Search Results

Search found 44 results on 2 pages for 'slugs'.

Page 2/2 | < Previous Page | 1 2 

  • What programming langauge is this

    - by Hutch
    We're trying to script a cad program, and this is the example for controlling the date in our design slugs, but I don't even know what language it is to know what to do with it. ! LIBEDATE def &d$ &ret$ set &d$ = rstr(`/`,` `,#d$); set &ret$ = word(&d$,2),`/`,word(&d$,1),`/`,subs(word(&d$,3), -2, 2)

    Read the article

  • How to handle URLs with diacritic characters

    - by user359650
    I am wondering how to handle URLs which correspond to strings containing diacritic (á, u, ´...). I believe what we're seeing mostly are URLs where diacritic characters where converted to their closest ASCII equivalent, for instance Rånades på Skyttis i Ö-vik converted to ranades-pa-skyttis-i-o-vik. However depending on the corresponding language, such conversion might be incorrect. For instance in German, ü should be converted to ue and not just u, as seen with the below URL representing the Bayern München string as bayern-muenchen: http://www.bundesliga.de/en/liga/clubs/fc-bayern-muenchen/index.php However what I've also noticed, is that browsers can render non-ASCII characters when they are percent-encoded in the URL, which is the approach Wikipedia has chosen, for instance http://de.wikipedia.org/wiki/FC_Bayern_M%C3%BCnchen which is rendered as: Therefore I'm considering the following approach for creating URL slugs: -(1) convert strings while replacing non-ASCII characters to their recommended ASCII representation: Bayern München - bayern-muenchen -(2) also convert strings to percent encoding: Bayern München - bayern_m%C3%BCnchen -create a 301 redirect from version (1) to version (2) Version (1) URLs could be used for marketing purposes (e.g. mywebsite.com/bayern-muenchen) but the URLs that would end being displayed in the browser bar would be version (2) URLs (e.g. mywebsite.com/bayern-münchen). Can you foresee particular problems with this approach? (Wikipedia is not doing it and I wonder why, apart from the fact that they don't need to market their URLs)

    Read the article

  • 1-st level routes for multiple resources in Rails

    - by Leonid Shevtsov
    I have a simple SEO task. There's a City model and a Brand model, and I have to create 1st-level URLs for both (e.g. site.com/honda and site.com/boston). What's the preferred routing/controller combination to do this in Rails? I can only think of map.connect '/:id', :controller => 'catchall', :action => 'index' class CatchallController < ApplicationController def index if City.exists?(:slug => params[:id]) @city = City.find_by_slug!(params[:id]) render 'cities/show' else @brand = Brand.find_by_slug!(params[:id]) render 'brands/show' end end end but it seems to be very un-Rails to put such logic into the controller. (Obviously I need to make sure that the slugs don't overlap in the models, that's done).

    Read the article

  • What are the possible reasons for App::import() not working?

    - by Julien Poulin
    I'm trying to implement a simple way to manage static pages in CakePhp, as described in this article. The problem I'm facing is that App::import() doesn't seem to import the required class in the routes.php file. The code is the following: App::import('Core','ClassRegistry'); $page = new StaticPage(); $slugs = $page->find('list', array( 'fields' => array('StaticPage.slug'), 'order' => 'StaticPage.slug DESC' )); I'm getting the error: Fatal error: Class 'StaticPage' not found in ... I just started CakePhp a few weeks ago and I guess I'm missing a simple thing here... I'm using CakePhp 1.3 and Php 5.2.42.

    Read the article

  • In what way does Wordpress rewrite page URLs?

    - by Mac Taylor
    Hey Recently I'm interested in post's structure of Wordpress. They use a table named (wp_posts) and in this table they saved 3 related fields such as : post_title post_name guid It's clear that they save title of each story in post_title field , and slugs in post_name , and full url of a post in guild filed . But where the hell, they rewrite these urls in way it appears in browsers : http://localhost/wordpress/about/ There is no htaccess rules for this ! I checked rewrite.php and didn't understand an inch ?! i need to create similar pages , what steps should i take !?

    Read the article

  • in what way wordpress rewrite pages

    - by Mac Taylor
    Hey Recently I'm interested in post's structure of worpress . They use a table named (wp_posts) and in this table they saved 3 related fields such as : post_title post_name guid It's clear that they save title of each story in post_title field , and slugs in post_name , and full url of a post in guild filed . But where the hell, they rewrite these urls in way it appears in browsers : http://localhost/wordpress/about/ There is no htaccess rules for this ! I checked rewrite.php and didn't understand an inch ?! If you were me , and u need to create such pages , what steps you would take !?

    Read the article

  • Best WordPress Shopping Cart & Ecommerce Plugins

    - by Edward
    A versatile WordPress Shopping Cart plugin can help you create a feature-rich online store on your WordPress-powered website or blog. Some are so advanced that you can get your store up and running in minutes. Some plugins allow you to take ecommerce to a next level with their high end customization tools. Here is a list of best WP shopping cart plugins available: Cart66 One of the best WordPress plugin with lots of features, great quality and ease of use. It accepts few more payment getways such as PayPal Website Payments Standard, PayPal Website Payments Professional, PayPal Express Checkout, eProcessing Network etc. It has flexible design options, recurring payments for subscriptions, memberships, and payment plans, Easy PCI Compliance – Safe and Secure. It is fast and efficient, one can sell digital and physical products and support is good. Price: Standard $49 & Professional $99 Details Download StorePress StorePress is a WordPress theme, which is fully coded. It comes with scripts that can change a WordPress blog into a veritable e-commerce virtual store. With this great premium WordPress theme, one can start affiliate stores, or promote affiliate products. Price: Single $59.99 & Developer License $119.99 Details Download WordPress eStore Plugin This shopping cart plugin comes with easy checkout, ease of design and use, automatic instant digital product delivery, Next Gen gallery integration, autoresponder integration etc. It is a lightweight shopping cart and allows multi site license. This plugin offers an amazingly comprehensive toolkit that will ensure your online shop is almost just plug-and-play. Price: $49.99 Details Download Shoppers Press Shoppers press is a premium cart for Word Press that comes with 20+ to choose from and 20+ built in payment gateways. It features one-click setups, personalized user accounts, easy management tools, detailed sales tracking, promotional options, a variety of product import tools, and many more features Price:$79 Details Download WordPress Shopping Cart plugin The WordPress Shopping Cart plugin by Tribulant quickly and seamlessly integrates an online shop with a fully functional shopping cart interface into any WordPress website. It has easy to use interface, which enables set up of multiple products and categorize and organizing them into multiple product categories. It also has many more attractive features. Price: $49.99 Details Download WP e-commerce WP e-commerce is a free full-featured shopping cart plugin for WordPress. It is a full featured shopping cart and boasts of easy checkout. It offers a wide range of features including SSL compatibility, customization and merchandising, integrated payment processing solutions including manual payment, Google Checkout and PayPal Payments, and email marketing. It is wordpress and social networking integrated. It is customizable by use of PHP template tag, wordpress shortcode and widgets. Details Download YAK for WordPress YAK is an open source shopping cart plugin for WordPress. It associates products with weblog entries (in other words, posts), so the post ID also becomes the product code. It supports both pages and posts as products, handles different types of product through categories. YAK supports downloadable products, so any e-books, plugins, or zip files you’re marketing can be easily purchased and dowloaded. Details Download Market Press It is another shopping cart full of many features. It offers following features such as assign categories and tags to products to make them easy to find, stock tracking with alerts, order management/alerts, fully customizable email messages, full support for most major currencies, fully customizable store urls/slugs, customers can checkout without being a site user etc. Expensive, but good option for those who can afford it. Price: $17.42/month Details Download Shopp It is an excellent shopping cart plugin for Word Press. This plugin is extremely easy to install and use. It has a cleaner interface. The customer support is good. Use can easily customize the look of the cart by using its amazing features. Price: $55 Details Download Related posts:8 PHP Shopping Cart Software for Reliable Ecommerce Solution Shopping Cart SEO 8 Free Open Source Shopping Carts

    Read the article

  • RMagic Error in rails, with AM Charts

    - by Elliot
    Hi Everyone, I'm using AMCharts and rails. AMCharts uses the Image Magic lib to export an image of the chart. In rails this is done with the gem, RMagic. In a controller this is implemented with the following controller method: def export width = params[:width].to_i height = params[:height].to_i data = {} img = Magick::Image.new(width, height) height.times do |y| row = params["r#{y}"].split(',') row.size.times do |r| pixel = row[r].to_s.split(':') pixel[0] = pixel[0].to_s.rjust(6, '0') if pixel.size == 2 pixel[1].to_i.times do (data[y] ||= []) << pixel[0] end else (data[y] ||= []) << pixel[0] end end width.times do |x| img.pixel_color(x, y, "##{data[y][x]}") end end img.format = "PNG" send_data(img.to_blob , :disposition => 'inline', :type => 'image/png', :filename => "chart.png?#{rand(99999999).to_i}") end When the controller is accessed however, I receive this error in the page: The change you wanted was rejected. Maybe you tried to change something you didn't have access to. And this error in the logs (its running on heroku btw): ActionController::InvalidAuthenticityToken (ActionController::InvalidAuthenticityToken): /home/heroku_rack/lib/static_assets.rb:9:in `call' /home/heroku_rack/lib/last_access.rb:25:in `call' /home/heroku_rack/lib/date_header.rb:14:in `call' thin (1.0.1) lib/thin/connection.rb:80:in `pre_process' thin (1.0.1) lib/thin/connection.rb:78:in `catch' thin (1.0.1) lib/thin/connection.rb:78:in `pre_process' thin (1.0.1) lib/thin/connection.rb:57:in `process' thin (1.0.1) lib/thin/connection.rb:42:in `receive_data' eventmachine (0.12.6) lib/eventmachine.rb:240:in `run_machine' eventmachine (0.12.6) lib/eventmachine.rb:240:in `run' thin (1.0.1) lib/thin/backends/base.rb:57:in `start' thin (1.0.1) lib/thin/server.rb:150:in `start' thin (1.0.1) lib/thin/controllers/controller.rb:80:in `start' thin (1.0.1) lib/thin/runner.rb:173:in `send' thin (1.0.1) lib/thin/runner.rb:173:in `run_command' thin (1.0.1) lib/thin/runner.rb:139:in `run!' thin (1.0.1) bin/thin:6 /usr/local/bin/thin:20:in `load' /usr/local/bin/thin:20 Rendering /disk1/home/slugs/149903_609c236_eb4f/mnt/public/422.html (422 Unprocessable Entity) Anyone have any idea what's going on here?

    Read the article

  • Typus not working in Heroku (error 500) what im doing wrong?

    - by Victor P
    Have someone used Typus (admin plugin for rails) in Heroku? http://intraducibles.com/projects/typus/install I follow the instructions and in my local machine (Rails 2.3.5) is working fine, but when I deploy to Heroku it crashes. What Im doing wrong? the log: Logfile created on Mon Mar 29 18:14:06 -0700 2010 Processing TypusController#dashboard (for 190.196.113.93 at 2010-03-29 18:14:07) [GET] Parameters: {"action"=>"dashboard", "controller"=>"typus"} ActiveRecord::StatementInvalid (PGError: ERROR: relation "typus_users" does not exist : SELECT a.attname, format_type(a.atttypid, a.atttypmod), d.adsrc, a.attnotnull FROM pg_attribute a LEFT JOIN pg_attrdef d ON a.attrelid = d.adrelid AND a.attnum = d.adnum WHERE a.attrelid = '"typus_users"'::regclass AND a.attnum > 0 AND NOT a.attisdropped ORDER BY a.attnum ): vendor/plugins/typus/app/controllers/typus_controller.rb:128:in `verify_typus_users_table_schema' /home/heroku_rack/lib/static_assets.rb:9:in `call' /home/heroku_rack/lib/last_access.rb:25:in `call' /home/heroku_rack/lib/date_header.rb:14:in `call' thin (1.0.1) lib/thin/connection.rb:80:in `pre_process' thin (1.0.1) lib/thin/connection.rb:78:in `catch' thin (1.0.1) lib/thin/connection.rb:78:in `pre_process' thin (1.0.1) lib/thin/connection.rb:57:in `process' thin (1.0.1) lib/thin/connection.rb:42:in `receive_data' eventmachine (0.12.6) lib/eventmachine.rb:240:in `run_machine' eventmachine (0.12.6) lib/eventmachine.rb:240:in `run' thin (1.0.1) lib/thin/backends/base.rb:57:in `start' thin (1.0.1) lib/thin/server.rb:150:in `start' thin (1.0.1) lib/thin/controllers/controller.rb:80:in `start' thin (1.0.1) lib/thin/runner.rb:173:in `send' thin (1.0.1) lib/thin/runner.rb:173:in `run_command' thin (1.0.1) lib/thin/runner.rb:139:in `run!' thin (1.0.1) bin/thin:6 /usr/local/bin/thin:20:in `load' /usr/local/bin/thin:20 Rendering /disk1/home/slugs/157361_3469154_60b1/mnt/public/500.html (500 Internal Server Error)

    Read the article

  • Heroku Rails Internal Server Error

    - by Ryan Max
    Hello. I got a 500 Internal Sever error when I try to deploy my rails app on heroku. It works fine on my local machine, so i'm not sure what's wrong here. Seems to be something with the "sessions" on the home controller. Here is my log: ==> production.log <== # Logfile created on Sun May 09 17:35:59 -0700 2010 Processing HomeController#index (for 76.169.212.8 at 2010-05-09 17:36:00) [GET] ActiveRecord::StatementInvalid (PGError: ERROR: relation "sessions" does not ex ist : SELECT a.attname, format_type(a.atttypid, a.atttypmod), d.adsrc, a .attnotnull FROM pg_attribute a LEFT JOIN pg_attrdef d ON a.attrelid = d.adrelid AND a.attnum = d.adnum WHERE a.attrelid = '"sessions"'::regclass AND a.attnum > 0 AND NOT a.attisdropped ORDER BY a.attnum ): lib/authenticated_system.rb:106:in `login_from_session' lib/authenticated_system.rb:12:in `current_user' lib/authenticated_system.rb:6:in `logged_in?' lib/authenticated_system.rb:35:in `authorized?' lib/authenticated_system.rb:53:in `login_required' /home/heroku_rack/lib/static_assets.rb:9:in `call' /home/heroku_rack/lib/last_access.rb:25:in `call' /home/heroku_rack/lib/date_header.rb:14:in `call' thin (1.2.7) lib/thin/connection.rb:76:in `pre_process' thin (1.2.7) lib/thin/connection.rb:74:in `catch' thin (1.2.7) lib/thin/connection.rb:74:in `pre_process' thin (1.2.7) lib/thin/connection.rb:57:in `process' thin (1.2.7) lib/thin/connection.rb:42:in `receive_data' eventmachine (0.12.10) lib/eventmachine.rb:256:in `run_machine' eventmachine (0.12.10) lib/eventmachine.rb:256:in `run' thin (1.2.7) lib/thin/backends/base.rb:57:in `start' thin (1.2.7) lib/thin/server.rb:156:in `start' thin (1.2.7) lib/thin/controllers/controller.rb:80:in `start' thin (1.2.7) lib/thin/runner.rb:177:in `send' thin (1.2.7) lib/thin/runner.rb:177:in `run_command' thin (1.2.7) lib/thin/runner.rb:143:in `run!' thin (1.2.7) bin/thin:6 /usr/local/bin/thin:20:in `load' /usr/local/bin/thin:20 Rendering /disk1/home/slugs/155328_f2d3c00_845e/mnt/public/500.html (500 Interna l Server Error) And here is my home_controller.rb class HomeController < ApplicationController before_filter :login_required def index @user = current_user @user.profile ||= Profile.new @profile = @user.profile end end Does it have something the way my routes are set up? Or is it my authentication? (I am using restful authentication with Bort)

