Search Results

Search found 35219 results on 1409 pages for 'without'.

Page 204/1409 | < Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >

  • Should I amortize scripting cost via bytecode analysis or multithreading?

    - by user18983
    I'm working on a game sort of thing where users can write arbitrary code for individual agents, and I'm trying to decide the best way to divide up computation time. The simplest option would be to give each agent a set amount of time and skip their turn if it elapses without an action being decided upon, but I would like people to be able to write their agents decision functions without having to think too much about how long its taking unless they really want to. The two approaches I'm considering are giving each agent a set number of bytecode instructions (taking cost into account) each timestep, and making players deal with the consequences of the game state changing between blocks of computation (as with Battlecode) or giving each agent it's own thread and giving each thread equal time on the processor. I'm about equally knowledgeable on both concurrency and bytecode stuff, which is to say not very, so I'm wondering which approach would be best. I have a clearer idea of how I'd structure things if I used bytecode, but less certainty about how to actually implement the analysis. I'm pretty sure I can work up a concurrency based system without much trouble, but I worry it will be messier with more overhead and will add unnecessary complexity to the project.

    Read the article

  • Upgraded from ubuntu 12.04 to 12.10 issues

    - by ubuntu novice user
    I recently upgraded 12.04 to 12.10 ubuntu and then all hell broke loose. Being more specific, I have a Compaq machine and its hard disk is partitioned into 3 parts, so when I installed Ubuntu 10.04, I installed it in windows, since then have upgraded with each new ubuntu release via the update manager without any problems. I have installed the 64 bit versions. 12.10 downloaded via update manager, and initial downloading of packages was without problems, however, as it tried to install the packages, error messages appeared. The first was one about missing lib files, but I clicked to continue, since I am a relative novice on ubuntu. It continued, and during the restart process, when it was powering down, the computer hanged on the shutting down bit without rebooting for more than half an hour, so I manually shut down the machine and restarted it. Then a new error message appeared stating could not find disk, and I hit the manual fix option, and it now boots to an empty ubuntu desktop with my wallpaper but no launcher and the graphics appears as if this was put on a 640 x 480 resolution, and the screen no longer fits onto my 19" LCD. I had to use Ctrl-Alt-T to log out and then restart from there. How can I resolve this issue. Please help!

    Read the article

  • Possible to create "fake" forum (for prototyping) using html, javascript, jquery, css? [closed]

    - by htmlNewbie
    I am trying to figure out if it might be possible to create a small forum without any use of a database and php coding. I have created a small (local and will only be local) webpage with a couple of menus. I have a forum button which will take me to another .html location. Here i would like to create something that looks like a forum and which you somewhat could interact with like a forum, without any database or PHP. I would probably want/need a form with a heading and text input. When i have given some input, i want it to be displayed as a thread, probably on top of the other threads (which will have to be created beforehand). When I refresh the forum will obviously be set to default, without saving what i just entered since I'm not using a database to save any data. So the new posts will not be saved, just displayed, neatly, when submitted. I'm doing this webpage with forum just as a prototype, and that is why it doesn't have to work as a professional forum. :) Would be very thankful for some tips, tricks, ideas or links to helpful threads.

    Read the article

  • How can I load a file into a DataBag from within a Yahoo PigLatin UDF?

    - by Cervo
    I have a Pig program where I am trying to compute the minimum center between two bags. In order for it to work, I found I need to COGROUP the bags into a single dataset. The entire operation takes a long time. I want to either open one of the bags from disk within the UDF, or to be able to pass another relation into the UDF without needing to COGROUP...... Code: # **** Load files for iteration **** register myudfs.jar; wordcounts = LOAD 'input/wordcounts.txt' USING PigStorage('\t') AS (PatentNumber:chararray, word:chararray, frequency:double); centerassignments = load 'input/centerassignments/part-*' USING PigStorage('\t') AS (PatentNumber: chararray, oldCenter: chararray, newCenter: chararray); kcenters = LOAD 'input/kcenters/part-*' USING PigStorage('\t') AS (CenterID:chararray, word:chararray, frequency:double); kcentersa1 = CROSS centerassignments, kcenters; kcentersa = FOREACH kcentersa1 GENERATE centerassignments::PatentNumber as PatentNumber, kcenters::CenterID as CenterID, kcenters::word as word, kcenters::frequency as frequency; #***** Assign to nearest k-mean ******* assignpre1 = COGROUP wordcounts by PatentNumber, kcentersa by PatentNumber; assignwork2 = FOREACH assignpre1 GENERATE group as PatentNumber, myudfs.kmeans(wordcounts, kcentersa) as CenterID; basically my issue is that for each patent I need to pass the sub relations (wordcounts, kcenters). In order to do this, I do a cross and then a COGROUP by PatentNumber in order to get the set PatentNumber, {wordcounts}, {kcenters}. If I could figure a way to pass a relation or open up the centers from within the UDF, then I could just GROUP wordcounts by PatentNumber and run myudfs.kmeans(wordcount) which is hopefully much faster without the CROSS/COGROUP. This is an expensive operation. Currently this takes about 20 minutes and appears to tack the CPU/RAM. I was thinking it might be more efficient without the CROSS. I'm not sure it will be faster, so I'd like to experiment. Anyway it looks like calling the Loading functions from within Pig needs a PigContext object which I don't get from an evalfunc. And to use the hadoop file system, I need some initial objects as well, which I don't see how to get. So my question is how can I open a file from the hadoop file system from within a PIG UDF? I also run the UDF via main for debugging. So I need to load from the normal filesystem when in debug mode. Another better idea would be if there was a way to pass a relation into a UDF without needing to CROSS/COGROUP. This would be ideal, particularly if the relation resides in memory.. ie being able to do myudfs.kmeans(wordcounts, kcenters) without needing the CROSS/COGROUP with kcenters... But the basic idea is to trade IO for RAM/CPU cycles. Anyway any help will be much appreciated, the PIG UDFs aren't super well documented beyond the most simple ones, even in the UDF manual.

    Read the article

  • ActionResult types in MVC2

    - by rajbk
    In ASP.NET MVC, incoming browser requests gets mapped to a controller action method. The action method returns a type of ActionResult in response to the browser request. A basic example is shown below: public class HomeController : Controller { public ActionResult Index() { return View(); } } Here we have an action method called Index that returns an ActionResult. Inside the method we call the View() method on the base Controller. The View() method, as you will see shortly, is a method that returns a ViewResult. The ActionResult class is the base class for different controller results. The following diagram shows the types derived from the ActionResult type. ASP.NET has a description of these methods ContentResult – Represents a text result. EmptyResult – Represents no result. FileContentResult – Represents a downloadable file (with the binary content). FilePathResult – Represents a downloadable file (with a path). FileStreamResult – Represents a downloadable file (with a file stream). JavaScriptResult – Represents a JavaScript script. JsonResult – Represents a JavaScript Object Notation result that can be used in an AJAX application. PartialViewResult – Represents HTML and markup rendered by a partial view. RedirectResult – Represents a redirection to a new URL. RedirectToRouteResult – Represents a result that performs a redirection by using the specified route values dictionary. ViewResult – Represents HTML and markup rendered by a view. To return the types shown above, you call methods that are available in the Controller base class. A list of these methods are shown below.   Methods without an ActionResult return type The MVC framework will translate action methods that do not return an ActionResult into one. Consider the HomeController below which has methods that do not return any ActionResult types. The methods defined return an int, object and void respectfully. public class HomeController : Controller { public int Add(int x, int y) { return x + y; }   public Employee GetEmployee() { return new Employee(); }   public void DoNothing() { } } When a request comes in, the Controller class hands internally uses a ControllerActionInvoker class which inspects the action parameters and invokes the correct action method. The CreateActionResult method in the ControllerActionInvoker class is used to return an ActionResult. This method is shown below. If the result of the action method is null, an EmptyResult instance is returned. If the result is not of type ActionResult, the result is converted to a string and returned as a ContentResult. protected virtual ActionResult CreateActionResult(ControllerContext controllerContext, ActionDescriptor actionDescriptor, object actionReturnValue) { if (actionReturnValue == null) { return new EmptyResult(); }   ActionResult actionResult = (actionReturnValue as ActionResult) ?? new ContentResult { Content = Convert.ToString(actionReturnValue, CultureInfo.InvariantCulture) }; return actionResult; }   In the HomeController class above, the DoNothing method will return an instance of the EmptyResult() Renders an empty webpage the GetEmployee() method will return a ContentResult which contains a string that represents the current object Renders the text “MyNameSpace.Controllers.Employee” without quotes. the Add method for a request of /home/add?x=3&y=5 returns a ContentResult Renders the text “8” without quotes. Unit Testing The nice thing about the ActionResult types is in unit testing the controller. We can, without starting a web server, create an instance of the Controller, call the methods and verify that the type returned is the expected ActionResult type. We can then inspect the returned type properties and confirm that it contains the expected values. Enjoy! Sulley: Hey, Mike, this might sound crazy but I don't think that kid's dangerous. Mike: Really? Well, in that case, let's keep it. I always wanted a pet that could kill me.

    Read the article

  • The Incremental Architect&rsquo;s Napkin - #5 - Design functions for extensibility and readability

    - by Ralf Westphal
    Originally posted on: http://geekswithblogs.net/theArchitectsNapkin/archive/2014/08/24/the-incremental-architectrsquos-napkin---5---design-functions-for.aspx The functionality of programs is entered via Entry Points. So what we´re talking about when designing software is a bunch of functions handling the requests represented by and flowing in through those Entry Points. Designing software thus consists of at least three phases: Analyzing the requirements to find the Entry Points and their signatures Designing the functionality to be executed when those Entry Points get triggered Implementing the functionality according to the design aka coding I presume, you´re familiar with phase 1 in some way. And I guess you´re proficient in implementing functionality in some programming language. But in my experience developers in general are not experienced in going through an explicit phase 2. “Designing functionality? What´s that supposed to mean?” you might already have thought. Here´s my definition: To design functionality (or functional design for short) means thinking about… well, functions. You find a solution for what´s supposed to happen when an Entry Point gets triggered in terms of functions. A conceptual solution that is, because those functions only exist in your head (or on paper) during this phase. But you may have guess that, because it´s “design” not “coding”. And here is, what functional design is not: It´s not about logic. Logic is expressions (e.g. +, -, && etc.) and control statements (e.g. if, switch, for, while etc.). Also I consider calling external APIs as logic. It´s equally basic. It´s what code needs to do in order to deliver some functionality or quality. Logic is what´s doing that needs to be done by software. Transformations are either done through expressions or API-calls. And then there is alternative control flow depending on the result of some expression. Basically it´s just jumps in Assembler, sometimes to go forward (if, switch), sometimes to go backward (for, while, do). But calling your own function is not logic. It´s not necessary to produce any outcome. Functionality is not enhanced by adding functions (subroutine calls) to your code. Nor is quality increased by adding functions. No performance gain, no higher scalability etc. through functions. Functions are not relevant to functionality. Strange, isn´t it. What they are important for is security of investment. By introducing functions into our code we can become more productive (re-use) and can increase evolvability (higher unterstandability, easier to keep code consistent). That´s no small feat, however. Evolvable code can hardly be overestimated. That´s why to me functional design is so important. It´s at the core of software development. To sum this up: Functional design is on a level of abstraction above (!) logical design or algorithmic design. Functional design is only done until you get to a point where each function is so simple you are very confident you can easily code it. Functional design an logical design (which mostly is coding, but can also be done using pseudo code or flow charts) are complementary. Software needs both. If you start coding right away you end up in a tangled mess very quickly. Then you need back out through refactoring. Functional design on the other hand is bloodless without actual code. It´s just a theory with no experiments to prove it. But how to do functional design? An example of functional design Let´s assume a program to de-duplicate strings. The user enters a number of strings separated by commas, e.g. a, b, a, c, d, b, e, c, a. And the program is supposed to clear this list of all doubles, e.g. a, b, c, d, e. There is only one Entry Point to this program: the user triggers the de-duplication by starting the program with the string list on the command line C:\>deduplicate "a, b, a, c, d, b, e, c, a" a, b, c, d, e …or by clicking on a GUI button. This leads to the Entry Point function to get called. It´s the program´s main function in case of the batch version or a button click event handler in the GUI version. That´s the physical Entry Point so to speak. It´s inevitable. What then happens is a three step process: Transform the input data from the user into a request. Call the request handler. Transform the output of the request handler into a tangible result for the user. Or to phrase it a bit more generally: Accept input. Transform input into output. Present output. This does not mean any of these steps requires a lot of effort. Maybe it´s just one line of code to accomplish it. Nevertheless it´s a distinct step in doing the processing behind an Entry Point. Call it an aspect or a responsibility - and you will realize it most likely deserves a function of its own to satisfy the Single Responsibility Principle (SRP). Interestingly the above list of steps is already functional design. There is no logic, but nevertheless the solution is described - albeit on a higher level of abstraction than you might have done yourself. But it´s still on a meta-level. The application to the domain at hand is easy, though: Accept string list from command line De-duplicate Present de-duplicated strings on standard output And this concrete list of processing steps can easily be transformed into code:static void Main(string[] args) { var input = Accept_string_list(args); var output = Deduplicate(input); Present_deduplicated_string_list(output); } Instead of a big problem there are three much smaller problems now. If you think each of those is trivial to implement, then go for it. You can stop the functional design at this point. But maybe, just maybe, you´re not so sure how to go about with the de-duplication for example. Then just implement what´s easy right now, e.g.private static string Accept_string_list(string[] args) { return args[0]; } private static void Present_deduplicated_string_list( string[] output) { var line = string.Join(", ", output); Console.WriteLine(line); } Accept_string_list() contains logic in the form of an API-call. Present_deduplicated_string_list() contains logic in the form of an expression and an API-call. And then repeat the functional design for the remaining processing step. What´s left is the domain logic: de-duplicating a list of strings. How should that be done? Without any logic at our disposal during functional design you´re left with just functions. So which functions could make up the de-duplication? Here´s a suggestion: De-duplicate Parse the input string into a true list of strings. Register each string in a dictionary/map/set. That way duplicates get cast away. Transform the data structure into a list of unique strings. Processing step 2 obviously was the core of the solution. That´s where real creativity was needed. That´s the core of the domain. But now after this refinement the implementation of each step is easy again:private static string[] Parse_string_list(string input) { return input.Split(',') .Select(s => s.Trim()) .ToArray(); } private static Dictionary<string,object> Compile_unique_strings(string[] strings) { return strings.Aggregate( new Dictionary<string, object>(), (agg, s) => { agg[s] = null; return agg; }); } private static string[] Serialize_unique_strings( Dictionary<string,object> dict) { return dict.Keys.ToArray(); } With these three additional functions Main() now looks like this:static void Main(string[] args) { var input = Accept_string_list(args); var strings = Parse_string_list(input); var dict = Compile_unique_strings(strings); var output = Serialize_unique_strings(dict); Present_deduplicated_string_list(output); } I think that´s very understandable code: just read it from top to bottom and you know how the solution to the problem works. It´s a mirror image of the initial design: Accept string list from command line Parse the input string into a true list of strings. Register each string in a dictionary/map/set. That way duplicates get cast away. Transform the data structure into a list of unique strings. Present de-duplicated strings on standard output You can even re-generate the design by just looking at the code. Code and functional design thus are always in sync - if you follow some simple rules. But about that later. And as a bonus: all the functions making up the process are small - which means easy to understand, too. So much for an initial concrete example. Now it´s time for some theory. Because there is method to this madness ;-) The above has only scratched the surface. Introducing Flow Design Functional design starts with a given function, the Entry Point. Its goal is to describe the behavior of the program when the Entry Point is triggered using a process, not an algorithm. An algorithm consists of logic, a process on the other hand consists just of steps or stages. Each processing step transforms input into output or a side effect. Also it might access resources, e.g. a printer, a database, or just memory. Processing steps thus can rely on state of some sort. This is different from Functional Programming, where functions are supposed to not be stateful and not cause side effects.[1] In its simplest form a process can be written as a bullet point list of steps, e.g. Get data from user Output result to user Transform data Parse data Map result for output Such a compilation of steps - possibly on different levels of abstraction - often is the first artifact of functional design. It can be generated by a team in an initial design brainstorming. Next comes ordering the steps. What should happen first, what next etc.? Get data from user Parse data Transform data Map result for output Output result to user That´s great for a start into functional design. It´s better than starting to code right away on a given function using TDD. Please get me right: TDD is a valuable practice. But it can be unnecessarily hard if the scope of a functionn is too large. But how do you know beforehand without investing some thinking? And how to do this thinking in a systematic fashion? My recommendation: For any given function you´re supposed to implement first do a functional design. Then, once you´re confident you know the processing steps - which are pretty small - refine and code them using TDD. You´ll see that´s much, much easier - and leads to cleaner code right away. For more information on this approach I call “Informed TDD” read my book of the same title. Thinking before coding is smart. And writing down the solution as a bunch of functions possibly is the simplest thing you can do, I´d say. It´s more according to the KISS (Keep It Simple, Stupid) principle than returning constants or other trivial stuff TDD development often is started with. So far so good. A simple ordered list of processing steps will do to start with functional design. As shown in the above example such steps can easily be translated into functions. Moving from design to coding thus is simple. However, such a list does not scale. Processing is not always that simple to be captured in a list. And then the list is just text. Again. Like code. That means the design is lacking visuality. Textual representations need more parsing by your brain than visual representations. Plus they are limited in their “dimensionality”: text just has one dimension, it´s sequential. Alternatives and parallelism are hard to encode in text. In addition the functional design using numbered lists lacks data. It´s not visible what´s the input, output, and state of the processing steps. That´s why functional design should be done using a lightweight visual notation. No tool is necessary to draw such designs. Use pen and paper; a flipchart, a whiteboard, or even a napkin is sufficient. Visualizing processes The building block of the functional design notation is a functional unit. I mostly draw it like this: Something is done, it´s clear what goes in, it´s clear what comes out, and it´s clear what the processing step requires in terms of state or hardware. Whenever input flows into a functional unit it gets processed and output is produced and/or a side effect occurs. Flowing data is the driver of something happening. That´s why I call this approach to functional design Flow Design. It´s about data flow instead of control flow. Control flow like in algorithms is of no concern to functional design. Thinking about control flow simply is too low level. Once you start with control flow you easily get bogged down by tons of details. That´s what you want to avoid during design. Design is supposed to be quick, broad brush, abstract. It should give overview. But what about all the details? As Robert C. Martin rightly said: “Programming is abot detail”. Detail is a matter of code. Once you start coding the processing steps you designed you can worry about all the detail you want. Functional design does not eliminate all the nitty gritty. It just postpones tackling them. To me that´s also an example of the SRP. Function design has the responsibility to come up with a solution to a problem posed by a single function (Entry Point). And later coding has the responsibility to implement the solution down to the last detail (i.e. statement, API-call). TDD unfortunately mixes both responsibilities. It´s just coding - and thereby trying to find detailed implementations (green phase) plus getting the design right (refactoring). To me that´s one reason why TDD has failed to deliver on its promise for many developers. Using functional units as building blocks of functional design processes can be depicted very easily. Here´s the initial process for the example problem: For each processing step draw a functional unit and label it. Choose a verb or an “action phrase” as a label, not a noun. Functional design is about activities, not state or structure. Then make the output of an upstream step the input of a downstream step. Finally think about the data that should flow between the functional units. Write the data above the arrows connecting the functional units in the direction of the data flow. Enclose the data description in brackets. That way you can clearly see if all flows have already been specified. Empty brackets mean “no data is flowing”, but nevertheless a signal is sent. A name like “list” or “strings” in brackets describes the data content. Use lower case labels for that purpose. A name starting with an upper case letter like “String” or “Customer” on the other hand signifies a data type. If you like, you also can combine descriptions with data types by separating them with a colon, e.g. (list:string) or (strings:string[]). But these are just suggestions from my practice with Flow Design. You can do it differently, if you like. Just be sure to be consistent. Flows wired-up in this manner I call one-dimensional (1D). Each functional unit just has one input and/or one output. A functional unit without an output is possible. It´s like a black hole sucking up input without producing any output. Instead it produces side effects. A functional unit without an input, though, does make much sense. When should it start to work? What´s the trigger? That´s why in the above process even the first processing step has an input. If you like, view such 1D-flows as pipelines. Data is flowing through them from left to right. But as you can see, it´s not always the same data. It get´s transformed along its passage: (args) becomes a (list) which is turned into (strings). The Principle of Mutual Oblivion A very characteristic trait of flows put together from function units is: no functional units knows another one. They are all completely independent of each other. Functional units don´t know where their input is coming from (or even when it´s gonna arrive). They just specify a range of values they can process. And they promise a certain behavior upon input arriving. Also they don´t know where their output is going. They just produce it in their own time independent of other functional units. That means at least conceptually all functional units work in parallel. Functional units don´t know their “deployment context”. They now nothing about the overall flow they are place in. They are just consuming input from some upstream, and producing output for some downstream. That makes functional units very easy to test. At least as long as they don´t depend on state or resources. I call this the Principle of Mutual Oblivion (PoMO). Functional units are oblivious of others as well as an overall context/purpose. They are just parts of a whole focused on a single responsibility. How the whole is built, how a larger goal is achieved, is of no concern to the single functional units. By building software in such a manner, functional design interestingly follows nature. Nature´s building blocks for organisms also follow the PoMO. The cells forming your body do not know each other. Take a nerve cell “controlling” a muscle cell for example:[2] The nerve cell does not know anything about muscle cells, let alone the specific muscel cell it is “attached to”. Likewise the muscle cell does not know anything about nerve cells, let a lone a specific nerve cell “attached to” it. Saying “the nerve cell is controlling the muscle cell” thus only makes sense when viewing both from the outside. “Control” is a concept of the whole, not of its parts. Control is created by wiring-up parts in a certain way. Both cells are mutually oblivious. Both just follow a contract. One produces Acetylcholine (ACh) as output, the other consumes ACh as input. Where the ACh is going, where it´s coming from neither cell cares about. Million years of evolution have led to this kind of division of labor. And million years of evolution have produced organism designs (DNA) which lead to the production of these different cell types (and many others) and also to their co-location. The result: the overall behavior of an organism. How and why this happened in nature is a mystery. For our software, though, it´s clear: functional and quality requirements needs to be fulfilled. So we as developers have to become “intelligent designers” of “software cells” which we put together to form a “software organism” which responds in satisfying ways to triggers from it´s environment. My bet is: If nature gets complex organisms working by following the PoMO, who are we to not apply this recipe for success to our much simpler “machines”? So my rule is: Wherever there is functionality to be delivered, because there is a clear Entry Point into software, design the functionality like nature would do it. Build it from mutually oblivious functional units. That´s what Flow Design is about. In that way it´s even universal, I´d say. Its notation can also be applied to biology: Never mind labeling the functional units with nouns. That´s ok in Flow Design. You´ll do that occassionally for functional units on a higher level of abstraction or when their purpose is close to hardware. Getting a cockroach to roam your bedroom takes 1,000,000 nerve cells (neurons). Getting the de-duplication program to do its job just takes 5 “software cells” (functional units). Both, though, follow the same basic principle. Translating functional units into code Moving from functional design to code is no rocket science. In fact it´s straightforward. There are two simple rules: Translate an input port to a function. Translate an output port either to a return statement in that function or to a function pointer visible to that function. The simplest translation of a functional unit is a function. That´s what you saw in the above example. Functions are mutually oblivious. That why Functional Programming likes them so much. It makes them composable. Which is the reason, nature works according to the PoMO. Let´s be clear about one thing: There is no dependency injection in nature. For all of an organism´s complexity no DI container is used. Behavior is the result of smooth cooperation between mutually oblivious building blocks. Functions will often be the adequate translation for the functional units in your designs. But not always. Take for example the case, where a processing step should not always produce an output. Maybe the purpose is to filter input. Here the functional unit consumes words and produces words. But it does not pass along every word flowing in. Some words are swallowed. Think of a spell checker. It probably should not check acronyms for correctness. There are too many of them. Or words with no more than two letters. Such words are called “stop words”. In the above picture the optionality of the output is signified by the astrisk outside the brackets. It means: Any number of (word) data items can flow from the functional unit for each input data item. It might be none or one or even more. This I call a stream of data. Such behavior cannot be translated into a function where output is generated with return. Because a function always needs to return a value. So the output port is translated into a function pointer or continuation which gets passed to the subroutine when called:[3]void filter_stop_words( string word, Action<string> onNoStopWord) { if (...check if not a stop word...) onNoStopWord(word); } If you want to be nitpicky you might call such a function pointer parameter an injection. And technically you´re right. Conceptually, though, it´s not an injection. Because the subroutine is not functionally dependent on the continuation. Firstly continuations are procedures, i.e. subroutines without a return type. Remember: Flow Design is about unidirectional data flow. Secondly the name of the formal parameter is chosen in a way as to not assume anything about downstream processing steps. onNoStopWord describes a situation (or event) within the functional unit only. Translating output ports into function pointers helps keeping functional units mutually oblivious in cases where output is optional or produced asynchronically. Either pass the function pointer to the function upon call. Or make it global by putting it on the encompassing class. Then it´s called an event. In C# that´s even an explicit feature.class Filter { public void filter_stop_words( string word) { if (...check if not a stop word...) onNoStopWord(word); } public event Action<string> onNoStopWord; } When to use a continuation and when to use an event dependens on how a functional unit is used in flows and how it´s packed together with others into classes. You´ll see examples further down the Flow Design road. Another example of 1D functional design Let´s see Flow Design once more in action using the visual notation. How about the famous word wrap kata? Robert C. Martin has posted a much cited solution including an extensive reasoning behind his TDD approach. So maybe you want to compare it to Flow Design. The function signature given is:string WordWrap(string text, int maxLineLength) {...} That´s not an Entry Point since we don´t see an application with an environment and users. Nevertheless it´s a function which is supposed to provide a certain functionality. The text passed in has to be reformatted. The input is a single line of arbitrary length consisting of words separated by spaces. The output should consist of one or more lines of a maximum length specified. If a word is longer than a the maximum line length it can be split in multiple parts each fitting in a line. Flow Design Let´s start by brainstorming the process to accomplish the feat of reformatting the text. What´s needed? Words need to be assembled into lines Words need to be extracted from the input text The resulting lines need to be assembled into the output text Words too long to fit in a line need to be split Does sound about right? I guess so. And it shows a kind of priority. Long words are a special case. So maybe there is a hint for an incremental design here. First let´s tackle “average words” (words not longer than a line). Here´s the Flow Design for this increment: The the first three bullet points turned into functional units with explicit data added. As the signature requires a text is transformed into another text. See the input of the first functional unit and the output of the last functional unit. In between no text flows, but words and lines. That´s good to see because thereby the domain is clearly represented in the design. The requirements are talking about words and lines and here they are. But note the asterisk! It´s not outside the brackets but inside. That means it´s not a stream of words or lines, but lists or sequences. For each text a sequence of words is output. For each sequence of words a sequence of lines is produced. The asterisk is used to abstract from the concrete implementation. Like with streams. Whether the list of words gets implemented as an array or an IEnumerable is not important during design. It´s an implementation detail. Does any processing step require further refinement? I don´t think so. They all look pretty “atomic” to me. And if not… I can always backtrack and refine a process step using functional design later once I´ve gained more insight into a sub-problem. Implementation The implementation is straightforward as you can imagine. The processing steps can all be translated into functions. Each can be tested easily and separately. Each has a focused responsibility. And the process flow becomes just a sequence of function calls: Easy to understand. It clearly states how word wrapping works - on a high level of abstraction. And it´s easy to evolve as you´ll see. Flow Design - Increment 2 So far only texts consisting of “average words” are wrapped correctly. Words not fitting in a line will result in lines too long. Wrapping long words is a feature of the requested functionality. Whether it´s there or not makes a difference to the user. To quickly get feedback I decided to first implement a solution without this feature. But now it´s time to add it to deliver the full scope. Fortunately Flow Design automatically leads to code following the Open Closed Principle (OCP). It´s easy to extend it - instead of changing well tested code. How´s that possible? Flow Design allows for extension of functionality by inserting functional units into the flow. That way existing functional units need not be changed. The data flow arrow between functional units is a natural extension point. No need to resort to the Strategy Pattern. No need to think ahead where extions might need to be made in the future. I just “phase in” the remaining processing step: Since neither Extract words nor Reformat know of their environment neither needs to be touched due to the “detour”. The new processing step accepts the output of the existing upstream step and produces data compatible with the existing downstream step. Implementation - Increment 2 A trivial implementation checking the assumption if this works does not do anything to split long words. The input is just passed on: Note how clean WordWrap() stays. The solution is easy to understand. A developer looking at this code sometime in the future, when a new feature needs to be build in, quickly sees how long words are dealt with. Compare this to Robert C. Martin´s solution:[4] How does this solution handle long words? Long words are not even part of the domain language present in the code. At least I need considerable time to understand the approach. Admittedly the Flow Design solution with the full implementation of long word splitting is longer than Robert C. Martin´s. At least it seems. Because his solution does not cover all the “word wrap situations” the Flow Design solution handles. Some lines would need to be added to be on par, I guess. But even then… Is a difference in LOC that important as long as it´s in the same ball park? I value understandability and openness for extension higher than saving on the last line of code. Simplicity is not just less code, it´s also clarity in design. But don´t take my word for it. Try Flow Design on larger problems and compare for yourself. What´s the easier, more straightforward way to clean code? And keep in mind: You ain´t seen all yet ;-) There´s more to Flow Design than described in this chapter. In closing I hope I was able to give you a impression of functional design that makes you hungry for more. To me it´s an inevitable step in software development. Jumping from requirements to code does not scale. And it leads to dirty code all to quickly. Some thought should be invested first. Where there is a clear Entry Point visible, it´s functionality should be designed using data flows. Because with data flows abstraction is possible. For more background on why that´s necessary read my blog article here. For now let me point out to you - if you haven´t already noticed - that Flow Design is a general purpose declarative language. It´s “programming by intention” (Shalloway et al.). Just write down how you think the solution should work on a high level of abstraction. This breaks down a large problem in smaller problems. And by following the PoMO the solutions to those smaller problems are independent of each other. So they are easy to test. Or you could even think about getting them implemented in parallel by different team members. Flow Design not only increases evolvability, but also helps becoming more productive. All team members can participate in functional design. This goes beyon collective code ownership. We´re talking collective design/architecture ownership. Because with Flow Design there is a common visual language to talk about functional design - which is the foundation for all other design activities.   PS: If you like what you read, consider getting my ebook “The Incremental Architekt´s Napkin”. It´s where I compile all the articles in this series for easier reading. I like the strictness of Function Programming - but I also find it quite hard to live by. And it certainly is not what millions of programmers are used to. Also to me it seems, the real world is full of state and side effects. So why give them such a bad image? That´s why functional design takes a more pragmatic approach. State and side effects are ok for processing steps - but be sure to follow the SRP. Don´t put too much of it into a single processing step. ? Image taken from www.physioweb.org ? My code samples are written in C#. C# sports typed function pointers called delegates. Action is such a function pointer type matching functions with signature void someName(T t). Other languages provide similar ways to work with functions as first class citizens - even Java now in version 8. I trust you find a way to map this detail of my translation to your favorite programming language. I know it works for Java, C++, Ruby, JavaScript, Python, Go. And if you´re using a Functional Programming language it´s of course a no brainer. ? Taken from his blog post “The Craftsman 62, The Dark Path”. ?

    Read the article

  • Windows Phone–A beautiful phone which I admire but I don’t recommend to friends and family

    - by Gopinath
    Microsoft’s Windows Phones are the most beautiful phones I’ve seen. Look at the photo which Microsoft shared on their Facebook page today. It’s gorgeous. Windows Phones come in vibrant colors and the user interface is very lively. When you keep an iPhone, Android Phone & a Windows Phone on a table, Windows Phone definitely stands out. Android and iOS interfaces are routine – a bunch of apps icons arranged in rows and multiple screens. Windows Phone is very different, the live tiles concept mesmerizes us. I love Windows Phone, but neither I buy one nor I recommend to family/friends! Why? Because it does not have all the Apps I need. Microsoft advertises that Windows Phone has 100K apps on its Windows Market Place. It’s true, there are 100K+ apps available for Windows Phone but not many of them are really useful and most of the popular Apps I use on Android are not available. When I say this to my friends at Microsoft, they don’t agree and one of them asked me list the apps that are not available. For him today I spent an hour quickly scanning through the apps installed on my Google Nexus and searched for same apps on Windows Market Place. As expected many of them are not available. Here is the list of my favorite Android apps that are not available for Windows Phone Mint – I use this app more than any of the Banking Apps I’ve installed on my mobile. It’s one app to keep a tab on all the expenses and income, the best money management and tracking app. Google Chrome – Web without Google Chrome is too boring, either on Desktop or on mobile. IE is too heavy and Firefox is loosing its grip. Chrome is the new darling of web. Pulse, Flipboard – Flipboard and Pulse are one of the best apps for reading news and following content of favorite blogs. Dropbox – Sync content across devices and provides access to your content on any device.It really does not matter what is your gadget – mobile, tablet or computer; Dropbox lets you access your content. GMail, Google Maps – Should I say how important are these two apps in our day to day life!! Vonage Extension – For around 30 bucks a month, Vonage provide landline service in USA + unlimited calls to India and many other countries + Vonage Extension App that lets Android/iOS mobile to make unlimited international calls for free. Without Vonage Extension app, I’m almost cutoff from my family and friends back home in India. Instagram – The most popular camera app used from a common man to celebrities. Raaga, Dhingana  – Music is part and parcel of life and these two apps are the most like popular apps to listen to Indian music. Quora – Quora is the place where most of the sensible discussions happen on web. Google Analytics, Google Adsense – I’m a blogger and these two apps mean a lot to me The list goes on and on! There are many useful apps that are not available on Windows Phone – TuneIn, MyTWC, Chrome To Phone, Google Voice, etc. Without all these apps, Windows Phone is just another old Nokia phone. Even though Windows Phone is the most beautiful phone, it needs Apps to attract customers. Without apps a smartphone is more or less a dumb feature phone which we loved to use before release of iPhone. Wish in an year or two the beautiful Windows Phone may have all the missing Apps. When it happens I’ll buy a phone for myself and recommend it to my family & friends. But till then I prefer to stay away.

    Read the article

  • Release Management as Orchestra

    - by ericajanine
    I read an excellent, concise article (http://www.buildmeister.com/articles/software_release_management_best_practices) on the basics of release management practices. In the article, it states "Release Management is often likened to the conductor of an orchestra, with the individual changes to be implemented the various instruments within it." I played in music ensembles for years, so this is especially close to my heart as example. I learned most of my discipline from hours and hours of practice at the hand of a very skilled conductor and leader. I also learned that the true magic in symphonic performance is one where everyone involved is focused on one sound, one goal. In turn, that solid focus creates a sound and experience bigger than just mechanics alone accomplish. In symphony, a conductor's true purpose is to make you, a performer, better so the overall sound and end product is better. The big picture (the performance of the composition) is the end-game, and all musicians in the orchestra know without question their part makes up an important but incomplete piece of that performance. A good conductor works with each section (e.g. group) to ensure their individual pieces are solid. Let's restate: The conductor leads and is responsible for ensuring those pieces are solid. While the performers themselves are doing the work, the conductor is the final authority on when the pieces are ready or not. If not, the conductor initiates the efforts to get them ready or makes the decision to scrap their parts altogether for the sake of an overall performance. Let it sink in, because it's clear--It is not the performer's call if they play their part as agreed, it's the conductor's final call to allow it. In comparison, if a software release manager is a conductor, the only way for that manager to be effective is to drive the overarching process and execution of individual pieces of a software development lifecycle. It does not mean the release manager performs each and every piece, it means the release manager has oversight and influence because the end-game is a successful software enhancin a useable environment. It means the release manager, not the developer or development manager, has the final call if something goes into a software release. Of course, this is not a process of autocracy or dictation of absolute rule, it's cooperative effort. But the release manager must have the final authority to make a decision if something is ready to be added to the bigger piece, the overall symphony of software changes being considered for package and release. It also goes without saying a release manager, like a conductor, must have full autonomy and isolation from other software groups. A conductor is the one on the podium waving a little stick at the each section and cueing them for their parts, not yelling from the back of the room while also playing a tuba and taking direction from the horn section. I have personally seen where release managers are relegated to being considered little more than coordinators, red-tapers to "satisfy" the demands of an audit group without being bothered to actually respect all that a release manager gives a group willing to employ them fully. In this dysfunctional scenario, development managers, project managers, business users, and other stakeholders have been given nearly full clearance to demand and push their agendas forward, causing a tail-wagging-the-dog scenario where an inherent conflict will ensue. Depending on the strength, determination for peace, and willingness to overlook a built-in expectation that is wrong, the release manager here must face the crafted conflict head-on and diffuse it as quickly as possible. Then, the release manager must clearly make a case why a change cannot be released without negative impact to all parties involved. If a political agenda is solely driving a software release, there IS no symphony, there is no "software lifecycle". It's just out-of-tune noise. More importantly, there is no real conductor. Sometimes, just wanting to make a beautiful sound is not enough. If you are a release manager, are you freed up enough to move, to conduct the sections of software creation to ensure a solid release performance is possible? If not, it's time to take stock in what your role actually is and see if that is what you truly want to achieve in your position. If you are, then you can successfully build your career and that of the people in your groups to create truly beautiful software (music) together.

