curl_close($ch); if ($devnull) { fclose($devnull); } How can I fix this error? If not, is there an alternative to curl?

    Read the article

  • Jquery - Loop through Checkboxes and Multiple elements

    - by Vincent
    All, I have a set of elements like this in a form: <input type="checkbox" name="chk[140]"> <input type="hidden" value="3" name="ctcount[140]"> <input type="hidden" value="Apples" name="catname[140]"> <input type="checkbox" name="chk[142]"> <input type="hidden" value="20" name="ctcount[142]"> <input type="hidden" value="Bananas" name="catname[142]"> <input type="checkbox" name="chk[144]"> <input type="hidden" value="200" name="ctcount[144]"> <input type="hidden" value="Strawberries" name="catname[144]"> <input type="checkbox" name="chk[145]"> <input type="hidden" value="0" name="ctcount[145]"> <input type="hidden" value="Carrots" name="catname[145]"> When a user clicks a button, I want the Javascript to: 1. Loop through all the checkboxes 2. For all the checked checkboxes, 2a. Get ctcount value 2b. Get catname value 2c. If ctcount value > 50, alert a message saying "Unable to add item as max limit for 'catname' has reached. 2d. Break the loop after it encountered first ctcount value that is greater than 50. I am new to JQuery..have the following code so far: var checklimit = 50; $('#frmTest input:checkbox:checked').each(function(i) { alert(this.value); }); How do I do this using JQuery? Thanks

    Read the article

  • Solve the IE select overlap bug

    - by Vincent Robert
    When using IE, you cannot put an absolutely positioned div over a select input element. That's because the select element is considered an ActiveX object and is on top of every HTML element in the page. I already saw people hiding selects when opening a popup div, that leads to pretty bad user experience having controls disappearing. FogBugz actually had a pretty smart solution (before v6) of turning every select into text boxes when a popup was displayed. This solved the bug and tricked the user eye but the behavior was not perfect. Another solution is in FogBugz 6 where they no more use the select element and recoded it everywhere. Last solution I currently use is messing up the IE rendering engine and force it to render the absolutely positioned div as an ActiveX element too, ensuring it can live over a select element. This is achieved by placing an invisible iframe inside the div and styling it with: #MyDiv iframe { position: absolute; z-index: -1; filter: mask(); border: 0; margin: 0; padding: 0; top: 0; left: 0; width: 9999px; height: 9999px; overflow: hidden; } Anyone has a even better solution than this one ? EDIT: The purpose of this question is as much informative as it is a real question. I find the iframe trick to be a good solution but I am still looking for improvement like removing this ugly useless iframe tag that degrade accessibility.

    Read the article

  • How to debug packet loss ?

    - by Gene Vincent
    I wrote a C++ application (running on Linux) that serves an RTP stream of about 400 kbps. To most destinations this works fine, but some destinations expericence packet loss. The problematic destinations seem to have a slower connection in common, but it should be plenty fast enough for the stream I'm sending. Since these destinations are able to receive similar RTP streams for other applications without packet loss, my application might be at fault. I already verified a few things: - in a tcpdump, I see all RTP packets going out on the sending machine - there is a UDP send buffer in place (I tried sizes between 64KB and 300KB) - the RTP packets mostly stay below 1400 bytes to avoid fragmentation What can a sending application do to minimize the possibility of packet loss and what would be the best way to debug such a situation ?

    Read the article

  • Zend_Soap_Client - Ignore HTTPS verification

    - by Vincent
    All, I want to use Zend_Soap_Client class to load WSDL from an HTTPS url. Currently, if I call like this, it gives me an error even if the WSDL is perfectly valid: $wsdlUrl = "https://abc.xyz.com/webservices/WeatherService.php?wsdl"; $soapClient = new Zend_Soap_Client($wsdlUrl); The error I receive is: SOAP-ERROR: Parsing WSDL: Couldn't load from 'https://abc.xyz.com/webservices /WeatherService.php?wsdl' : Start tag expected, '<' not found If I browse to the WSDL url in the browser, it loads up the WSDL just fine. I think Zend_Soap_Client is trying to validate the certificate and failing. Is there a way to set the SOAP option to ignore the HTTPS verification and just load the WSDL? Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • merge() multiple data frames (do.call ?)

    - by Vincent
    Hi everyone, here's my very simple question: merge() only takes two data frames as input. I need to merge a series of data frames from a list, using the same keys for every merge operation. Given a list named "test", I want to do something like: do.call("merge", test). I could write some kind of loop, but I'm wondering if there's a standard or built-in way to do this more efficiently. Any advice is appreciated. Thanks! Here's a subset of the dataset in dput format (note that merging on country is trivial in this case, but that there are more countries in the original data): test <- list(structure(list(country = c("United States", "United States", "United States", "United States", "United States"), NY.GNS.ICTR.GN.ZS = c(13.5054687, 14.7608697, 14.1115876, 13.3389063, 12.9048351), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GNS.ICTR.GN.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NE.TRD.GNFS.ZS = c(29.3459277, 28.352838, 26.9861939, 25.6231246, 23.6615328), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NE.TRD.GNFS.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NY.GDP.MKTP.CD = c(1.37416e+13, 1.31165e+13, 1.23641e+13, 1.16309e+13, 1.0908e+13), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GDP.MKTP.CD", "year"), row.names = c(NA, 5L), class = "data.frame"))

    Read the article

  • CSS for https urls

    - by Vincent
    Hello, looking for some help with images referenced within the stylesheet. I have no problems with these from non secure locations within the site but only from https. The stylesheet loads fine and displays everything correctly except for the images. example: body { margin: 0; padding: 0; background: url(/img/background_tile.gif) top left repeat-x; text-align: center; background-color: #fff; } All my css files and other image paths inside the code use relative urls to images. How can I make sure they all work fine without hard coding my image paths with https or http? I want the code to work fine with http and https. Thanks

    Read the article

  • how to use two forms and sumit once

    - by Mac Taylor
    hey guys is it possible to have two forms with two submit buttons but when i click on the button then it saves both forms input fields im concerning to solve this in php /mysql i tried my own way : if ((isset($_POST["form-1"])) && (isset($_POST["form-2"])) { //SQL Insertion } thanks in advance

    Read the article

  • How to use a specific Windows SDK with MSBuild?

    - by Mac
    I have a large project made of many C++ and C# projects, and a MSBuild (3.5) script to build the whole thing. This script is based on the VCBuild (C++ projects) and MSBuild (C# projects) tasks. It is regularly executed by a Continuous Integration server. I want to be able to select a specific Windows SDK (v6.0A, v7.0, v7.1...) to be used for compilation. As I have many branches in my repository that would ultimately need a different SDK version, I need a way to select the right one before each compilation. On my computer, I have been able to setup a batch script that calls the right SetEnv.cmd before launching the MSBuild script. But this solution is not usable on the CI server as the MSBuild script is executed directly. Do you know of a way to achieve the equivalent of SetEnv.cmd under MSBuild?

    Read the article

  • Launch Apple's Stocks app, with a particular stock selected

    - by Vincent Gable
    I would like to launch Apple's Stocks app to show information for a particular stock, on a non-jailbroken phone. I'm not interesting in how to get a quote or graph a stock myself, just opening Stocks.app. I was hoping that the Stocks app would have a custom URL format, so opening a URL like stocks://AAPL would do the trick. But I haven't found anything documenting such a scheme, and suspect it doesn't exist. Any other ideas, or is it impossible to integrate with the native Stocks app?

    Read the article

  • Pear SOAP and XAMPP on Ubuntu

    - by Vincent
    All, I have installed xampp for linux on ubuntu 9.10. The installation directory is /opt/lampp. The xampp website says PEAR comes with the installation.. I am relatively new to PEAR and want to know the answers for following: Is PEAR installed with xampp or need to be installed separately using synaptic package manager? I browse to /opt/lampp/bin directory and see "pear" there, but when i type it in the command line, it says "The program 'pear' is currently not installed. You can install it by typing: sudo apt-get install php-pear pear: command not found " I want to use PEAR:SOAP package in my PHP code. How to use that? Do I need to set any paths to the pear in my php.ini? Thanks

    Read the article

  • saving information in file in php

    - by Mac Taylor
    hey guys i want to write a tracking system and now i can save in my Mysql database . but saving information about each ip that visits is a huge work for mysql so i think if i could save the information in a file , then there is no discussion about database and its problems . but to begin this : i realy dont know how to save in a file in a way that i can read it with no problem and show the details this is what is used to insert into my database sql_query("insert into tracking (date_time, ip_address, hostname,referer, page , page_title) values ('".sql_quote($dt)."', '".sql_quote($ipaddr)."', '".sql_quote($hostnm)."','$referer', '".sql_quote($pg)."', '".sql_quote($pagetitle)."')", $dbi); i need to show information about all ips in rows , after saving in a file what should i do to save and show in row order ( table ) php/mysql

    Read the article

  • How to use ternary operator instead of if-else in PHP

    - by Mac Taylor
    hey guys i need to shorten or better to say ., harden my codes this is my original code : if ($type = "recent") { $OrderType = "sid DESC"; }elseif ($type = "pop"){ $OrderType = "counter DESC"; }else { $OrderType = "RAND()"; } now how can i use markers like this : $OrderType = ($type = "recent") ? "sid DESC" : "counter DESC" ; i tried but i didnt know how to write elseif in operators

    Read the article

  • Exporting XML from FIleMaker Pro Server

    - by Jeno
    FileMaker Pro 10 Server: Mac OS X Server 10.4.11 DAtA Server: Windows Server 2008 I am having problem cross platform issue when exporting XML from FileMaker Pro client on a Mac to DATA Server. My FileMaker Pro server is hosting on a Mac OS X and the I need user to export their data to a DATA server which is hosting on a Windows Server. I created a button(function/script) in the FileMaker form for user to export data once they finish with their job. FileMaker Pro client on the PC works perfectly but It does't work on the MAC. I've tried every combination I can think of for the location path as documented on: http://www.filemaker.com/11help/html/create_db.8.32.html#1030283 Any idea? Thanks

    Read the article

< Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >