Search Results

Search found 70288 results on 2812 pages for 'custom data generator'.

Page 1934/2812 | < Previous Page | 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941  | Next Page >

  • How to play next file using Audio Queue Services

    - by Stanislav
    What is the right way to play next file using Audio Queue Services? When "play next" button is pressed should I first call AudioQueueStop and then AudioQueuePrime/AudioQueueStart or it is enough to just fill buffers with next file data? The problem is that the latter gives me sound glitches on iPhone.

    Read the article

  • Where are Riak Post-Commit Hooks run?

    - by pixelcort
    I'm trying to evaluate using Riak's Post-Commit Hooks to build a distributed, incremental MapReduce-based index, but was wondering which Riak nodes the Post-Commit Hooks actually run on. Are they run on the nodes the client used to put the commits, or on the primary nodes where the data is persisted? If it's the latter, I'm thinking I can from there efficiently do a map or reduce and put additional records from the output.

    Read the article

  • jquery multiple ajax check for all done? (order not important)

    - by second
    Is there a neat way to make sure a bunch of ajax callbacks have all finished? They don't need to be executed in order, i just need all the data to be there. one idea is to have them all increment a counter on completion and check if counter == countMax, but that seems ugly. Also, are there sync issues? (from simultaneous read/write to the counter)

    Read the article

  • Hibernate + Spring : cascade deletion ignoring non-nullable constraints

    - by E.Benoît
    Hello, I seem to be having one weird problem with some Hibernate data classes. In a very specific case, deleting an object should fail due to existing, non-nullable relations - however it does not. The strangest part is that a few other classes related to the same definition behave appropriately. I'm using HSQLDB 1.8.0.10, Hibernate 3.5.0 (final) and Spring 3.0.2. The Hibernate properties are set so that batch updates are disabled. The class whose instances are being deleted is: @Entity( name = "users.Credentials" ) @Table( name = "credentials" , schema = "users" ) public class Credentials extends ModelBase { private static final long serialVersionUID = 1L; /* Some basic fields here */ /** Administrator credentials, if any */ @OneToOne( mappedBy = "credentials" , fetch = FetchType.LAZY ) public AdminCredentials adminCredentials; /** Active account data */ @OneToOne( mappedBy = "credentials" , fetch = FetchType.LAZY ) public Account activeAccount; /* Some more reverse relations here */ } (ModelBase is a class that simply declares a Long field named "id" as being automatically generated) The Account class, which is one for which constraints work, looks like this: @Entity( name = "users.Account" ) @Table( name = "accounts" , schema = "users" ) public class Account extends ModelBase { private static final long serialVersionUID = 1L; /** Credentials the account is linked to */ @OneToOne( optional = false ) @JoinColumn( name = "credentials_id" , referencedColumnName = "id" , nullable = false , updatable = false ) public Credentials credentials; /* Some more fields here */ } And here is the AdminCredentials class, for which the constraints are ignored. @Entity( name = "admin.Credentials" ) @Table( name = "admin_credentials" , schema = "admin" ) public class AdminCredentials extends ModelBase { private static final long serialVersionUID = 1L; /** Credentials linked with an administrative account */ @OneToOne( optional = false ) @JoinColumn( name = "credentials_id" , referencedColumnName = "id" , nullable = false , updatable = false ) public Credentials credentials; /* Some more fields here */ } The code that attempts to delete the Credentials instances is: try { if ( account.validationKey != null ) { this.hTemplate.delete( account.validationKey ); } this.hTemplate.delete( account.languageSetting ); this.hTemplate.delete( account ); } catch ( DataIntegrityViolationException e ) { return false; } Where hTemplate is a HibernateTemplate instance provided by Spring, its flush mode having been set to EAGER. In the conditions shown above, the deletion will fail if there is an Account instance that refers to the Credentials instance being deleted, which is the expected behaviour. However, an AdminCredentials instance will be ignored, the deletion will succeed, leaving an invalid AdminCredentials instance behind (trying to refresh that instance causes an error because the Credentials instance no longer exists). I have tried moving the AdminCredentials table from the admin DB schema to the users DB schema. Strangely enough, a deletion-related error is then triggered, but not in the deletion code - it is triggered at the next query involving the table, seemingly ignoring the flush mode setting. I've been trying to understand this for hours and I must admit I'm just as clueless now as I was then.