    Read the article

  • Installation problem Ubuntu 12.04 Crashing hardware error

    - by user93640
    I am running on Ubuntu 8.04 for quite some time without many problems. About almost a year ago or so I have been trying to upgrade to 10.04 LTS, but without any success. Each time when trying to upgrade or even newly install the installation process crashed after about an hour or so (I forgot exactly how long). Now I wanted to try Ubuntu 12.04 (not even installing, but I only selected "Try Ubuntu without installing") and I got similar errors. I did not try to install it, because of earlier experience with 10.04 when after I also lost 8.04 and had to install from scratch again (after which it worked). I get the following screen (as I am not allowed to upload photos here the text): 26.767262] [Hardware Error]: CPU 0: Machine Check Exception: 0 Bank 5: b200001804000e0f 26.767279] [Hardware Error]: TSC 0 26.767287] [Hardware Error]: PROCESSOR 0:6f6 TIME 1349017924 SOCKET 0 APIC 0 microcode 44 26.767297] [Hardware Error]: Run the above through 'mcelog --ascii' 26.767307] [Hardware Error]: CPU 1: Machine Check Exception: 0 Bank 1: b200000000000175 26.767316] [Hardware Error]: TSC 0 26.767323] [Hardware Error]: PROCESSOR 0:6f6 TIME 1349017924 SOCKET 0 APIC 1 microcode 44 26.767331] [Hardware Error]: Run the above through 'mcelog --ascii' 26.767339] [Hardware Error]: CPU 1: Machine Check Exception: 0 Bank 5: b200003000000e0f 26.767348] [Hardware Error]: TSC 0 26.767354] [Hardware Error]: PROCESSOR 0:6f6 TIME 1349017924 SOCKET 0 APIC 1 microcode 44 26.767363] [Hardware Error]: Run the above through 'mcelog --ascii' 26.767371] [Hardware Error]: CPU 1: Machine Check Exception: 4 Bank 1: b200000000000175 26.767379] [Hardware Error]: TSC 1bf231e65f 26.767386] [Hardware Error]: PROCESSOR 0:6f6 TIME 1349017951 SOCKET 0 APIC 1 microcode 44 26.767395] [Hardware Error]: Run the above through 'mcelog --ascii' 26.767403] [Hardware Error]: CPU 1: Machine Check Exception: 4 Bank 5: b200003008000e0f 26.767413] [Hardware Error]: TSC 1bf231e65f 26.767421] [Hardware Error]: PROCESSOR 0:6f6 TIME 1349017951 SOCKET 0 APIC 1 microcode 44 26.767429] [Hardware Error]: Run the above through 'mcelog --ascii' 26.767437] [Hardware Error]: CPU 0: Machine Check Exception: 5 Bank 5: b200001806000e0f 26.767447] [Hardware Error]: RIP |INEXACT| 60:<00000000c1018b5c> {mwait_idle+0x7c/0x1d0} 26.767464] [Hardware Error]: TSC 1bf231e674 26.767471] [Hardware Error]: PROCESSOR 0:6f6 TIME 1349017951 SOCKET 0 APIC 0 microcode 44 26.767480] [Hardware Error]: Run the above through 'mcelog --ascii' 26.767487] [Hardware Error]: Machine check: Processor context corrupt 26.767495] Kernel panic - not syncing: Fatal Machine check 26.767505] Pid: 579, comm: debconf-communi Tainted: G M 3.2.0.29-generic-pae #46-Ubuntu 26.767515] Call Trace: 26.767525] [<c158f812>] ? printk+0x2d/0x2f 26.767534] [<c158f6e0>] panic+0x5c/0x161 26.767542] [<c10247ef>] mce_panic.part.14+0x13f/0x170 26.767551] [<c1024872>] mce_panic+0x52/0x90 26.767558] [<c1024a18>] mce_reign+0x168/0x170 26.767565] [<c1024bb5>] mce_end+0x105/0x110 26.767572] [<c10252db>] do_machine_check+0x32b/0x4f0 26.767581] [<c1024fb0>] ? mce_log+0x120/0x120 26.767590] [<c15a5e47>] error_code+0x67/0x6c 26.767602] panic occurred, switching back to text console 26.768498] Rebooting in 30 seconds.. For information, I have also tried earlier Arch Linux. I can install it, but when I try to install a window manager (LXDE) again I got similar errors. Fedora also crashes when installing and also Mandriva did not work for me. Therefore I think something deep in the machine might be wrong. But as stated above I can (clean) install 8.04 and also 9.10 can be installed without problems. Also updates for 8.04 can be installed. My machine is dual boot with XP next to it on a different partition. My HW: Memory : 2.0 GiB; Processor 0: Intel(R) Core(TM)2 CPU 6320 @ 1.86GHz; Processor 1: Intel(R) Core(TM)2 CPU 6320 @ 1.86GHz; How can I install Ubuntu 12.04? Last option would be to completely format my machine and install everything from scratch, but even I am not sure if that would solve it in the end. Can anybody help me out?

    Read the article

  • Unleash the Power of Cryptography on SPARC T4

    - by B.Koch
    by Rob Ludeman Oracle’s SPARC T4 systems are architected to deliver enhanced value for customer via the inclusion of many integrated features.  One of the best examples of this approach is demonstrated in the on-chip cryptographic support that delivers wire speed encryption capabilities without any impact to application performance.  The Evolution of SPARC Encryption SPARC T-Series systems have a long history of providing this capability, dating back to the release of the first T2000 systems that featured support for on-chip RSA encryption directly in the UltraSPARC T1 processor.  Successive generations have built on this approach by support for additional encryption ciphers that are tightly coupled with the Oracle Solaris 10 and Solaris 11 encryption framework.  While earlier versions of this technology were implemented using co-processors, the SPARC T4 was redesigned with new crypto instructions to eliminate some of the performance overhead associated with the former approach, resulting in much higher performance for encrypted workloads. The Superiority of the SPARC T4 Approach to Crypto As companies continue to engage in more and more e-commerce, the need to provide greater degrees of security for these transactions is more critical than ever before.  Traditional methods of securing data in transit by applications have a number of drawbacks that are addressed by the SPARC T4 cryptographic approach. 1. Performance degradation – cryptography is highly compute intensive and therefore, there is a significant cost when using other architectures without embedded crypto functionality.  This performance penalty impacts the entire system, slowing down performance of web servers (SSL), for example, and potentially bogging down the speed of other business applications.  The SPARC T4 processor enables customers to deliver high levels of security to internal and external customers while not incurring an impact to overall SLAs in their IT environment. 2. Added cost – one of the methods to avoid performance degradation is the addition of add-in cryptographic accelerator cards or external offload engines in other systems.  While these solutions provide a brute force mechanism to avoid the problem of slower system performance, it usually comes at an added cost.  Customers looking to encrypt datacenter traffic without the overhead and expenditure of extra hardware can rely on SPARC T4 systems to deliver the performance necessary without the need to purchase other hardware or add-on cards. 3. Higher complexity – the addition of cryptographic cards or leveraging load balancers to perform encryption tasks results in added complexity from a management standpoint.  With SPARC T4, encryption keys and the framework built into Solaris 10 and 11 means that administrators generally don’t need to spend extra cycles determining how to perform cryptographic functions.  In fact, many of the instructions are built-in and require no user intervention to be utilized.  For example, For OpenSSL on Solaris 11, SPARC T4 crypto is available directly with a new built-in OpenSSL 1.0 engine, called the "t4 engine."  For a deeper technical dive into the new instructions included in SPARC T4, consult Dan Anderson’s blog. Conclusion In summary, SPARC T4 systems offer customers much more value for applications than just increased performance. The integration of key virtualization technologies, embedded encryption, and a true Enterprise Operating System, Oracle Solaris, provides direct business benefits that supersedes the commodity approach to data center computing.   SPARC T4 removes the roadblocks to secure computing by offering integrated crypto accelerators that can save IT organizations in operating cost while delivering higher levels of performance and meeting objectives around compliance. For more on the SPARC T4 family of products, go to here.

    Read the article

  • SEO non-English domain name advice

    - by Dominykas Mostauskis
    I'm starting a website, that is meant for a non-English region, using an alphabet that is a bit different than that of English. Current plan is as follows. The website name, and the domain name, will be in the local language (not English); however, domain name will be spelled in the English alphabet, while the website's title will be the same word(s), but spelled properly with accents. E.g.: 'www.litterat.fr' and 'Littérat'. Does the difference between domain name and website name character use influence the site's SEO? Is it better, SEO-wise, to choose a name that can be spelled the same way in the English alphabet? From my experience, when searching online, invariably, the English alphabet is used, no matter the language, so people will still be searching 'litterat' (without accents and such). Edit: To sum up: Things have been said about IDN (Internationalized domain name). To make it simple, they are second-level domain names that contain language specific characters (LSP)(e.g. www.café.fr). Here you can check what top-level domains support what LSPs. Check initall's answer for more info on using LSPs in paths and queries. To answer my question about how and if search engines relate keywords spelled with and without language specific characters: Google can potentially tell that series and séries is the same keyword. However, (most relevant for words that are spelled differently across languages and have different meanings, like séries), for Google to make the connection (or lack thereof) between e and é, it has to deduce two things: Language that you are searching in. Language of your query. You can specify it manually through Advanced search or it guesses it, sometimes. I presume it can guess it wrong too. The more keywords specific to this language you use the higher Google's chance to guess the language. Language of the crawled document, against which the ASCII version of the word will be compared (in this example – series). Again, check initall's answer for how to help Google in understanding what language your document is in. Once it has that it can tell whether or not these two spellings should be treated as the same keyword. Google has to understand that even though you're not using french (in this example) specific characters, you're searching in French. The reason why I used the french word séries in this example, is that it demonstrates this very well. You have it in French and you have it in English without the accent. So if your search query is ambiguous like our series, unless Google has something more to go on, it will presume that there's no correlation between your search and séries in French documents. If you augment your query to series romantiques (try it), Google will understand that you're searching in French and among your results you'll see séries as well. But this does not always work, you should test it out with your keywords first. For example, if you search series francaises, it will associate francaises with françaises, but it will not associate series with séries. It depends on the words. Note: worth stressing that this problem is very relevant to words that, written in plain ASCII, might have some other meanings in other languages, it is less relevant to words that can be, by a distinct margin, just some one language. Tip: I've noticed that sometimes even if my non-accented search query doesn't get associated with the properly spelled word in a document (especially if it's the title or an important keyword in the doc), it still comes up. I followed the link, did a Ctrl-F search for my non-accented search query and found nothing, then checked the meta-tags in the source and you had the page's title in both accented and non-accented forms. So if you have meta-tags that can be spelled with language specific characters and without, put in both. Footnote: I hope this helps. If you have anything to add or correct, go ahead.

