Search Results

Search found 7241 results on 290 pages for 'casey hope'.

Page 195/290 | < Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >

  • Valgrind says "stack allocation," I say "heap allocation"

    - by Joel J. Adamson
    Dear Friends, I am trying to trace a segfault with valgrind. I get the following message from valgrind: ==3683== Conditional jump or move depends on uninitialised value(s) ==3683== at 0x4C277C5: sparse_mat_mat_kron (sparse.c:165) ==3683== by 0x4C2706E: rec_mating (rec.c:176) ==3683== by 0x401C1C: age_dep_iterate (age_dep.c:287) ==3683== by 0x4014CB: main (age_dep.c:92) ==3683== Uninitialised value was created by a stack allocation ==3683== at 0x401848: age_dep_init_params (age_dep.c:131) ==3683== ==3683== Conditional jump or move depends on uninitialised value(s) ==3683== at 0x4C277C7: sparse_mat_mat_kron (sparse.c:165) ==3683== by 0x4C2706E: rec_mating (rec.c:176) ==3683== by 0x401C1C: age_dep_iterate (age_dep.c:287) ==3683== by 0x4014CB: main (age_dep.c:92) ==3683== Uninitialised value was created by a stack allocation ==3683== at 0x401848: age_dep_init_params (age_dep.c:131) However, here's the offending line: /* allocate mating table */ age_dep_data->mtable = malloc (age_dep_data->geno * sizeof (double *)); if (age_dep_data->mtable == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); for (int j = 0; j < age_dep_data->geno; j++) { 131=> age_dep_data->mtable[j] = calloc (age_dep_data->geno, sizeof (double)); if (age_dep_data->mtable[j] == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); } What gives? I thought any call to malloc or calloc allocated heap space; there is no other variable allocated here, right? Is it possible there's another allocation going on (the offending stack allocation) that I'm not seeing? You asked to see the code, here goes: /* Copyright 2010 Joel J. Adamson <[email protected]> $Id: age_dep.c 1010 2010-04-21 19:19:16Z joel $ age_dep.c:main file Joel J. Adamson -- http://www.unc.edu/~adamsonj Servedio Lab University of North Carolina at Chapel Hill CB #3280, Coker Hall Chapel Hill, NC 27599-3280 This file is part of an investigation of age-dependent sexual selection. This code is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This software is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with haploid. If not, see <http://www.gnu.org/licenses/>. */ #include "age_dep.h" /* global variables */ extern struct argp age_dep_argp; /* global error message variables */ char * nullmsg = "Null pointer: %i"; /* error message for conversions: */ char * errmsg = "Representation error: %s"; /* precision for formatted output: */ const char prec[] = "%-#9.8f "; const size_t age_max = AGEMAX; /* maximum age of males */ static int keep_going_p = 1; int main (int argc, char ** argv) { /* often used counters: */ int i, j; /* read the command line */ struct age_dep_args age_dep_args = { NULL, NULL, NULL }; argp_parse (&age_dep_argp, argc, argv, 0, 0, &age_dep_args); /* set the parameters here: */ /* initialize an age_dep_params structure, set the members */ age_dep_params_t * params = malloc (sizeof (age_dep_params_t)); if (params == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); age_dep_init_params (params, &age_dep_args); /* initialize frequencies: this initializes a list of pointers to initial frqeuencies, terminated by a NULL pointer*/ params->freqs = age_dep_init (&age_dep_args); params->by = 0.0; /* what range of parameters do we want, and with what stepsize? */ /* we should go from 0 to half-of-theta with a step size of about 0.01 */ double from = 0.0; double to = params->theta / 2.0; double stepsz = 0.01; /* did you think I would spell the whole word? */ unsigned int numparts = floor(to / stepsz); do { #pragma omp parallel for private(i) firstprivate(params) \ shared(stepsz, numparts) for (i = 0; i < numparts; i++) { params->by = i * stepsz; int tries = 0; while (keep_going_p) { /* each time through, modify mfreqs and mating table, then go again */ keep_going_p = age_dep_iterate (params, ++tries); if (keep_going_p == ERANGE) error (ERANGE, ERANGE, "Failure to converge\n"); } fprintf (stdout, "%i iterations\n", tries); } /* for i < numparts */ params->freqs = params->freqs->next; } while (params->freqs->next != NULL); return 0; } inline double age_dep_pmate (double age_dep_t, unsigned int genot, double bp, double ba) { /* the probability of mating between these phenotypes */ /* the female preference depends on whether the female has the preference allele, the strength of preference (parameter bp) and the male phenotype (age_dep_t); if the female lacks the preference allele, then this will return 0, which is not quite accurate; it should return 1 */ return bits_isset (genot, CLOCI)? 