    Read the article

  • How to setup prawn on heroku when installed as a git submodule

    - by brad
    I have a rails app that I am trying to deploy to heroku. This app generates pdfs using prawn. I installed prawn as a git submodule rather than as a gem as this is what is recommended on the prawn website (here). This has not worked well with heroku so far though. As stated on heroku's application constraints page submodules are not supported so I followed their instructions to track the submodule in the main project and tried again. This has not worked and when I access my application I get the following error: App failed to start An error happened during the initialization of your app. This may be due to a typo, wrong number of arguments, or calling a function that doesn’t exists. Check the stack trace below for specific details. Make sure the app is working locally in production mode, by running it with RAILS_ENV (for Rails apps) or RACK_ENV (for Sinatra or other rack apps) set to production. e.g. RAILS_ENV=production script/server. Original Error /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:in `gem_original_require': /disk1/home/slugs/208590_03c9c22_67f5/mnt/app/controllers/invoices_controller.rb:37: syntax error, unexpected ')' (SyntaxError) ).to_pdf(@invoice) (and then a whole lot more that I'll spare you from) The .to_pdf function described in the last line is called in a controller in exactly the way described in the prawn how-to that I linked to above so my interpretation of the error message is that prawn is not being installed/detected. Does anyone know how I can address this? I'm new to heroku so have little idea how to approach this. Is the submodule approach for prawn dead in the water from the get-go? Do I need to install it as a gem instead. I'd rather keep it as a submodule just because that works for now and I don't want to break it.

    Read the article

  • Rails Heroku Migrate Unknown Error

    - by Ryan Max
    Hello. I am trying to get my app up and running on heroku. However once I go to migrate I get the following error: $ heroku rake db:migrate rake aborted! An error has occurred, this and all later migrations canceled: 530 5.7.0 Must issue a STARTTLS command first. bv42sm676794ibb.5 (See full trace by running task with --trace) (in /disk1/home/slugs/155328_f2d3c00_845e/mnt) == BortMigration: migrating ================================================= -- create_table(:sessions) -> 0.1366s -- add_index(:sessions, :session_id) -> 0.0759s -- add_index(:sessions, :updated_at) -> 0.0393s -- create_table(:open_id_authentication_associations, {:force=>true}) -> 0.0611s -- create_table(:open_id_authentication_nonces, {:force=>true}) -> 0.0298s -- create_table(:users) -> 0.0222s -- add_index(:users, :login, {:unique=>true}) -> 0.0068s -- create_table(:passwords) -> 0.0123s -- create_table(:roles) -> 0.0119s -- create_table(:roles_users, {:id=>false}) -> 0.0029s I'm not sure exactly what it means. Or really what it means at all. Could it have to do with my Bort installation? I did remove all the open-id stuff from it. But I never had any problems with my migrations locally. Additionally on Bort the Restful Authentication uses my gmail stmp to send confirmation emails...all the searches on google i do on STARTTLS have to do with stmp. Can someone point me in the right direction?

    Read the article

  • How to redirect a URL with GET variables in routes.rb without Rails stripping out the variable first?

    - by Michael Hopkins
    I am building a website in Rails to replace an existing website. In routes.rb I am trying to redirect some of the old URLs to their new equivalents (some of the URL slugs are changing so a dynamic solution is not possible.) My routes.rb looks like this: match "/index.php?page=contact-us" => redirect("/contact-us") match "/index.php?page=about-us" => redirect("/about-us") match "/index.php?page=committees" => redirect("/teams") When I visit /index.php?page=contact-us I am not redirected to /contact-us. I have determined this is because Rails is removing the get variables and only trying to match /index.php. For example, If I pass /index.php?page=contact-us into the below routes I will be redirected to /foobar: match "/index.php?page=contact-us" => redirect("/contact-us") match "/index.php?page=about-us" => redirect("/about-us") match "/index.php?page=committees" => redirect("/teams") match "/index.php" => redirect("/foobar") How can I keep the GET variables in the string and redirect the old URLs the way I'd like? Does Rails have an intended mechanism for this?

    Read the article

  • action mailer gem and tlsmail gem not working in heroku after GIT PUSH HEROKU

    - by user163352
    I'm using heroku as my host..It was working fine. Then I installed action_mailer_tls and tlsmail. Then I comitted it and pushed it heroku.. After that I got error in myapp.heroku.com. The error is /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:in gem_original_require': no such file to load -- smtp_tls (MissingSourceFile) from /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:inrequire' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.3/lib/active_support/dependencies.rb:158:in require' from /disk1/home/slugs/154378_e47562d_b59c/mnt/config/initializers/smtp_gmail.rb:3 from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.3/lib/active_support/dependencies.rb:147:inload_without_new_constant_marking' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.3/lib/active_support/dependencies.rb:147:in load' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.3/lib/initializer.rb:622:inload_application_initializers' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.3/lib/initializer.rb:621:in each' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.3/lib/initializer.rb:621:inload_application_initializers' ... 19 levels... from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:in instance_eval' from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:ininitialize' from /home/heroku_rack/heroku.ru:1:in `new' from /home/heroku_rack/heroku.ru:1 Do I need to push the gems..If so I tried git add .gems It also gives fatal error. any suggestion would be greatly appreciated.