    Read the article

  • How to move complete SharePoint Server 2007 from one box to another

    - by DipeshBhanani
    It was time of my first onsite client assignment on SharePoint. Client had one server production environment. They wanted to upgrade the topology with completely new SharePoint Farm of three servers. So, the task was to move whole MOSS 2007 stuff to the new server environment without impacting data. The last three scary words “… without impacting data…” were actually putting pressure on my head. Moreover SSP was required to move because additional information has been added for users apart from AD import.   I thought I had to do only backup and restore. It appeared pretty easy at first thought. Just because of these damn scary words, I thought to check out on internet for guidance related to this scenario. I couldn’t get anything except general guidance of moving server on Microsoft TechNet site. I promised myself for starting blogs with this post if I would be successful in this task. Well, I took long time to write this but finally made it. I hope it will be useful to all guys looking for SharePoint server movement.   Before beginning restoration, make sure that, there is no difference in versions of SharePoint at source and destination server. Also check whether the state of SharePoint Installation at the time of backup and restore is same or not. (E.g. SharePoint related service packs and patches if any)   The main tasks of the server movement are as follow:   Backup all the databases Install and configure SharePoint on new environment Deploy all solution (WSP Files) globally to destination server- for installing features attached to the solutions Install all the custom features Deploy/Copy custom pages/files which are added to the “12Hive” folder later Restore SSP Restore My Site Restore other web application   Tasks 3 to 5 are for making sure that we have configured the environment well enough for the web application to be restored successfully. The main and complex task was restoring SSP. I have started restoring SSP through Central Admin. After a while, the restoration status was updated to “unsuccessful”. “Damn it, what went wrong?” I thought looking at the error detail down the page. I couldn’t remember the error message but I had corrected and restored it again.   Actually once you fail restoring SSP, until and unless you don’t clean all related stuff well, your restoration will be failed again and again. I wanted to find the actual reason. So cleaned, restored, cleaned, restored… I had tried almost 5-6 times and finally, I succeeded. I had realized how pleasant it is, to see the word “Successful” on the screen. Without wasting your much time to read, let me write all the detailed steps of restoring SSP:   Delete the SSP through following STSADM command. stsadm -o deletessp -title <SSP name> -deletedatabases -force e.g.: stsadm -o deletessp -title SharedServices1 -deletedatabases –force Check and delete the web application associated with SSP if it exists. Remove Link from Check and remove “Alternate Access Mapping” associated with SSP if it exists. Check and delete IIS site as well as application pool associated with SSP if it exists. Stop following services: ·         Office SharePoint Server Search ·         Windows SharePoint Services Search ·         Windows SharePoint Services Help Search Delete all the databases associated/related to SSP from SQL Server. Reset IIS. Start again following services: ·         Office SharePoint Server Search ·         Windows SharePoint Services Search ·         Windows SharePoint Services Help Search Restore the new SSP.   After the SSP restoration, all other stuffs had completed very smoothly without any more issues. I did few modifications to sites for change of server name and finally, the new environment was ready.

    Read the article

  • Lubuntu upgrade to 13.04 killed sound with ALSA. How to troubleshoot?

    - by Sven
    After upgrading to 13.04 from 12.10 Lubuntu lost audio playback after unplugging usb soundcard (Polycom) and plugging it back in. Volume control was gray and leading to pulseaudio mixer (not installed) so I uninstalled the pulseaudio package. I also removed and reinstalled the alsa-base package. After restart I have the alsamixer back everything seemingly as usual(volume 100%, unmute) but every sound program gets me errors no matter what device I select. aplay -L: null Discard all samples (playback) or generate zero samples (capture) pulse PulseAudio Sound Server default:CARD=NVidia HDA NVidia, ALC662 rev1 Analog Default Audio Device sysdefault:CARD=NVidia HDA NVidia, ALC662 rev1 Analog Default Audio Device front:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog Front speakers surround40:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog 4.0 Surround output to Front and Rear speakers surround41:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog 4.1 Surround output to Front, Rear and Subwoofer speakers surround50:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog 5.0 Surround output to Front, Center and Rear speakers surround51:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog 5.1 Surround output to Front, Center, Rear and Subwoofer speakers surround71:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog 7.1 Surround output to Front, Center, Side, Rear and Woofer speakers iec958:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Digital IEC958 (S/PDIF) Digital Audio Output hdmi:CARD=NVidia,DEV=0 HDA NVidia, HDMI 0 HDMI Audio Output dmix:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog Direct sample mixing device dmix:CARD=NVidia,DEV=1 HDA NVidia, ALC662 rev1 Digital Direct sample mixing device dmix:CARD=NVidia,DEV=3 HDA NVidia, HDMI 0 Direct sample mixing device dsnoop:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog Direct sample snooping device dsnoop:CARD=NVidia,DEV=1 HDA NVidia, ALC662 rev1 Digital Direct sample snooping device dsnoop:CARD=NVidia,DEV=3 HDA NVidia, HDMI 0 Direct sample snooping device hw:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog Direct hardware device without any conversions hw:CARD=NVidia,DEV=1 HDA NVidia, ALC662 rev1 Digital Direct hardware device without any conversions hw:CARD=NVidia,DEV=3 HDA NVidia, HDMI 0 Direct hardware device without any conversions plughw:CARD=NVidia,DEV=0 HDA NVidia, ALC662 rev1 Analog Hardware device with all software conversions plughw:CARD=NVidia,DEV=1 HDA NVidia, ALC662 rev1 Digital Hardware device with all software conversions plughw:CARD=NVidia,DEV=3 HDA NVidia, HDMI 0 Hardware device with all software conversions default:CARD=Communicator Default Audio Device sysdefault:CARD=Communicator Default Audio Device front:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio Front speakers surround40:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio 4.0 Surround output to Front and Rear speakers surround41:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio 4.1 Surround output to Front, Rear and Subwoofer speakers surround50:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio 5.0 Surround output to Front, Center and Rear speakers surround51:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio 5.1 Surround output to Front, Center, Rear and Subwoofer speakers surround71:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio 7.1 Surround output to Front, Center, Side, Rear and Woofer speakers iec958:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio IEC958 (S/PDIF) Digital Audio Output dmix:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio Direct sample mixing device dsnoop:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio Direct sample snooping device hw:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio Direct hardware device without any conversions plughw:CARD=Communicator,DEV=0 Polycom Communicator, USB Audio Hardware device with all software conversions etc/asound.conf: defaults.ctl.card 1 defaults.pcm.card 1 defaults.pcm.device 1 Following gets same result with both devices. aplay -vv -D front:CARD=NVidia,DEV=0 "Release the Pressure.wav": Playing WAVE 'Release the Pressure.wav' : Signed 16 bit Little Endian, Rate 44100 Hz, Mono aplay: set_params:1087: Channels count non available Guayadeque mp3 playback: AL lib: alsa_open_playback: Could not open playback device 'default': No such file or directory 21:32:14: Error: Gstreamer error 'Configured audiosink playbackbin is not working.' Audacious: ALSA error: snd_mixer_attach failed: No such file or directory. ALSA error: snd_pcm_open failed: No such device. So How do I fix my audio? UPDATE: I removed the usb soundcard and got rid of all alsa config. Everything is working as before the install but it sure feels fragile.

    Read the article

  • Have Your Cake and Eat it Too: Industry Best Practices + Flexibility

    - by Oracle Accelerate for Midsize Companies
    By Richard Garraputa, VP of Sales & Marketing, brij Richard joined brij in 1996 after graduating from the University of North Carolina at Greensboro with degrees in Information Systems and Accounting. He directs brij’s overall strategies of both the business development and marketing departments. Companies looking for new ERP systems spend so much time comparing features and functions of software products but too often short change the value of their own processes.  Company managers I meet often claim that they are implementing a new ERP system so they can perform better and faster.  When asked how, the answer is often “by implementing best practices”.  But the term ‘best practices’ is frequently used to mean ‘doing things the way everyone else does them’ rather than a starting point or benchmark to build upon by adding your own value. Of course, implementing standardized processes across an enterprise is an important step in improving operational efficiencies.  But not all companies are alike.  Do you ever tell your customers “We are just like our competition and have no competitive differentiation”?  Probably not.  So why should the implementation of your business processes be just like your competitor’s?  Even within the same industry, companies differentiate themselves by leveraging their unique expertise and approach to business.  These unique aspects—the competitive differentiators that companies use to thrive in a crowded marketplace—can and should be supported by the implementation of business systems like ERP. Modern ERP systems like Oracle’s JD Edwards EnterpriseOne have a broad and deep functional footprint designed to integrate a company’s core operations.  But how can a company take advantage of this footprint without blowing up their implementation budget?  Some ERP vendors claim to solve this challenge by stating that their systems come pre-configured with ‘best practices’.  Too often what they are really saying is that you will have to abandon your key operational differentiators to fit a vendor’s template for your business—or extend your implementation and postpone the realization of any benefits. Thankfully for midsize companies, there is an alternative to the undesirable options of extended implementation projects or abandoning their competitive differentiators.  Oracle Accelerate Solutions speed the time it takes to implement JD Edwards EnterpriseOne solution based on your unique business characteristics, getting your new ERP system up and running faster without forcing your business to fit a cookie-cutter solution. We’ve been a JD Edwards implementation partner since 1986 and we now leverage Oracle Business Accelerators—cloud based rapid implementation tools built and maintained by Oracle. Oracle Business Accelerators deliver the benefits of embedded industry best practices without forcing every customer in to one set of processes like many template or “clone and go” approaches do. You retain the ability to reconfigure your applications—without customization—as your business changes. Wielded by Oracle partners with industry-specific domain expertise, Oracle Accelerate Solution implementations powered by Oracle Business Accelerators help automate the application configuration to fit your business better, faster. For example, on a recent project at a manufacturing company, the project manager told me that Oracle Business Accelerators helped get them to Conference Room Pilot 20% faster than with a traditional approach. Time savings equal cost savings. And if ‘better and faster’ is your goal for your business performance, shouldn’t it be the goal for your ERP implementation as well? Established in 1986, brij has been dedicated solely to helping its customers implement Oracle’s JD Edwards solutions and to maximize the value of those customers’ IT investments. They are a Gold level member in Oracle PartnerNetwork and an Oracle Accelerate Solution provider.