    Read the article

  • Javascript ContextMenu on a TD

    - by Dave
    If I attach a context menu to a td, it fires okay for text in the TD, but if I add a div to the TD, the context menu will not fire when right clicking on the div. How can I make the context menu fire when anything, data or divs, are right clicked in the td?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • Saxon XSLT-Transformation: How to change serialization of an empty tag from <x/> to <x></x>?

    - by Ben
    Hello folks! I do some XSLT-Transformation using Saxon HE 9.2 with the output later being unmarshalled by Castor 1.3.1. The whole thing runs with Java at the JDK 6. My XSLT-Transformation looks like this: <xsl:transform version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ns="http://my/own/custom/namespace/for/the/target/document"> <xsl:output method="xml" encoding="UTF-8" indent="no" /> <xsl:template match="/"> <ns:item> <ns:property name="id"> <xsl:value-of select="/some/complicated/xpath" /> </ns:property> <!-- ... more ... --> </xsl:template> So the thing is: if the XPath-expression /some/complicated/xpath evaluates to an empty sequence, the Saxon serializer writes <ns:property/> instead of <ns:property></ns:property>. This, however, confuses the Castor unmarshaller, which is next in the pipeline and which unmarshals the output of the transformation to instances of XSD-generated Java-code. So my question is: How can I tell the Saxon-serializer to output empty tags not as standalone tags? Here is what I am proximately currently doing to execute the transformation: import net.sf.saxon.s9api.*; import javax.xml.transform.*; import javax.xml.transform.sax.SAXSource; // ... // read data XMLReader xmlReader = XMLReaderFactory.createXMLReader(); // ... there is some more setting up the xmlReader here ... InputStream xsltStream = new FileInputStream(xsltFile); InputStream inputStream = new FileInputStream(inputFile); Source xsltSource = new SAXSource(xmlReader, new InputSource(xsltStream)); Source inputSource = new SAXSource(xmlReader, new InputSource(inputStream)); XdmNode input = processor.newDocumentBuilder().build(inputSource); // initialize transformation configuration Processor processor = new Processor(false); XsltCompiler compiler = processor.newXsltCompiler(); compiler.setErrorListener(this); XsltExecutable executable = compiler.compile(xsltSource); Serializer serializer = new Serializer(); serializer.setOutputProperty(Serializer.Property.METHOD, "xml"); serializer.setOutputProperty(Serializer.Property.INDENT, "no"); serializer.setOutputStream(output); // execute transformation XsltTransformer transformer = executable.load(); transformer.setInitialContextNode(input); transformer.setErrorListener(this); transformer.setDestination(serializer); transformer.setSchemaValidationMode(ValidationMode.STRIP); transformer.transform(); I'd appreciate any hint pointing in the direction of a solution. :-) In case of any unclarity I'd be happy to give more details. Nightly greetings from Germany, Benjamin

    Read the article

  • rails dates with json

    - by fenec
    hello am implementing a facebook application and am using AJAX/Json,however the json structures that are returned have this format "2010-05-30T06:14:00Z" , I am using Game.all.to_json how can i convert them to a normal date format ? Is it easier to do it from the server side or the client side using fbjs? (there are a lot of bugs with fbjs so i would prefer using a solution from the server side , like converting the data before sending the json structures) thnak you

    Read the article

  • matplotlib analog of R's `pairs`

    - by bgbg
    R has a useful function pairs that provides nice matrix of plots of pairwise connections between variables in a data set. The resulting plot looks similar to the following figure, copied from this blog post: Is there any ready to use function based on python's matplolib? I have searched its gallery, but couldn't find anything that resembles what I need. Technically, this should be a simple task, but proper handling of all the possible cases, labels, titles, etc is very tedious.

    Read the article

  • Best way to handle global state

    - by David
    Hi there, I was wondering if anyone could offer some advice on 'best practices' for using global state in a web application - specifically PHP, although im looking for generic best practices i.e. design patterns etc. At the moment I just use a static class, calling it Configs. I suppose this is similar to using the registry pattern but surely there is a more elegant way of handling global data within an application - i just cant think of a better way though.

    Read the article

  • problem about gridview and baseadapter? Pls help

    - by flybirdtt
    I need a gridview to place 9 items. And i write a custom baseadapter. But find a problem about the position in the getView method.it looks like this gridview miss the 7th item.The code like this:` public View getView(int position, View convertView, ViewGroup parent) { LayoutDTO lDto = menuHashtable.get(Integer.toString(position)); ViewHolder vHolder = new ViewHolder(); if (lDto != null) { String titleString = lDto.getTitle(); Log.v("title...........", titleString + " " + Integer.toString(position) ); Bitmap iconBitmap = lDto.getIcon(); convertView = mInflater.inflate(R.layout.custombutton, null); vHolder.icon = (ImageView) convertView .findViewById(R.id.imageicon); vHolder.icon.setImageBitmap(iconBitmap); vHolder.text = (TextView) convertView .findViewById(R.id.icontitle); int index = titleString.indexOf("\u0026"); if (index != -1) { String title1 = titleString.substring(0, index + 1).trim(); String title2 = titleString.substring(index + 1, titleString.length()).trim(); vHolder.text.setLines(2); String newtitle = title1 + "\n" + title2; vHolder.text.setText(newtitle); } else { vHolder.text.setLines(2); String newtitle = titleString + "\n" + " "; vHolder.text.setText(newtitle); } convertView.setTag(vHolder); } return convertView; }` The log show this: 05-20 21:37:16.066: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.105: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.125: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.135: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.166: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.185: VERBOSE/title...........(158): Entertainment 1 05-20 21:37:16.195: VERBOSE/title...........(158): Shopping 2 05-20 21:37:16.195: VERBOSE/title...........(158): Fashion 3 05-20 21:37:16.205: VERBOSE/title...........(158): Health & Beauty 4 05-20 21:37:16.215: VERBOSE/title...........(158): Supermarkets 5 05-20 21:37:16.226: VERBOSE/title...........(158): Auto Services 6 05-20 21:37:16.236: VERBOSE/title...........(158): Travel & Accommodation 8 05-20 21:37:16.316: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.326: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.336: VERBOSE/title...........(158): Dining 0 05-20 21:37:16.345: VERBOSE/title...........(158): Dining 0

    Read the article

  • How to merge jquery autocomplete and fcbkListSelection functionality?

    - by Ben
    Initial caveat: I am a newbie to jquery and javascript. I started using the autocomplete jquery plugin recently from bassistance.de. Yesterday, I found the fcbkListSelection plugin (http://www.emposha.com/javascript/fcbklistselection-like-facebook-friends-selector.html) and am using it to include a selector in my application. What I now want to do is to merge the 2 pieces of functionality since there are lots of items in my selector list. To be more specific, I want to put a "Filter by Name" text box above the facebook list selection object in my html. When the user types a few characters into the "Filter by Name" text box, I want the items in the Facebook list selector to only show the items that contain the typed characters -- kind of like what autocomplete does already, but rather than the results showing below the text input box, I want them to dynamically update the facebook list object. Is this possible and relatively straightforward? If so, can somebody please describe how to do it? If not, is there an easier way to approach this? Thanks! OK, to Spencer Ruport's comment, I guess I may have a more specific question already. Below is the current Javascript in my HTML file (angle brackets represent Django tags). #suggest1 and #fcbklist both do their separate pieces, but how do I get them to talk to each other? Do I need to further write javascript in my HTML file, or do I need to customize the guts of the plugins' .js? Does this help elaborate? $(document).ready(function() { var names = []; var count = 0; {% for a, b, c in friends_for_picker %} names[count] = "{{ b }}"; count = count+1; {% endfor %} function findValueCallback(event, data, formatted) { $("<li>").html( !data ? "No match!" : "Selected: " + formatted).appendTo("#result"); } function formatItem(row) { return row[0] + " (<strong>id: " + row[1] + "</strong>)"; } function formatResult(row) { return row[0].replace(/(<.+?>)/gi, ''); } $("#suggest1").autocomplete(names, { multiple: true, mustMatch: false, autoFill: true, matchContains: true, }); //id(ul id),width,height(element height),row(elements in row) $.fcbkListSelection("#fcbklist","575","50","4"); });

    Read the article

  • e.Row.Tag .ToString

    - by prince23
    hi, Child data grid is not showing the values in the page for the child datagrid I am binding with an list <sdk:DataGrid MinHeight="100" x:Name="contacts" Margin="51,21,88,98" RowDetailsVisibilityChanged="contacts_RowDetailsVisibilityChanged" LoadingRowDetails="contacts_LoadingRowDetails" RowDetailsVisibilityMode="VisibleWhenSelected" MouseLeftButtonUp="contacts_MouseLeftButtonUp" MouseLeftButtonDown="contacts_MouseLeftButtonDown"> <sdk:DataGrid.Columns> <sdk:DataGridTextColumn Binding="{Binding EmployeeID}" Header="ID" /> <sdk:DataGridTextColumn Binding="{Binding EmployeeFName}" Header="Fname" /> <sdk:DataGridTextColumn Binding="{Binding EmployeeLName}" Header="LName" /> <sdk:DataGridTextColumn Binding="{Binding EmployeeMailID}" Header="MailID" /> </sdk:DataGrid.Columns> <sdk:DataGrid.RowDetailsTemplate> <DataTemplate> <sdk:DataGrid x:Name="dgrdRowDetail" Width="200" AutoGenerateColumns="False" HorizontalAlignment="Center" IsReadOnly="True"> <sdk:DataGrid.Columns> <sdk:DataGridTextColumn Header="CompanyName" Binding="{Binding Company name}"/> <sdk:DataGridTextColumn Header="CompanyName" Binding="{Binding EmpID}"/> </sdk:DataGrid.Columns> </sdk:DataGrid> </DataTemplate> </sdk:DataGrid.RowDetailsTemplate> </sdk:DataGrid> I am having 2 grids "contacts" and "dgrdRowDetail" globally i have defined an variable like this:- DataGrid dgrdRowDetail; in the contacts_RowDetailsVisibilityChanged event I have this code if (e.Row.DataContext != null) { string strEmpID = ((SilverlightApplication1.DBServiceEMP.Employee)((e.DetailsElement).DataContext)).EmployeeID; dgrdRowDetail = (DataGrid)e.DetailsElement.FindName("dgrdRowDetail"); // here i am finding the child datgrid control in contacts datagrid // then in dgrdRowDetail i will be binding this grid with new values if (strEmpID != null) { int EmpID = Convert.ToInt32(strEmpID.ToString()); DBServiceEmp.GetEmployeeIDCompleted += new EventHandler<GetEmployeeIDCompletedEventArgs>(DBServiceEmp_GetEmployeeIDCompleted); DBServiceEmp.GetEmployeeIDAsync(EmpID); } } this is my method void DBServiceEmp_GetEmployeeIDCompleted(object sender, GetEmployeeIDCompletedEventArgs e) { // List<Employee> Employes = new List<Employee>(); List<Employee> rows = new List<Employee>(); for (int i = 0; i < e.Result.Count; i++) { rows.Add(e.Result[i]); } dgrdRowDetail.ItemsSource = rows; // here i am binding the child datagrid with new data source } dgrdRowDetail.ItemsSource = rows// what ever rows i am binding to dgrdRowDetail are not shown in the page if i check the rows i am able to see the value ther. but in the child grid it is not reflecting plz plz help me out i am struck thanks in advance prince

    Read the article

  • Java delimiter reader

    - by newbieprogrammer
    I have a colon-delimited text file containing grouped, related data. The People group contains people's names followed by their ages, separated by colons. How can I parse the text and group people according to their ages? The structure is as follows: Group.txt Age:10:20:30:40: Group:G1:10:G2:30:G3:20:G4:40: People:Jack:10:Tom:30:Dick:20:Harry:10:Paul:10:Peter:20: People:Mary:20:Lance:10: And I want to display something like this: G1 Jack Harry Paul Lance G2 Dick Peter Marry G3 Tom G4

    Read the article

  • .NET: Writing DataAccess dll

    - by RedsDevils
    I would like to write all data relations processes (general functions regarding with DataAccess via .NET) in dll and I want to use it repeatedly. What kinds of functions should have in that dll? Some want to use Stored Procedures , Some with Statements. Can you all suggest me? Please guide me! Thanks all!

    Read the article

  • Binding to a collection of DependencyObjects in Silverlight 4

    - by Meik
    As of Silverlight 4 it is possible to data bind against a DependencyObject (instead of a Framework element in previous versions). So far so good, but how do I bind agains a collection of DependencyObjects. The DataContext is not passed from the ObservableCollection to the collection elements, so that the DependencyProperties of the DependencyObjects are never called (neither the changed events). Neither the DependencyObject offers SetBinding or DataContext to initialize the binding manually. Thanks for any advice here.

    Read the article

  • Available alternative libraries in java to generate PDF documents

    - by Fazal
    I have been using XSL-FO and FOP Engine to generate PDF documents for required data. This works great, but lately I have seen some limitations in FOP especially when it comes to allowing user to enter text in a html editor which can be transformed to XSL-FO and given to FOP driver. This brought me to point to ask this large community of well informed individuals about what are possible Open Source or even non open source libraries to generate PDF documents in Java?

    Read the article

< Previous Page | 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941  | Next Page >