    Read the article

  • Can't get rails app to start on heroku

    - by jonnii
    I'm trying to deploy a rails app to heroku, but keep getting the following error. I'd have thought that managing the postgres gems would be something heroku would handle. I've tried everything I can think of short of installing postgres on my local machine, which I'd need to do if I wanted to install the postgres gem. There's also no gem called activerecord-postgresql-adapter... I'm guessing this is the standard adapter that comes with rails?? Any thoughts on how to fix this? App failed to start /usr/local/lib/ruby/gems/1.8/gems/activerecord-2.3.5/lib/active_record/connection_adapters/abstract/connection_specification.rb:76:in `establish_connection': Please install the postgresql adapter: `gem install activerecord-postgresql-adapter` (no such file to load -- pg) (RuntimeError) from /usr/local/lib/ruby/gems/1.8/gems/activerecord-2.3.5/lib/active_record/connection_adapters/abstract/connection_specification.rb:60:in `establish_connection' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-2.3.5/lib/active_record/connection_adapters/abstract/connection_specification.rb:55:in `establish_connection' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.5/lib/initializer.rb:438:in `initialize_database' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.5/lib/initializer.rb:141:in `process' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.5/lib/initializer.rb:113:in `send' from /usr/local/lib/ruby/gems/1.8/gems/rails-2.3.5/lib/initializer.rb:113:in `run' from /disk1/home/slugs/135415_c7f31f0_9f1f/mnt/config/environment.rb:9 from /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:in `gem_original_require' ... 14 levels... from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:in `instance_eval' from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:in `initialize' from /home/heroku_rack/heroku.ru:1:in `new' from /home/heroku_rack/heroku.ru:1

    Read the article

  • php request variables assigning $_GEt

    - by chris
    if you take a look at a previous question http://stackoverflow.com/questions/2690742/mod-rewrite-title-slugs-and-htaccess I am using the solution that Col. Shrapnel proposed- but when i assign values to $_GET in the actual file and not from a request the code doesnt work. It defaults away from the file as if the $_GET variables are not set The code I have come up with is- if(!empty($_GET['cat'])){ $_GET['target'] = "category"; if(isset($_GET['page'])){ $_GET['pageID'] = $_GET['page']; } $URL_query = "SELECT category_id FROM cats WHERE slug = '".$_GET['cat']."';"; $URL_result = mysql_query($URL_query); $URL_array = mysql_fetch_array($URL_result); $_GET['category_id'] = $URL_array['category_id']; }elseif($_GET['product']){ $_GET['target'] = "product"; $URL_query = "SELECT product_id FROM products WHERE slug = '".$_GET['product']."';"; $URL_result = mysql_query($URL_query); $URL_array = mysql_fetch_array($URL_result); print_r($URL_array); $_GET['product_id'] = $URL_array['product_id']; The original variable string that im trying to represent is /cart.php?Target=product&product_id=16142&category_id=249 And i'm trying to build the query string variables with code and including cart.php so i can use cleaner URL's So I have product/product-title-with-clean-url/ going to slug.php?product=slug Then the slug searches the db for a record with the matching slug and returns the product_id as in the code above.Then built the query string and include cart.php

    Read the article

  • Heroku only initializes some of my models.

    - by JayX
    So I ran heroku db:push And it returned Sending schema Schema: 100% |==========================================| Time: 00:00:08 Sending indexes schema_migrat: 100% |==========================================| Time: 00:00:00 projects: 100% |==========================================| Time: 00:00:00 tasks: 100% |==========================================| Time: 00:00:00 users: 100% |==========================================| Time: 00:00:00 Sending data 8 tables, 70,551 records groups: 100% |==========================================| Time: 00:00:00 schema_migrat: 100% |==========================================| Time: 00:00:00 projects: 100% |==========================================| Time: 00:00:00 tasks: 100% |==========================================| Time: 00:00:02 authenticatio: 100% |==========================================| Time: 00:00:00 articles: 100% |==========================================| Time: 00:08:27 users: 100% |==========================================| Time: 00:00:00 topics: 100% |==========================================| Time: 00:01:22 Resetting sequences And when I went to heroku console This worked >> Task => Task(id: integer, topic: string, content: string, This worked >> User => User(id: integer, name: string, email: string, But the rest only returned something like >> Project NameError: uninitialized constant Project /home/heroku_rack/lib/console.rb:150 /home/heroku_rack/lib/console.rb:150:in `call' /home/heroku_rack/lib/console.rb:28:in `call' >> Authentication NameError: uninitialized constant Authentication /home/heroku_rack/lib/console.rb:150 /home/heroku_rack/lib/console.rb:150:in `call' update 1: And when I typed >> ActiveRecord::Base.connection.tables it returned => ["projects", "groups", "tasks", "topics", "articles", "schema_migrations", "authentications", "users"] Using heroku's SQL console plugin I got SQL> show tables +-------------------+ | table_name | +-------------------+ | authentications | | topics | | groups | | projects | | schema_migrations | | tasks | | articles | | users | +-------------------+ So I think they are existing in heroku's database already. There is probably something wrong with rack db:migrate update 2: I ran rack db:migrate locally in both production and development modes and nothing wrong happened. But when I ran it on heroku it only returned: $ heroku rake db:migrate (in /disk1/home/slugs/389817_1c16250_4bf2-f9c9517b-bdbd-49d9-8e5a-a87111d3558e/mnt) $ Also, I am using sqlite3 update 3: so I opened up heroku console and typed in the following command class Authentication < ActiveRecord::Base;end Amazingly I was able to call Authentication class, but once I exited, nothing was changed.

    Read the article

  • Custom DataAnnotation attribute with datastore access in ASP.NET MVC 2

    - by mare
    I have my application designed with Repository pattern implemented and my code prepared for optional dependency injection in future, if we need to support another datastore. I want to create a custom validation attribute for my content objects. This attribute should perform some kind of datastore lookup. For instance, I need my content to have unique slugs. To check if a Slug already exist, I want to use custom DataAnnotation attribute in my Base content object (instead of manually checking if a slug exists each time in my controller's Insert actions). Attribute logic would do the validation. So far I have come up with this: public class UniqueSlugAttribute : ValidationAttribute { private readonly IContentRepository _repository; public UniqueSlugAttribute(ContentType contentType) { _repository = new XmlContentRepository(contentType); } public override bool IsValid(object value) { if (string.IsNullOrWhiteSpace(value.ToString())) { return false; } string slug = value.ToString(); if(_repository.IsUniqueSlug(slug)) return true; return false; } } part of my Base content class: ... [DataMember] public ContentType ContentType1 { get; set; } [DataMember] [Required(ErrorMessageResourceType = typeof (Localize), ErrorMessageResourceName = "Validation_SlugIsBlank")] [UniqueSlug(ContentType1)] public string Slug { get { return _slug; } set { if (!string.IsNullOrEmpty(value)) _slug = Utility.RemoveIllegalCharacters(value); } } ... There's an error in line [UniqueSlug(ContentType1)] saying: "An attribute argument must be a constant expression, typeof expression or array creation expression of an attribute parameter type." Let me explain that I need to provide the ContentType1 parameter to the Constructor of UniqueSlug class because I use it in my data provider. It is actually the same error that appears if you try do to this on the built-in Required attribute: [Required(ErrorMessageResourceType = typeof (Localize), ErrorMessageResourceName = Resources.Localize.SlugRequired] It does not allow us to set it to dynamic content. In the first case ContentType1 gets known at runtime, in the second case the Resources.Localize.SlugRequired also gets known at runtime (because the Culture settings are assigned at runtime). This is really annoying and makes so many things and implementation scenarios impossible. So, my first question is, how to get rid of this error? The second question I have, is whether you think that I should redesign my validation code in any way?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 1 2