    Read the article

  • IP Micro-outages, telephone micro-outages, and CATV micro-outages

    - by Michael Graff
    This is a long and complicated question, mostly because it has been going on for 2.5 years without a solution in sight. It also is only one-third computer related, the other two-thirds are cable TV and cable-phone related. Background I have COX Communications for a cable provider, and we get Internet, digital cable TV, and digital phone service through them. The Internet is a SB5101 right now, and has been a DPC2100 and SB5120 in the past. Same results. The phone service is provided through a telephone interface mounted on the outside of the house (not classic VoIP) and the CATV is through a Scientific Atlanta receiver without DVR. I do have a TiVo connected to the CATV box. Symptoms The CATV shows "blocking" -- sometimes very very short duration where a few blocks appear on the screen. Sometimes it lasts long enough that the video "pauses" for 2-5 seconds, and rarely but not unseen the audio also fails. The CATV decoder box shows no correctable (FEC) or uncorrectable errors. That is, all BER counters are zero for the video stream. The Internet shows "micro-outages" where it appears that sent packets are not making it out, but I continue to receive packets from local modems. That is, pings stop coming back, but I continue to see modems broadcast for DHCP, and sometimes they ask more than once. The cable modem shows no errors during this time, but cable modems lie like you would not believe. It is actually possible to unplug the coax from the modem for 20 seconds and it reports NO ERRORS to the provider's tools. The phone service cuts out for 1-3 seconds, infrequently. When this happens, I hear NOTHING (not even comfort noise) and the remote side hears a "click" as if I were getting a call waiting message. However, there is no call incoming, other than the one I'm currently on of course. Things SEEM to happen more frequently when the temperature outside swings from cold to warm, so fall/spring seems worse than summer/winter. All micro-outages occur between once or twice a day (which I could ignore) to 10 times per hour. All SNR, signal levels, noise levels, etc. show very close to optimal when measured. COX's diagnosis This is a continual pain for me. Over the last 2.5 years, they have opened, "fixed" something, and closed the tickets. They close it without confirming that it is indeed better, and when I reopen they cannot do that, but instead they open a new ticket and send yet another low-level tech out to do the same signal tests and report that all is OK. I've finally gotten a line tech who has a clue and is motivated enough to pursue this with me. We have tried things like switching the local nodes over to UPS and generator power, but this does not trigger the noise. We have tried replacing all cabling, the tap outside my house, the modem, the CATV decoder -- all without resolution. Recently they have decided it is both my computer or switch, my TiVo, and my phone that are all broken and causing this issue. My debugging steps I spent the worse day of my TV-watching life yesterday and part of today. I watched live TV without the TiVo. I witnessed blocking, but it did "feel different." and was actually more severe. Some days it is better, some days it is worse, so perhaps this was just a very bad day. Today, I connected the TiVo to my DVD player, and ran two very long movies through it. I saw no blocking at all during nearly 6 hours of video. Suggestions? Does anyone have any suggestions on what to do next? I understand perhaps only the IP side can be addressed here, but it is one of the more limiting debugging options.

    Read the article

  • Know your Data Lineage

    - by Simon Elliston Ball
    An academic paper without the footnotes isn’t an academic paper. Journalists wouldn’t base a news article on facts that they can’t verify. So why would anyone publish reports without being able to say where the data has come from and be confident of its quality, in other words, without knowing its lineage. (sometimes referred to as ‘provenance’ or ‘pedigree’) The number and variety of data sources, both traditional and new, increases inexorably. Data comes clean or dirty, processed or raw, unimpeachable or entirely fabricated. On its journey to our report, from its source, the data can travel through a network of interconnected pipes, passing through numerous distinct systems, each managed by different people. At each point along the pipeline, it can be changed, filtered, aggregated and combined. When the data finally emerges, how can we be sure that it is right? How can we be certain that no part of the data collection was based on incorrect assumptions, that key data points haven’t been left out, or that the sources are good? Even when we’re using data science to give us an approximate or probable answer, we cannot have any confidence in the results without confidence in the data from which it came. You need to know what has been done to your data, where it came from, and who is responsible for each stage of the analysis. This information represents your data lineage; it is your stack-trace. If you’re an analyst, suspicious of a number, it tells you why the number is there and how it got there. If you’re a developer, working on a pipeline, it provides the context you need to track down the bug. If you’re a manager, or an auditor, it lets you know the right things are being done. Lineage tracking is part of good data governance. Most audit and lineage systems require you to buy into their whole structure. If you are using Hadoop for your data storage and processing, then tools like Falcon allow you to track lineage, as long as you are using Falcon to write and run the pipeline. It can mean learning a new way of running your jobs (or using some sort of proxy), and even a distinct way of writing your queries. Other Hadoop tools provide a lot of operational and audit information, spread throughout the many logs produced by Hive, Sqoop, MapReduce and all the various moving parts that make up the eco-system. To get a full picture of what’s going on in your Hadoop system you need to capture both Falcon lineage and the data-exhaust of other tools that Falcon can’t orchestrate. However, the problem is bigger even that that. Often, Hadoop is just one piece in a larger processing workflow. The next step of the challenge is how you bind together the lineage metadata describing what happened before and after Hadoop, where ‘after’ could be  a data analysis environment like R, an application, or even directly into an end-user tool such as Tableau or Excel. One possibility is to push as much as you can of your key analytics into Hadoop, but would you give up the power, and familiarity of your existing tools in return for a reliable way of tracking lineage? Lineage and auditing should work consistently, automatically and quietly, allowing users to access their data with any tool they require to use. The real solution, therefore, is to create a consistent method by which to bring lineage data from these data various disparate sources into the data analysis platform that you use, rather than being forced to use the tool that manages the pipeline for the lineage and a different tool for the data analysis. The key is to keep your logs, keep your audit data, from every source, bring them together and use the data analysis tools to trace the paths from raw data to the answer that data analysis provides.

    Read the article

  • Introducing the Oracle Linux Playground yum repo

    - by wcoekaer
    We just introduced a new yum repository/channel on http://public-yum.oracle.com called the playground channel. What we started doing is the following: When a new stable mainline kernel is released by Linus or GregKH, we internally build RPMs to test it and do some QA work around it to keep track of what's going on with the latest development kernels. It helps us understand how performance moves up or down and if there are issues, we try to help look into them and of course send that stuff back upstream. Many Linux users out there are interested in trying out the latest features but there are some potential barriers to do this. (1) in general, you are looking at an upstream development distribution, which means that everything changes both in userspace(random applications) and kernel. Projects like Fedora are very useful and someone that wants to just see how the entire distribution evolves with all the changes, this is a great way to be current. A drawback here, though, is that if you have applications that are not part of the distribution, there's a lot of manual work involved or they might just not work because the changes are too drastic. The introduction of systemd is a good example. (2) when you look at many of our customers, that are interested in our database products or applications, the starting point of having a supported/certified userspace/distribution, like Oracle Linux, is a much easier way to get your feet wet in seeing what new/future Linux kernel enhancements could do. This is where the playground channel comes into play. When you install Oracle Linux 6 (which anyone can download and use from http://edelivery.oracle.com/linux), grab the latest public yum repository file http://public-yum.oracle.com/public-yum-ol6.repo, put it in /etc/yum.repos.d and enable the playground repo : [ol6_playground_latest] name=Latest mainline stable kernel for Oracle Linux 6 ($basearch) - Unsupported baseurl=http://public-yum.oracle.com/repo/OracleLinux/OL6/playground/latest/$basearch/ gpgkey=http://public-yum.oracle.com/RPM-GPG-KEY-oracle-ol6 gpgcheck=1 enabled=1 Now, all you need to do : type yum update and you will be downloading the latest stable kernel which will install cleanly on Oracle Linux 6. Thus you end up with a stable Linux distribution where you can install all your software, and then download the latest stable kernel (at time of writing this is 3.6.7) without having to recompile a kernel, without having to jump through hoops. There is of course a big, very important disclaimer this is NOT for PRODUCTION use. We want to try and help make it easy for people that are interested, from a user perspective, where the Linux kernel is going and make it easy to install and use it and play around with new features. Without having to learn how to compile a kernel and without necessarily having to install a complete new distribution with all the changes top to bottom. So we don't or won't introduce any new userspace changes, this project really is around making it easy to try out the latest upstream Linux kernels in a very easy way on an environment that's stable and you can keep current, since all the latest errata for Oracle Linux 6 are published on the public yum repo as well. So one repository location for all your current changes and the upstream kernels. We hope that this will get more users to try out the latest kernel and report their findings. We are always interested in understanding stability and performance characteristics. As new features are going into the mainline kernel, that could potentially be interesting or useful for various products, we will try to point them out on our blogs and give an example on how something can be used so you can try it out for yourselves. Anyway, I hope people will find this useful and that it will help increase interested in upstream development beyond reading lkml by some of the more non-kernel-developer types.

    Read the article

  • Why does my computer run slowly and freeze sometimes?

    - by Brae
    EDIT I disabled sound in the BIOS, rebooted and it hung. I removed the (previously) faulty HDD, rebooted and it hung. I have managed to get my Realtek audio manager open again after its mysterious disappearance. Subsequently my microphone is now working again, to fix it I had to uninstall audio drivers, disable audio in BIOS, install audio drivers, enable audio in BIOS. Access via network (with faulty HDD in) seems to not be triggering hangs at the moment. I think with the sound problem fixed it might play a little nicer, but I think its still going to hang. If it does, then I'm fairly sure its been narrowed down to the mobo. EDIT Pretty convinced my motherboard is the culprit, because nothing else seems to have any obvious problems (bar the hard drive, which the PC still hangs without it being plugged in) So thank you all for helping, once I get more rep ill up a few of the answers. My PC is doing some weird things... Sometimes when I open up a program, lets say Adobe Photoshop, it will load everything normally, nice and quick no problems and I can use it fine. Other times its a little odd, and it loads the program as if it's only using half of the CPU. It's pretty obvious when it does it, normally the loading screen skims past, but when it does this weird load you see it slowly tick though each thing, and the program itself becomes incredibly slow. Even Google Chrome does it sometimes. Yet when I exit and reopen the program without doing anything else, it typically opens fine without lagging. I think this problem is probably a symptom of something bigger, because of other problems I'm having. Random hangs; no matter what I have open or what I'm doing. My PC will sort of freeze up for a few seconds. If music is playing it will either loop the last second or two, or it will buzz. This only lasts for a few seconds then it returns to normal without having to restart. During this time all programs lock up and freeze, and the mouse and keyboard are useless. I am also having a weird issue with my audio jacks, without touching my PC at all, sometimes I will see a popup saying that I have unplugged something or plugged something in, neither of which has actually happened. Pretty sure this is cause by the motherboard. I recently had a 'Pink Screen of Death' (yes pink) which pointed to my audio drivers. The lockups seem to happen with some consistency when someone is accessing my shared files via my home LAN. Which leads me to believe either one of my hard drives is acting up or more likely the controller. One of my drives had a bit of a crash before, I used Spinrite and managed to recover my stuff and now the drive appears to be working okay. This is possibly adding to the problems. My best guess is something has gone wrong with my motherboard, possibly a power issue or a chip has died, I really don't know. So what I would like to know is: Have I have missed some obvious diagnostic to help figure out what it is, or should I just bite the bullet and assume its my motherboard acting up and buy a new system? dxdiag[64-bit] - http://pastebin.com/G30kb2TL PSOD (minidump) - http://pastebin.com/aZsv0H56 HWiNFO64 (system info / specs) - http://pastebin.com/X6h3K8g6

    Read the article

  • Can I select 0 columns in SQL Server?

    - by Woody Zenfell III
    I am hoping this question fares a little better than the similar Create a table without columns. Yes, I am asking about something that will strike most as pointlessly academic. It is easy to produce a SELECT result with 0 rows (but with columns), e.g. SELECT a = 1 WHERE 1 = 0. Is it possible to produce a SELECT result with 0 columns (but with rows)? e.g. something like SELECT NO COLUMNS FROM Foo. (This is not valid T-SQL.) I came across this because I wanted to insert several rows without specifying any column data for any of them. e.g. (SQL Server 2005) CREATE TABLE Bar (id INT NOT NULL IDENTITY PRIMARY KEY) INSERT INTO Bar SELECT NO COLUMNS FROM Foo -- Invalid column name 'NO'. -- An explicit value for the identity column in table 'Bar' can only be specified when a column list is used and IDENTITY_INSERT is ON. One can insert a single row without specifying any column data, e.g. INSERT INTO Foo DEFAULT VALUES. One can query for a count of rows (without retrieving actual column data from the table), e.g. SELECT COUNT(*) FROM Foo. (But that result set, of course, has a column.) I tried things like INSERT INTO Bar () SELECT * FROM Foo -- Parameters supplied for object 'Bar' which is not a function. -- If the parameters are intended as a table hint, a WITH keyword is required. and INSERT INTO Bar DEFAULT VALUES SELECT * FROM Foo -- which is a standalone INSERT statement followed by a standalone SELECT statement. I can do what I need to do a different way, but the apparent lack of consistency in support for degenerate cases surprises me. I read through the relevant sections of BOL and didn't see anything. I was surprised to come up with nothing via Google either.

    Read the article

  • Problem installing RMagick rubygem on Centos 5

    - by Keith Pitty
    I'm having problems installing the RMagick rubygem on Centos 5. I've followed the steps detailed in http://rmagick.rubyforge.org/install2-linux.html but when I try: sudo gem install rmagick the result is: Building native extensions. This could take a while... ERROR: Error installing rmagick: ERROR: Failed to build gem native extension. /usr/local/bin/ruby extconf.rb checking for Ruby version >= 1.8.5... yes checking for gcc... yes checking for Magick-config... no Can't install RMagick 2.11.0. Can't find Magick-config in /usr/bin:/bin *** extconf.rb failed *** Could not create Makefile due to some reason, probably lack of necessary libraries and/or headers. Check the mkmf.log file for more details. You may need configuration options. Provided configuration options: --with-opt-dir --without-opt-dir --with-opt-include --without-opt-include=${opt-dir}/include --with-opt-lib --without-opt-lib=${opt-dir}/lib --with-make-prog --without-make-prog --srcdir=. --curdir --ruby=/usr/local/bin/ruby Gem files will remain installed in /usr/local/lib/ruby/gems/1.8/gems/rmagick-2.11.0 for inspection. Results logged to /usr/local/lib/ruby/gems/1.8/gems/rmagick-2.11.0/ext/RMagick/gem_make.out The directory /usr/local/bin contains Magick-config but I haven't been able to get rubygems to look there. I tried the following but the result was the same: sudo gem install rmagick -- --with-opt-dir=/usr/local/bin Any suggestions would be appreciated.

    Read the article

  • Android ignores scrollbarsize

    - by Maragues
    Hi, I'm trying to modify a ListView scrollbar's width without success <ListView android:id="@+id/android:list" android:layout_width="fill_parent" android:layout_height="wrap_content" android:choiceMode="singleChoice" android:scrollbars="vertical" android:scrollbarTrackVertical="@drawable/scrollbar_vertical_track" android:scrollbarThumbVertical="@drawable/scrollbar_vertical_thumb" android:scrollbarSize="4px" android:clickable="true"/> First I tried using a drawable image 4px wide, but the .png was resized. Then I tried using a shape extracted from SamplesApi, without success. <shape xmlns:android="http://schemas.android.com/apk/res/android" android:width="40px"> <gradient android:startColor="#505050" android:endColor="#C0C0C0" android:angle="0"/> <corners android:radius="0dp" /> I've tried with and without the android:width attribute. There's a question on the same topic (http://stackoverflow.com/questions/2565083/width-of-a-scroll-bar-in-android), but it doesn't try anything different that what I'm already trying. As far as I know, creating my own theme shouldn't change the output. There's an example in SamplesApi (Views/ScrollBars). I tried modifying the scrollbarSize attribute without result. I know about ninepatch images, but there's an attribute which should do what I want. Any hint? Thanks in advance.

    Read the article

  • How do I avoid repetition in Java ResourceBundle strings?

    - by Trejkaz
    We had a lot of strings which contained the same sub-string, from sentences about checking the log or how to contact support, to branding-like strings containing the company or product name. The repetition was causing a few issues for ourselves (primarily typos or copy/paste errors) but it also causes issues in that it increases the amount of text our translator has to translate. The solution I came up with went something like this: public class ExpandingResourceBundleControl extends ResourceBundle.Control { public static final ResourceBundle.Control EXPANDING = new ExpandingResourceBundleControl(); private ExpandingResourceBundleControl() { } @Override public ResourceBundle newBundle(String baseName, Locale locale, String format, ClassLoader loader, boolean reload) throws IllegalAccessException, InstantiationException, IOException { ResourceBundle inner = super.newBundle(baseName, locale, format, loader, reload); return inner == null ? null : new ExpandingResourceBundle(inner, loader); } } ExpandingResourceBundle delegates to the real resource bundle but performs conversion of {{this.kind.of.thing}} to look up the key in the resources. Every time you want to get one of these, you have to go: ResourceBundle.getBundle("com/acme/app/Bundle", EXPANDING); And this works fine -- for a while. What eventually happens is that some new code (in our case autogenerated code which was spat out of Matisse) looks up the same resource bundle without specifying the custom control. This appears to be non-reproducible if you write a simple unit test which calls it with and then without, but it occurs when the application is run for real. Somehow the cache inside ResourceBundle ejects the good value and replaces it with the broken one. I am yet to figure out why and Sun's jar files were compiled without debug info so debugging it is a chore. My questions: Is there some way of globally setting the default ResourceBundle.Control that I might not be aware of? That would solve everything rather elegantly. Is there some other way of handling this kind of thing elegantly, perhaps without tampering with the ResourceBundle classes at all?

    Read the article

  • Is there a disassembler + debugger for java (ala OllyDbg / SoftICE for assembler)?

    - by Ran Biron
    Is there a utility similar to OllyDbg / SoftICE for java? I.e. execute class (from jar / with class path) and, without source code, show the disassembly of the intermediate code with ability to step through / step over / search for references / edit specific intermediate code in memory / apply edit to file... If not, is it even possible to write something like this (assuming we're willing to live without hotspot for the debug duration)? Edit: I'm not talking about JAD or JD or Cavaj. These are fine decompilers, but I don't want a decompiler for several reasons, most notable is that their output is incorrect (at best, sometimes just plain wrong). I'm not looking for a magical "compiled bytes to java code" - I want to see the actual bytes that are about to be executed. Also, I'd like the ability to change those bytes (just like in an assembly debugger) and, hopefully, write the changed part back to the class file. Edit2: I know javap exists - but it does only one way (and without any sort of analysis). Example (code taken from the vmspec documentation): From java code, we use "javac" to compile this: void setIt(int value) { i = value; } int getIt() { return i; } to a java .class file. Using javap -c I can get this output: Method void setIt(int) 0 aload_0 1 iload_1 2 putfield #4 5 return Method int getIt() 0 aload_0 1 getfield #4 4 ireturn This is OK for the disassembly part (not really good without analysis - "field #4 is Example.i"), but I can't find the two other "tools": A debugger that goes over the instructions themselves (with stack, memory dumps, etc), allowing me to examine the actual code and environment. A way to reverse the process - edit the disassembled code and recreate the .class file (with the edited code).

    Read the article

  • Swing: what to do when a JTree update takes too long and freezes other GUI elements?

    - by java.is.for.desktop
    Hello, everyone! I know that GUI code in Java Swing must be put inside SwingUtilities.invokeAndWait or SwingUtilities.invokeLater. This way threading works fine. Sadly, in my situation, the GUI update it that thing which takes much longer than background thread(s). More specific: I update a JTree with about just 400 entries, nesting depth is maximum 4, so should be nothing scary, right? But it takes sometimes one second! I need to ensure that the user is able to type in a JTextPane without delays. Well, guess what, the slow JTree updates do cause delays for JTextPane during input. It refreshes only as soon as the tree gets updated. I am using Netbeans and know empirically that a Java app can update lots of information without freezing the rest of the UI. How can it be done? NOTE 1: All those DefaultMutableTreeNodes are prepared outside the invokeAndWait. NOTE 2: When I replace invokeAndWait with invokeLater the tree doesn't get updated. NOTE 3: Fond out that recursive tree expansion takes far the most time. NOTE 4: I'm using custom tree cell renderer, will try without and report. NOTE 4a: My tree cell renderer uses a map to cache and reuse created JTextComponents, depending on tree node (as a key). CLUE 1: Wow! Without setting custom cell renderer it's 10 times faster. I think, I'll need few good tutorials on writing custom tree cell renderers.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >