Search Results

Search found 13293 results on 532 pages for 'small ticket'.

Page 199/532 | < Previous Page | 195 196 197 198 199 200 201 202 203 204 205 206  | Next Page >

  • Detect if selected element is an anchor on right click

    - by Yawn
    I'm writing a small firefox addon to grab urls and send them to a site. What I want to do is be able to right click on a link (but not have to actually highlight it) and be able to click send and the links href value is grabbed and sent. The bit I'm having trouble with is detecting if the selected element is an anchor and grabbing it's href. Many thanks for any help given :)

    Read the article

  • java array manipulation

    - by sachin
    Hi, I'm a beginner in java. I want the logic of the small program. I have two arrays array = {a1,a2,a3,a4,a5,,,,,,,,,an} and array2 = {b1,b2,b3,b4,,,,,,,,,,,bn} I want string as: a1b1,a2a3b2b3,a4a5a6b4b5b6,..........an Please tell me what will be the logic.

    Read the article

  • Storing and managing video files

    - by Ajay
    What approach is considered to be the best to store and manage video files? As databases are used for small textual data, are databases good enough to handle huge amounts of video/audio data? Are databases, the formidable solution? Apart from size of hard disk space required for centrally managing video/audio/image content, what are the requirements of hosting such a server?

    Read the article

  • Multicore programming: what's necessary to do it?

    - by Casey
    I have a quadcore processor and I would really like to take advantage of all those cores when I'm running quick simulations. The problem is I'm only familiar with the small Linux cluster we have in the lab and I'm using Vista at home. What sort of things do I want to look into for multicore programming with C or Java? What is the lingo that I want to google? Thanks for the help.

    Read the article

  • Why is a c++ reference considered safer than a pointer?

    - by anand.arumug
    When the c++ compiler generates very similar assembler code for a reference and pointer, why is using references preferred (and considered safer) compared to pointers? I did see Difference between pointer variable and reference variable in C++ which discusses the differences between them. EDIT-1: I was looking at the assembler code generated by g++ for this small program: int main(int argc, char* argv[]) { int a; int &ra = a; int *pa = &a; }

    Read the article

  • Python for statement giving an Invalid Syntax error with list

    - by Cold Diamondz
    I have some code in which is throwing an error (I'm using repl.it) import random students = ['s1:0','s2:0','s3:0'] while True: print'\n'*50 print'Ticket Machine'.center(80) print'-'*80 print'1. Clear Student Ticket Values'.center(80) print'2. Draw Tickets'.center(80) menu = raw_input('-'*80+'\nChoose an Option: ') if menu == '1': print'\n'*50 print'CLEARED!' students = ['s1:0','s2:0','s3:0'] raw_input('Press enter to return to the main menu!') elif menu == '2': tickets = [] print'\n'*50 times = int(raw_input('How many tickets to draw? ') for a in students: for i in range(a.split(':')[1]): tickets.append(a.split(':')[0]) for b in range(1,times+1): print str(b) + '. ' + random.choice(tickets) else: print'\n'*50 print'That was not an option!' raw_input('Press enter to return to the main menu!') But it is throwing this error: File "<stdin>", line 19 for a in students: ^ SyntaxError: invalid syntax I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.

    Read the article

  • Redirect question using mod_rewrite (no extensions - root of site)

    - by alex
    Hi, I'm having a small problem with mod_rewrite I have the following in my .htacces: Options +FollowSymlinks RewriteEngine on RewriteRule ^(.+)\.htm$ index.php?name=$1 [NC] This is my index.php file: <?php echo $_GET['name]; ?> This works great for the following url: www.mySite.com/this is an example.htm this would display "this is an example" What i'm trying to do however, is get it to do the same, without the .htm extension: for example: www.mySite.com/this is an example Any ideas? (dont think it's relevant but i'm using xampp to test this)

    Read the article

  • PHPMailer - what sending method is most appropriate?

    - by Stomped
    Hello. I need to use PHPMailer to send emails out for the following reasons: small lists (less then 500) password resets general notifications, 100ish emails at a time And PHPMailer gives me the option to send via mail(), sendmail, or SMTP. Is there any reason to prefer one of these methods over the other? I don't know enough about email services in general to make an informed decision.

    Read the article

  • Form validation with optional File Upload field callback

    - by MotiveKyle
    I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

    Read the article

  • Changing background image of a Drupal page based on user's selection...?

    - by Sambo
    Hi I'm trying to give my users the functionality to change what the background image used on a page is. The list of background images will be a small number that won't really change. I thought I could add a few Taxonomy terms...one for each background type...then apply a class to the body tag when the page is viewed. Does this sound feasible and if so how would I go about doing it? Thanks Sam

    Read the article

  • Iframe covers navigation bar, needs close, open to fix?

    - by kuyanatan
    I have a small webpage with a form, iframe-d in. When I put invalid input inside the form, the iframe covers up the navigation bar and I can't get the navigation bar back without closing and opening the page again. Here is where I am (temporarily) hosting the webpage: dl.dropbox.com/u/1144456/rlp/v2/demo.html the css stylesheet: dl.dropbox.com/u/1144456/rlp/v2/contact-us.htm To recreate this problem, click the last tab and just click submit.

    Read the article

  • Minimalist Wiki like script

    - by arthurprs
    I'm trying to find a simple wiki like script to setup a personal directory, browser favorites simply doesn't do anymore and i have lots of small files on my flash drive Desired features file upload not bloated works on a common webhost (aka php) Thanks in advance

    Read the article

  • What is the most efficient procedure for implementing a sortable ajax list on the backend?

    - by HenryL
    The most common method is to assign a sequential order field for each item in the list and do an update that maintains the sequence with every ajax sort operation. Unfortunately, this requires an update to each item of the list every time someone sorts. This is fine for small lists, but what's the best way to implement sorting for larger lists that are constantly updated? I am looking for something that minimizes DB IO.

    Read the article

  • I'm tired of JButtons, how can I make a nicer GUI in java ?

    - by Jules Olléon
    So far I've only build "small" graphical applications, using swing and JComponents as I learned at school. Yet I can't bear ugly JButtons anymore. I've tried to play with the different JButton methods, like changing colors, putting icons etc. but I'm still not satisfied. How do you make a nicer GUI in java ? I'm looking for not-too-heavy alternatives (like, without big frameworks or too complicated libraries).

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Amazon Web Services Apache Server

    - by Samnsparky
    I am trying to get a feel for the costs imposed by running apache on AWS continually. Assuming that the service is scarcely used, does anyone know how many cpu hours that would eat up in a month just by sitting there and running? I understand that this is slightly impractical but I am trying to figure out what the cost of entry is to deploy an application on this platform (as compared to GAE). I suspect it to be small but I would like to know.

    Read the article

  • Redirection in Rails

    - by Cyborgo
    Hi, I have a small question regarding rails. I have a search controller which searches for a name in database, if found shows the details about it or else I am redirecting to the new name page. Is there anyway after redirection that the name searched for to automatically appear in the new form page? Thanks in advance.

    Read the article

  • How can I disable mouse click event system wide using C#?

    - by mazzzzz
    Hey guys, I have a laptop with a very sensitive touch pad, and wanted to code a small program that could block the mouse input when I was typing a paper or something. I didn't think it would be hard to do, considering everything I've seen on low-level hooks, but I was wrong (astounding, right?). I looked at a few examples, but the examples I've seen either block both keyboard and mouse, or just hide the mouse. Any help with this would be great.

    Read the article

< Previous Page | 195 196 197 198 199 200 201 202 203 204 205 206  | Next Page >