1.0 - exp (-bp * age_dep_t) + ba: 1.0; } inline double age_dep_trait (int age, unsigned int genot, double by) { /* return the male trait, a function of the trait locus, age, the age-dependent scaling parameter (bx) and the males condition genotype */ double C; double T; /* get the male's condition genotype */ C = (double) bits_popcount (bits_extract (0, CLOCI, genot)); /* get his trait genotype */ T = bits_isset (genot, CLOCI + 1)? 1.0: 0.0; /* return the trait value */ return T * by * exp (age * C); } int age_dep_iterate (age_dep_params_t * data, unsigned int tries) { /* main driver routine */ /* number of bytes for female frequencies */ size_t geno = data->age_dep_data->geno; size_t genosize = geno * sizeof (double); /* female frequencies are equal to male frequencies at birth (before selection) */ double ffreqs[geno]; if (ffreqs == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); /* do not set! Use memcpy (we need to alter male frequencies (selection) without altering female frequencies) */ memmove (ffreqs, data->freqs->freqs[0], genosize); /* for (int i = 0; i < geno; i++) */ /* ffreqs[i] = data->freqs->freqs[0][i]; */ #ifdef PRMTABLE age_dep_pr_mfreqs (data); #endif /* PRMTABLE */ /* natural selection: */ age_dep_ns (data); /* normalized mating table with new frequencies */ age_dep_norm_mtable (ffreqs, data); #ifdef PRMTABLE age_dep_pr_mtable (data); #endif /* PRMTABLE */ double * newfreqs; /* mutate here */ /* i.e. get the new frequency of 0-year-olds using recombination; */ newfreqs = rec_mating (data->age_dep_data); /* return block */ { if (sim_stop_ck (data->freqs->freqs[0], newfreqs, GENO, TOL) == 0) { /* if we have converged, stop the iterations and handle the data */ age_dep_sim_out (data, stdout); return 0; } else if (tries > MAXTRIES) return ERANGE; else { /* advance generations */ for (int j = age_max - 1; j < 0; j--) memmove (data->freqs->freqs[j], data->freqs->freqs[j-1], genosize); /* advance the first age-class */ memmove (data->freqs->freqs[0], newfreqs, genosize); return 1; } } } void age_dep_ns (age_dep_params_t * data) { /* calculate the new frequency of genotypes given additive fitness and selection coefficient s */ size_t geno = data->age_dep_data->geno; double w[geno]; double wbar, dtheta, ttheta, dcond, tcond; double t, cond; /* fitness parameters */ double mu, nu; mu = data->wparams[0]; nu = data->wparams[1]; /* calculate fitness */ for (int j = 0; j < age_max; j++) { int i; for (i = 0; i < geno; i++) { /* calculate male trait: */ t = age_dep_trait(j, i, data->by); /* calculate condition: */ cond = (double) bits_popcount (bits_extract(0, CLOCI, i)); /* trait-based fitness term */ dtheta = data->theta - t; ttheta = (dtheta * dtheta) / (2.0 * nu * nu); /* condition-based fitness term */ dcond = CLOCI - cond; tcond = (dcond * dcond) / (2.0 * mu * mu); /* calculate male fitness */ w[i] = 1 + exp(-tcond) - exp(-ttheta); } /* calculate mean fitness */ /* as long as we calculate wbar before altering any values of freqs[], we're safe */ wbar = gen_mean (data->freqs->freqs[j], w, geno); for (i = 0; i < geno; i++) data->freqs->freqs[j][i] = (data->freqs->freqs[j][i] * w[i]) / wbar; } } void age_dep_norm_mtable (double * ffreqs, age_dep_params_t * params) { /* this function produces a single mating table that forms the input for recombination () */ /* i is female genotype; j is male genotype; k is male age */ int i,j,k; double norm_denom; double trait; size_t geno = params->age_dep_data->geno; for (i = 0; i < geno; i++) { double norm_mtable[geno]; /* initialize the denominator: */ norm_denom = 0.0; /* find the probability of mating and add it to the denominator */ for (j = 0; j < geno; j++) { /* initialize entry: */ norm_mtable[j] = 0.0; for (k = 0; k < age_max; k++) { trait = age_dep_trait (k, j, params->by); norm_mtable[j] += age_dep_pmate (trait, i, params->bp, params->ba) * (params->freqs->freqs)[k][j]; } norm_denom += norm_mtable[j]; } /* now calculate entry (i,j) */ for (j = 0; j < geno; j++) params->age_dep_data->mtable[i][j] = (ffreqs[i] * norm_mtable[j]) / norm_denom; } } My current suspicion is the array newfreqs: I can't memmove, memcpy or assign a stack variable then hope it will persist, can I? rec_mating() returns double *.

    Read the article

  • How to make Processes Run Parallel in Erlang?

    - by Ankit S
    Hello, startTrains() -> TotalDist = 100, Trains = [trainA,trainB ], PID = spawn(fun() -> train(1,length(Trains)) end), [ PID ! {self(),TrainData,TotalDist} || TrainData <- Trains], receive {_From, Mesg} -> error_logger:info_msg("~n Mesg ~p ~n",[Mesg]) after 10500 -> refresh end. so, I created Two Processes named trainA, trainB. I want to increment these process by 5 till it gets 100. I made different processes to make each of the train (process) increments its position parallely. But I was surprised to get the output sequentially i.e process trainA ends then process trainB starts. But I want to increment themselves at simultaneously. I want to run processes like this trainA 10 trainB 0 trainA 15 trainB 5 .... trainA 100 trainB 100 but I m getting trainA 0 .... trainA 90 trainA 95 trainA 100 trainA ends trainB 0 trainB 5 trainB 10 ..... trainB 100 How to make the processes run parallel/simultaneously? Hope you get my Q's. Please help me.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Differences between iPhone/iPod Simulator and Devices

    - by Allisone
    Hi, since I started iPhone/iPod Development I have come across some differences between how the simulator and how real device react. Maybe I will come across some other differences I will have to figure out as well, maybe other people haven't met these problems here (YET) and can profit from the knowledge, and maybe you know some problems/differences that you would have been happy to know about earlier before you spent several hours or days figuring out what the heck is going on. So here is what I came across. Simulator is not case sensitive, Devices are case sensitive. This means a default.png or Icon.png will work in simulator, but not on a device where they must be named Default.png and icon.png (if it's still not working read this answer) Simulator has different codecs to play audio and video If you use f.e. MPMoviePlayerController you might play certain video on the simulator while on the device it won't work (use Handbrake-presets-iPhone & iPod Touch to create playable videos for Simulator and Device). If you play audio with AudioServicesPlaySystemSound(&soundID) you might here the sound on simulator but not an a device. (use Audacity to open your soundfile, export as wav and run afconvert -f caff -d LEI16@44100 -c 1 audacity.wav output.caf in terminal) Also there is this flickering on second run problem which can be resolved with an playerViewCtrl.initialPlaybackTime = -1.0; either on the end of playing or before each beginning. Simulator is mostly much faster cause it doesn't simulate the hardware but uses Mac resources, therefore f.e. sio2 Apps (OpenGL,OpenAL,etc. framework) run much better on simulator, well everything that uses more resources will run visibly better in simulator than on device. I hope we can add some more to this.

    Read the article

  • Ideal Multi-Developer Lamp Stack?

    - by devians
    I would like to build an 'ideal' lamp development stack. Dual Server (Virtualised, ESX) Apache / PHP on one, Databases (MySQL, PgSQL, etc) on the other. User (Developer) Manageable mini environments, or instance. Each developer instance shares the top level config (available modules and default config etc) A developer should have control over their apache and php version for each project. A developer might be able to change minor settings, ie magicquotes on for legacy code. Each project would determine its database provider in its code The idea is that it is one administrate-able server that I can control, and provide globally configured things like APC, Memcached, XDebug etc. Then by moving into subsets for each project, i can allow my users to quickly control their environments for various projects. Essentially I'm proposing the typical system of a developer running their own stack on their own machine, but centralised. In this way I'd hope to avoid problems like Cross OS code problems, database inconsistencies, slightly different installs producing bugs etc. I'm happy to manage this in custom builds from source, but if at all possible it would be great to have a large portion of it managed with some sort of package management. We typically use CentOS, so yum? Has anyone ever built anything like this before? Is there something turnkey that is similar to what I have described? Are there any useful guides I should be reading in order to build something like this?

    Read the article

  • Formatting the parent and child nodes of a Treeview that is populated by a XML file

    - by Marina
    Hello Everyone, I'm very new to xml so I hope I'm not asking any silly question here. I'm currently working on populating a treeview from an XML file that is not hierarchically structured. In the xml file that I was given the child and parent nodes are defined within the attributes of the item element. How would I be able to utilize the attributes in order for the treeview to populate in the right hierarchical order. (Example Mary Jane should be a child node of Peter Smith). At present all names are under one another. root <item parent_id="0" id="1"><content><name>Peter Smith</name></content></item> <item parent_id="1" id="2"><content><name>Mary Jane</name></content></item> <item parent_id="1" id="7"><content><name>Lucy Lu</name></content></item> <item parent_id="2" id="3"><content><name>Informatics Team</name></content></item> <item parent_id="3" id="4"><content><name>Sandy Chu</name></content></item> <item parent_id="4" id="5"><content><name>John Smith</name></content></item> <item parent_id="5" id="6"><content><name>Jane Smith</name></content></item> /root Thank you for all of your help, Marina

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Any good tutorials or resources for learning how to design a scalable and "component" based game 'fr

    - by CodeJustin.com
    In short I'm creating a 2D mmorpg and unlike my last "mmo" I started developing I want to make sure that this one will scale well and work well when I want to add new in-game features or modify existing ones. With my last attempt with an avatar chat within the first few thousand lines of code and just getting basic features added into the game I seen my code quality lowering and my ability to add new features or modify old ones was getting lower too as I added more features in. It turned into one big mess that some how ran, lol. This time I really need to buckle down and find a design that will allow me to create a game framework that will be easy to add and remove features (aka things like playing mini-games within my world or a mail system or buddy list or a new public area with interactive items). I'm thinking that maybe a component based approach MIGHT be what I'm looking for but I'm really not sure. I have read documents on mmorpg design and 2d game engine architecture but nothing really explained a way of designing a game framework that will basically let me "plug-in" new features into the main game and use the resources of the main game without changing much within my 'main game code'. Hope someone understands what I mean, any help will is appreciated.

    Read the article

  • video streaming over http in blackberry

    - by ysnky
    hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

    Read the article

  • How to delete duplicate records in MySQL by retaining those fields with data in the duplicate item b

    - by NJTechGuy
    I have few thousands of records with few 100 fields in a MySQL Table. Some records are duplicates and are marked as such. Now while I can simply delete the dupes, I want to retain any other possible valuable non-null data which is not present in the original version of the record. Hope I made sense. For instance : a b c d e f key dupe -------------------- 1 d c f k l 1 x 2 g h j 1 3 i h u u 2 4 u r t 2 x From the above sample table, the desired output is : a b c d e f key dupe -------------------- 2 g c h k j 1 3 i r h u u 2 If you look at it closely, the duplicate is determined by using the key (it is the same for 2 records, so the one that has an 'x' for dupe field is the one to be deleted by retaining some of the fields from the dupe (like c, e values for key 1). Please let me know if you need more info about this puzzling problem. Thanks a tonne! p.s : If it is not possible using MySQL, a PERL/Python script sample would be awesome! Thanks!

    Read the article

  • How do I 'addChild' an DisplayObject3d from another class? (Papervision3d)

    - by Sandor
    Hi All Im kind of new in the whole papervision scene. For a school assignment I'm making a panorama version of my own room using a cube with 6 pictures in it. It created the panorama, it works great. But now I want to add clickable objects in it. One of the requirements is that my code is OOP focused. So that's what I am trying right now. Currently I got two classes - Main.as (Here i make the panorama cube as the room) - photoWall.as (Here I want to create my first clickable object) Now my problem is: I want to addChild a clickable object from photoWall.as to my panorama room. But he doesn't show it? I think it has something to do with the scenes. I use a new scene in Main.as and in photoWall.as. No errors or warnings are reported This is the piece in photoWall.as were I want to addChild my object (photoList): private function portret():void { //defining my material for the clickable portret var material : BitmapFileMaterial = new BitmapFileMaterial('images/room.jpg'); var material_list : MaterialsList = new MaterialsList( { front: material, back: material } ); // I don't know if this is nessecary? that's my problem scene = new Scene3D(); material.interactive = true; // make the clickable object as a cube var photoList : DisplayObject3D = new Cube(material_list, 1400, 1400, 1750, 1, 4, 4, 4); // positioning photoList.x = -1400; photoList.y = -280; photoList.z = 5000; //mouse event photoList.addEventListener( InteractiveScene3DEvent.OBJECT_CLICK, onPress); // this is my problem! I cannot see 'photoList' within my scene!!! scene.addChild(photoList); // trace works, so the function must be loaded. trace('function loaded'); } Hope you guys can help me out here. Would really be great! Thanks, Sandor

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • Python: How to execute a SQL file or command

    - by Mestika
    Hi, I have this Python script: import sys import getopt import timeit import random import os import re import ibm_db import time from string import maketrans runs=5 queries=50 file = open("results.txt", "a") for r in range(5): print "Run %s\n" % r os.system("python reads.py -r1 -pquery1.sql -q50 -sespec") file.write('END QUERY READ 01') file.close() os.system("python query_read_02.py") Everything here is working, it is creating the results.txt file, it run the os.system("python reads.py...") file and that file is doing everything it's suppose to, but the problem comes when go and run the query_read_02.py file. In this file, it should execute a SQL command or a SQL file on my database, so I can create an index and see what the performance of that input is, but how do i do it? I create the connection to the database in the reads.py file, but it's hard to create the queries in there because I doesn't keep track of which file it has reached, it just execute commands from what the parameters are. I hope I've explained myself clear enough, otherwise please let me know. I just want to execute a SQL command or file which each query_read_0x.py file. Sincerely Mestika

    Read the article

  • AS3 microphone recording/saving works, in-flash PCM playback double speed

    - by Lowgain
    I have a working mic recording script in AS3 which I have been able to successfully use to save .wav files to a server through AMF. These files playback fine in any audio player with no weird effects. For reference, here is what I am doing to capture the mic's ByteArray: (within a class called AudioRecorder) public function startRecording():void { _rawData = new ByteArray(); _microphone.addEventListener(SampleDataEvent.SAMPLE_DATA, _samplesCaptured, false, 0, true); } private function _samplesCaptured(e:SampleDataEvent):void { _rawData.writeBytes(e.data); } This works with no problems. After the recording is complete I can take the _rawData variable and run it through a WavWriter class, etc. However, if I run this same ByteArray as a sound using the following code which I adapted from the adobe cookbook: (within a class called WavPlayer) public function playSound(data:ByteArray):void { _wavData = data; _wavData.position = 0; _sound.addEventListener(SampleDataEvent.SAMPLE_DATA, _playSoundHandler); _channel = _sound.play(); _channel.addEventListener(Event.SOUND_COMPLETE, _onPlaybackComplete, false, 0, true); } private function _playSoundHandler(e:SampleDataEvent):void { if(_wavData.bytesAvailable <= 0) return; for(var i:int = 0; i < 8192; i++) { var sample:Number = 0; if(_wavData.bytesAvailable > 0) sample = _wavData.readFloat(); e.data.writeFloat(sample); } } The audio file plays at double speed! I checked recording bitrates and such and am pretty sure those are all correct, and I tried changing the buffer size and whatever other numbers I could think of. Could it be a mono vs stereo thing? Hope I was clear enough here, thanks!

    Read the article

  • rename files with the same name

    - by snorpey
    Hi. I use the following function to rename thumbnails. For example, if I upload a file called "image.png" to an upload folder, and this folder already has a file named "image.png" in it, the new file automatically gets renamed to "image-copy-1.png". If there also is a file called "image-copy-1.png" it gets renamed to "image-copy-2.png" and so on. The following function returns the new filename. At least that's what it is supposed to do... The renaming doesn't seeem to work correctly, though. Sometimes it produces strange results, like: 1.png 1-copy-1.png 1-copy-2.png 1-copy-2-copy-1.png 1-copy-2-copy-3.png I hope you understand my problem, despite my description being somewhat complex... Can you tell me what went wrong here? (bonus question: Is regular expressions the right tool for doing this kind of stuff?) <?php function renameDuplicates($path, $file) { $fileName = pathinfo($path . $file, PATHINFO_FILENAME); $fileExtension = "." . pathinfo($path . $file, PATHINFO_EXTENSION); if(file_exists($path . $file)) { $fileCopy = $fileName . "-copy-1"; if(file_exists($path . $fileCopy . $fileExtension)) { if ($contains = preg_match_all ("/.*?(copy)(-)(\\d+)/is", $fileCopy, $matches)) { $copyIndex = $matches[3][0]; $fileName = substr($fileCopy, 0, -(strlen("-copy-" . $copyIndex))) . "-copy-" . ($copyIndex + 1); } } else { $fileName .= "-copy-1"; } } $returnValue = $fileName . $fileExtension; return $returnValue; }?>

    Read the article

  • CSS absolute DIV causing other absolute DIV problems

    - by Tim
    Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

    Read the article

  • Help me find an appropriate ruby/python parser generator

    - by Geo
    The first parser generator I've worked with was Parse::RecDescent, and the guides/tutorials available for it were great, but the most useful feature it has was it's debugging tools, specifically the tracing capabilities ( activated by setting $RD_TRACE to 1 ). I am looking for a parser generator that can help you debug it's rules. The thing is, it has to be written in python or in ruby, and have a verbose mode/trace mode or very helpful debugging techniques. Does anyone know such a parser generator ? EDIT: when I said debugging, I wasn't referring to debugging python or ruby. I was referring to debugging the parser generator, see what it's doing at every step, see every char it's reading, rules it's trying to match. Hope you get the point. BOUNTY EDIT: to win the bounty, please show a parser generator framework, and illustrate some of it's debugging features. I repeat, I'm not interested in pdb, but in parser's debugging framework. Also, please don't mention treetop. I'm not interested in it.

    Read the article

  • JAVASCRIPT changing on click

    - by Webby
    Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • How to scrape Google SERP based on copyright year?

    - by Michael Mao
    Hi all: I know there must be ways to do this sort of things. I am not pro in RoR or Python, not even an expert in PHP. So my solution tends to be quite dumb: It uses a FireFox add-on called imarcos to scrape the target urls from Google SERP, and use PHP to store info into the database. At the very core of my workaround there lies a problem: How to specifically find target urls based on their copyright year? I mean, something like "copyright 1998-2006" in the footer is to be considered a target, but my search results are not 100% accurate. I used the following url to search : http://www.google.com.au/#hl=en&q=inurl:.com.au+intext:copyright+1995..2007+--2008+--2009&start=0&cad=b&fp=6a8119b094529f00 It reads : search for pages that have .com.au in URL and a copyright range from 1995 to 2007 exclude the year of 2008 or 2009. Starting position is 0, of course the offset can be changed. I've already done a dummy list and honestly I am not pleased with the result. That's mostly because I cannot find a way to restrict search terms in the exact order as they are entered into the search url. copyright can appear in anywhere on page and doesn't necessarily before the years, that's the current story. Is there a more clear way to sort out this? Oh, almost forgot to say the client doesn't wanna spent too much in this - I cannot persuade him simply buy some cool software, unfortunately. I hope there is a way to use clever Google search operators or similar things to go around this issue. Many thanks in advance!

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

  • Prevent illegal behavior to the registered user

    - by Al Kush
    I am building a website in which this website will be focused on the publishing of novels. Every writers who publish their novels with us will get a royalty from us. And this royalty comes from the user or the reader who read the novel online in our website. When a user search for a novel and want to read that, they will click a link to the page which its content is that novel. The html page for each novels will have a session function that first will force them to login or register to make a payment such as with a credit-card or paypal before accessing that html page. My problem now is if the user has succesfully login and access the html page, I am afraid if the user will copy the content of the novel. Some disccussion out here How to Disable Copy Paste (Browser) have a solution to create it in Flash so that it can't be coppied-paste. But the I think, if the user who access it is a web developer like us they will try to find the path of the file from the link in the page source, and then they can steal it. For now I think it is enough I am explaining this. I hope anyone fully accept this problem (question) with a good idea to solve it.

    Read the article

  • Should the entity framework + self tracking entities be saving me time

    - by sipwiz
    I've been using the entity framework in combination with the self tracking entity code generation templates for my latest silverlight to WCF application. It's the first time I've used the entity framework in a real project and my hope was that I would save myself a lot of time and effort by being able to automatically update the whole data access layer of my project when my database schema changed. Happily I've found that to be the case, updating my database schema by adding a new table, changing column names, adding new columns etc. etc. can be propagated to my business object classes by using the update from database option on the entity framework model. Where I'm hurting is the CRUD operations within my WCF service in response to actions on my Silverlight client. I use the same self tracking entity framework business objects in my Silverlight app but I find I'm continually having to fight against problems such as foreign key associations not being handled correctly when updating an object or the change tracker getting confused about the state of an object at the Silverlight end and the data access operation within the WCF layer throwing a wobbly. It's got to a point where I have now spent more time dealing with this quirks than I have on my previous project where I used Linq-to-SQL as the starting point for rolling my own business objects. Is it just me being hopeless or is the self tracking entities approach something that should be avoided until it's more mature?

    Read the article

  • Java - Save video stream from Socket to File

    - by Alex
    I use my Android application for streaming video from phone camera to my PC Server and need to save them into file on HDD. So, file created and stream successfully saved, but the resulting file can not play with any video player (GOM, KMP, Windows Media Player, VLC etc.) - no picture, no sound, only playback errors. I tested my Android application into phone and may say that in this instance captured video successfully stored on phone SD card and after transfer it to PC played witout errors, so, my code is correct. In the end, I realized that the problem in the video container: data streamed from phone in MP4 format and stored in *.mp4 files on PC, and in this case, file may be incorrect for playback with video players. Can anyone suggest how to correctly save streaming video to a file? There is my code that process and store stream data (without errors handling to simplify): // getOutputMediaFile() returns a new File object DataInputStream in = new DataInputStream (server.getInputStream()); FileOutputStream videoFile = new FileOutputStream(getOutputMediaFile()); int len; byte buffer[] = new byte[8192]; while((len = in.read(buffer)) != -1) { videoFile.write(buffer, 0, len); } videoFile.close(); server.close(); Also, I would appreciate if someone will talk about the possible "pitfalls" in dealing with the conservation of media streams. Thank you, I hope for your help! Alex.

    Read the article

  • How to test a DAO with JPA implementation ?

    - by smallufo
    Hi I came from the Spring camp , I don't want to use Spring , and am migrating to JavaEE6 , But I have problem testing DAO + JPA , here is my simplified sample : public interface PersonDao { public Person get(long id); } This is a very basic DAO , because I came from Spring , I believe DAO still have it value , so I decided to add a DAO layer . public class PersonDaoImpl implements PersonDao , Serializable { @PersistenceContext(unitName = "test", type = PersistenceContextType.EXTENDED) EntityManager entityManager ; public PersonDaoImpl() { } @Override public Person get(long id) { return entityManager .find(Person.class , id); } } This is a JPA-implemented DAO , I hope the EE container or the test container able to inject the EntityManager. public class PersonDaoImplTest extends TestCase { @Inject protected PersonDao personDao; @Override protected void setUp() throws Exception { //personDao = new PersonDaoImpl(); } public void testGet() { System.out.println("personDao = " + personDao); // NULL ! Person p = personDao.get(1L); System.out.println("p = " + p); } } This is my test file . OK , here comes the problem : Because JUnit doesn't understand @javax.inject.Inject , the PersonDao will not be able to injected , the test will fail. How do I find a test framework that able to inject the EntityManager to the PersonDaoImpl , and @Inject the PersonDaoImpl to the PersonDao of TestCase ? I tried unitils.org , but cannot find a sample like this , it just directly inject the EntityManagerFactory to the TestCast , not what I want ...

    Read the article

< Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >