Search Results

Search found 6881 results on 276 pages for 'storage spaces'.

Page 215/276 | < Previous Page | 211 212 213 214 215 216 217 218 219 220 221 222  | Next Page >

  • SoundPool.load() and FileDescriptor from file

    - by Hans
    I tried using the load function of the SoundPool that takes a FileDescriptor, because I wanted to be able to set the offset and length. The File is not stored in the Ressources but a file on the storage card. Even though neither the load nor the play function of the SoundPool throw any Exception or print anything to the console, the sound is not played. Using the same code, but use the file path string in the SoundPool constructor works perfectly. This is how I have tried the loading (start equals 0 and length is the length of the file in miliseconds): FileInputStream fileIS = new FileInputStream(new File(mFile)); mStreamID = mSoundPool.load(fileIS.getFD(), start, length, 0); mPlayingStreamID = mSoundPool.play(mStreamID, 1f, 1f, 1, 0, 1f); If I would use this, it works: mStreamID = mSoundPool.load(mFile, 0); mPlayingStreamID = mSoundPool.play(mStreamID, 1f, 1f, 1, 0, 1f); Any ideas anyone? Thanks

    Read the article

  • The mathematics of Schellings segregation model

    - by Bruce
    For those who don't know the model. You can read this pdf. I want to find what is the probability that 2 nodes are each others neighbors when the algorithm converges (i.e. when all nodes are happy). Here's the model in a gist. You have a grid (say 10x10). You have nodes of two kind (red and green) 45 each. So we have 10 empty spaces. We randomly place the nodes on the grid. Now we scan through this grid (Exact order does not matter according to Schelling). Each node wants a specific percentage of people of same kind in its Moore neighborhood (say b = 50% for each red and green). We calculate the happiness of each node (a = Number of neighbors of same kind/Number of neighbors of different kind). If a node is unhappy (a < b) it moves to an empty cell where it knows it will be happy. This movement can change the dynamics of old as well as new neighborhood. Algorithm converges when all nodes are happy. PS - I am looking for links for any mathematical analysis of the Schelling's model.

    Read the article

  • Excess errors on model from somewhere

    - by gmile
    I have a User model, and use an acts_as_authentic (from authlogic) on it. My User model have 3 validations on username and looks as following: User < ActiveRecord::Base acts_as_authentic validates_presence_of :username validates_length_of :username, :within => 4..40 validates_uniqueness_of :username end I'm writing a test to see my validations in action. Somehow, I get 2 errors instead of one when validating a uniqueness of a name. To see excess error, I do the following test: describe User do before(:each) do @user = Factory.build(:user) end it "should have a username longer then 3 symbols" do @user2 = Factory(:user) @user.username = @user2.username @user.save puts @user.errors.inspect end end I got 2 errors on username: @errors={"username"=>["has already been taken", "has already been taken"]}. Somehow the validation passes two times. I think authlogic causes that, but I don't have a clue on how to avoid that. Another case of problem is when I set username to nil. Somehow I get four validation errors instead of three: @errors={"username"=>["is too short (minimum is 3 characters)", "should use only letters, numbers, spaces, and .-_@ please.", "can't be blank", "is too short (minimum is 4 characters)"]} I think authlogic is one that causes this strange behaviour. But I can't even imagine on how to solve that. Any ideas?

    Read the article

  • Add C pointer to NSMutableArray

    - by Georges Oates Larsen
    I am writing an Objective-C program that deals with low level image memory. I am using ANSI-C structs for my data storage -- Full blown objects seem overkill seeing as the data I am storing is 100% data, with no methods to operate on that data. Specifically, I am writing a customizable posterization algorithm which relies on an array of colors -- This is where things get tricky. I am storing my colors as structs of three floats, and an integer flag (related to the posterization algorithm specifically). Everyhting is going well, except for one thing... [actual question] I can't figure out how to add pointers to an NSMutableArray! I know how to add an object, but adding a pointer to a struct seems to be more difficult -- I do not want NSMutableArray dereferencing my pointer and treating the struct as some sort of strange object. I want NSMutableArray to add the pointer its self to its collection. How do I go about doing this? Thanks in advance, G

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Multi-process builds in Visual Studio 2010: Worth it?

    - by coryr
    I've started testing our C++ software with VS2010 and the build times are really bad (30-45 minutes, about double the VS2005 times). I've been reading about the /MP switch for multi-process compilation. Unfortunately, it is incompatible with some features that we use quite a bit like #import, incremental compilation, and precompiled headers. Have you had a similar project where you tried the /MP switch after turning off things like precompiled headers? Did you get faster builds? My machine is running 64-bit Windows 7 on a 4 core machine with 4 GB of RAM and a fast SSD storage. Virus scanner disabled and a pretty minimal software environment.

    Read the article

  • Stream classes ... design, pattern for creating views over streams

    - by ToxicAvenger
    A question regarding the design of stream classes - I need a pattern to create independent views over a single stream instance (in my case for reading). A view would be a consecutive part of the stream. The problem I have with the stream classes is that the state (reading or writing) is coupled with the underlying data/storage. So if I need to partition a stream into different segments (whether segments overlap or not doesn't matter), I cannot easily create views over the stream, the views would store start and end position. Because reading from a view - which would translate to reading from the underlying stream adjusted based on the start/end positions - would change the state of the underlying stream instance. So what I could do is take a read on a view instance, adjust the Position of the stream, read the chunks I need. But I cannot do that concurrently. Why is it designed in such a way, and what kind of pattern could I implement to create independet views over a single stream instance which would allow to read/write independently (and concurrently)?

    Read the article

  • Microsoft Access to SQL Server - synchronization

    - by David Pfeffer
    I have a client that uses a point-of-sale solution involving an Access database for its back-end storage. I am trying to provide this client with a service that involves, for SLA reasons, the need to copy parts of this Access database into tables in my own database server which runs SQL Server 2008. I need to do this on a periodic basis, probably about 5 times a day. I do have VPN connectivity to the client. Is there an easy programmatic way to do this, or an available tool? I don't want to handcraft what I assume is a relatively common task.

    Read the article

  • How do I tweak columns in a Flat File Destination in SSIS?

    - by theog
    I have an OLE DB Data source and a Flat File Destination in the Data Flow of my SSIS Project. The goal is simply to pump data into a text file, and it does that. Where I'm having problems is with the formatting. I need to be able to rtrim() a couple of columns to remove trailing spaces, and I have a couple more that need their leading zeros preserved. The current process is losing all the leading zeros. The rtrim() can be done by simple truncation and ignoring the truncation errors, but that's very inelegant and error prone. I'd like to find a better way, like actually doing the rtrim() function where needed. Exploring similar SSIS questions & answers on SO, the thing to do seems to be "Use a Script Task", but that's ususally just thrown out there with no details, and it's not at all an intuitive thing to set up. I don't see how to use scripting to do what I need. Do I use a Script Task on the Control Flow, or a Script Component in the Data Flow? Can I do rtrim() and pad strings where needed in a script? Anybody got an example of doing this or similar things? Many thanks in advance.

    Read the article

  • Consolidate loan, purchase & sale tables into one transaction table.

    - by Frank Computer
    INFORMIX-SE with ISQL 7.3: I have separate tables for Loan, Purchase & Sales transactions. Each tables rows are joined to their respective customer rows by: customer.id [serial] = loan.foreign_id [integer]; = purchase.foreign_id [integer]; = sale.foreign_id [integer]; I would like to consolidate the three tables into one table called "transaction", where a column: transaction.trx_type char(1) {L=Loan, P=Purchase, S=Sale} identifies the transaction type. Each transaction will be assigned a unique transaction number [serial]. Is this a good idea or is it better to keep them in separate tables? Storage space is not a concern, I think it would be easier programming & user-wise to have all types of transactions under one table, whenever possible. This implies denormalization.

    Read the article

  • How to obtain the panel within a treeview (WPF)

    - by sperling
    How can one obtain the panel that is used within a TreeView? I've read that by default TreeView uses a VirtualizingStackPanel for this. When I look at a TreeView template, all I see is <ItemsPresenter />, which seems to hide the details of what panel is used. Possible solutions: 1) On the treeview instance ("tv"), from code, do this: tv.ItemsPanel. The problem is, this does not return a panel, but an ItemsPanelTemplate ("gets or sets the template that defines the panel that controls the layout of the items"). 2) Make a TreeView template that explicitly replaces <ItemsPresenter /> with your own ItemsControl.ItemsPanel. I am providing a special template anyways, so this is fine in my scenario. Then give a part name to the panel that you place within that template, and from code you can obtain that part (i.e. the panel). The problem with this? see below. (I am using a control named VirtualTreeView which is derived from TreeView, as is seen below): , use following: -- [sorry folks about poor formatting here, this is my first post, I tried 4 spaces for code... doesn't seem to work?] [I stripped out all clutter here for visibility...] The problem with this is: this immediately overrides any TreeView layout mechanism. Actually, you just get a blank screen, even when you have TreeViewItems filling the tree. Well, the reason I want to get a hold of the panel is to take some part in the MeaureOverride, but without going into all of that, I certainly do not want to rewrite the book of how to layout a treeview. I.e., doing this the step #2 way seems to invalidate the point of even using a TreeView in the first place. Sorry if there is some confusion here, thanks for any help you can offer.

    Read the article

  • Python/Django Concatenate a string depending on whether that string exists

    - by Douglas Meehan
    I'm creating a property on a Django model called "address". I want address to consist of the concatenation of a number of fields I have on my model. The problem is that not all instances of this model will have values for all of these fields. So, I want to concatenate only those fields that have values. What is the best/most Pythonic way to do this? Here are the relevant fields from the model: house = models.IntegerField('House Number', null=True, blank=True) suf = models.CharField('House Number Suffix', max_length=1, null=True, blank=True) unit = models.CharField('Address Unit', max_length=7, null=True, blank=True) stex = models.IntegerField('Address Extention', null=True, blank=True) stdir = models.CharField('Street Direction', max_length=254, null=True, blank=True) stnam = models.CharField('Street Name', max_length=30, null=True, blank=True) stdes = models.CharField('Street Designation', max_length=3, null=True, blank=True) stdessuf = models.CharField('Street Designation Suffix',max_length=1, null=True, blank=True) I could just do something like this: def _get_address(self): return "%s %s %s %s %s %s %s %s" % (self.house, self.suf, self.unit, self.stex, self.stdir, self.stname, self.stdes, self.stdessuf) but then there would be extra blank spaces in the result. I could do a series of if statements and concatenate within each, but that seems ugly. What's the best way to handle this situation? Thanks.

    Read the article

  • segmentation fault in file operations in c

    - by mekasperasky
    #include<stdio.h> /* this is a lexer which recognizes constants , variables ,symbols, identifiers , functions , comments and also header files . It stores the lexemes in 3 different files . One file contains all the headers and the comments . Another file will contain all the variables , another will contain all the symbols. */ int main() { int i; char a,b[20],c; FILE *fp1; fp1=fopen("source.txt","r"); //the source file is opened in read only mode which will passed through the lexer //now lets remove all the white spaces and store the rest of the words in a file if(fp1==NULL) { perror("failed to open source.txt"); //return EXIT_FAILURE; } i=0; while(1) { a=fgetc(fp1); if(a !="") { b[i]=a; } else { fprintf(fp1, "%.20s\n", b); i=0; continue; } i=i+1; /*Switch(a) { case EOF :return eof; case '+':sym=sym+1; case '-':sym=sym+1; case '*':sym=sym+1; case '/':sym=sym+1; case '%':sym=sym+1; case ' */ } return 0; } how does this code end up in segmentation fault?

    Read the article

  • Hopefully simple topic to spark some good opinions, Question is MySQL or SQL Server???

    - by magellings
    I'm beginning development of a website and a high priority is for it to be extremely optimized, quick responses, etc. There will ultimately end up being large amounts of rows in the main tables (millions), so scalability is also important. It will need to use a database on the back-end for data storage and my web hosting service supports either MySQL or Sql Server. This website will be developed with .NET ASP.NET MVC with NHibernate (hopefully it can run in medium trust mode, as that is a requirement of my web hosting and reflection requirements of NHibernate may be problematic, maybe someone has a comment on this too). I'd also prefer to use the database that will require the least attention in regards to management. I don't want to have to be a DBA here. :) I wanted to through this topic out to the public to see what the community thinks? So MySQL or Sql Server, generally, which one would be better to use?

    Read the article

  • How can I use Amazon's API in PHP to search for books?

    - by TerranRich
    I'm working on a Facebook app for book sharing, reviewing, and recommendations. I've scoured the web, searched Google using every search phrase I could think of, but I could not find any tutorials on how to access the Amazon.com API for book information. I signed up for an AWS account, but even the tutorials on their website didn't help me one bit. They're all geared toward using cloud computing for file storage and processing, but that's not what I want. I just want to access their API to search info on books. Kind of like how http://openlibrary.org/ does it, where it's a simple URL call to get information on a book (but their databases aren't nearly as populated as Amazon's). Why is it so damned hard to find the information I need on Amazon's AWS site? If anybody could help, I would greatly appreciate it.

    Read the article

  • Using a password to generate two distinct hashes without reducing password security

    - by Nevins
    Hi there, I'm in the process of designing a web application that will require the storage of GPG keys in an encrypted format in a database. I'm planning on storing the user's password in a bCrypt hash in the database. What I would like to be able to do is to use that bCrypt to authenticate the user then use the combination of the stored bCrypt hash and another hash of the password to encrypt and decrypt the GPG keys. My question is whether I can do this without reducing the security of the password? I was thinking I may be able to use something like an HMAC-SHA256 of a static string using the password and a salt as the secret key. Is there a better way to do this that I haven't thought of? Thanks

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • Combine Search Bar and URL Bar into One (WebView)

    - by Jay Bush
    So I'm in the midst of updating my Web Browser app for iOS devices, from the ground up, and I'm trying to implement some more convenient features. One feature that seems to be really popular now, that I have been getting a lot of requests for, is the combination of a Google Search bar and a URL bar in one, like that of the Chrome application. Below is a screenshot of the Google Chrome app, and as you can see, they've made it so you can either enter in a search query like "apple ipad" and it will return a Google search page of 'Apple iPad', or you can enter in a URL "http://apple.com/ipad/" and it will load that URL. I have looked all over the internet, but all I could find were tutorials on how to Search Google with value of the UITextField. I have a feeling that the best way to do this is to probably make a 'check'. Like if the entered value contains 'http://' 'www.' '.com' or no spaces, then load it as a URL, if not then load it in a Google Search page, and then have the webview load up the Google Search page. If anybody could show me to the right direction, that would be great, or even supplying me with some code would be even greater. :) Thanks! If anyone needs part of the code, just ask.

    Read the article

  • GWT as offline app, to be deployed onto an iPad

    - by Maroloccio
    I often use GWT for web UIs. I have heard of it being used a fair bit in conjunction with Gears for offline solutions (probably nowadays HTML5 "offline storage" is all the rage) and I'd like to experiment with building a GUI in GWT and use it on my iPad. Tips/tutorials on how to deploy it onto the device to act as much as possible like a resident "App"? This is just a curiosity/experiment to fill a week-end... (I can "free" the iPad for the experiment if need be yet I am sure a lot can be done without doing so...)

    Read the article

  • How to check for a null object reference when validating forms in MVC

    - by quakkels
    Hello SO, I'm experimenting with validating forms in the asp.net MVC framework. I'm focusing on server side validation for the time being. I've come across an error that I'm not sure how to rectify. System.NullReferenceException: Object reference not set to an instance of an object. The code that throws the error is: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Create([Bind(Exclude="ID")] MembersCreate mc ) { mc.Modules = ModuleListDataContext.GetModuleList(); ViewData.Model = mc; //Validation using ModelState // // //line below errors when form field is empty // if ((string)mc.Member.Username.Trim() == "") ModelState.AddModelError("Member.Username", "Username is required."); if (!ModelState.IsValid) return View(); try { // TODO: Add insert logic here return RedirectToAction("Index","Home"); } catch { return View(); } } When I put spaces in the field it performs exactly as i want, but if I leave the field blank and press submit I get the error. What's the best way to avoid this error and still validate blank form fields? Thanks all -

    Read the article

  • Return lines in input code causing gaps/whitespace between elements in output?

    - by Jenny Zhang
    I am trying to put images next to each other on a webpage. Here is my HTML: <img class="pt" src="Yellow Tulip.jpg" title="Yellow Tulip" alt="Yellow Tulip" /> <img class="pt" src="Pink Tulip.jpg" title="Pink Tulip" alt="Pink Tulip" /> <img class="pt" src="Purple Tulip.jpg" title="Purple Tulip" alt="Purple Tulip" /> However, on my webpage, this shows a gap between each image. I've noticed that once I remove the return line that makes the elements separate and readable and instead just put all the elements on one line, the gaps go away. <img class="pt" src="Yellow Tulip.jpg" title="Yellow Tulip" alt="Yellow Tulip" /><img class="pt" src="Pink Tulip.jpg" title="Pink Tulip" alt="Pink Tulip" /><img class="pt" src="Purple Tulip.jpg" title="Purple Tulip" alt="Purple Tulip" /> Is there anyway I can achieve the output of the latter but still have the code/input look like the former? I really like the readability that the return lines (enter spaces) bring to the code, but I don't want the whitespace it creates on the actual page. If someone could explain why this is and/or how to fix it, I'd be really grateful! :)

    Read the article

  • Access violation using LocalAlloc()

    - by PaulH
    I have a Visual Studio 2008 Windows Mobile 6 C++ application that is using an API that requires the use of LocalAlloc(). To make my life easier, I created an implementation of a standard allocator that uses LocalAlloc() internally: /// Standard library allocator implementation using LocalAlloc and LocalReAlloc /// to create a dynamically-sized array. /// Memory allocated by this allocator is never deallocated. That is up to the /// user. template< class T, int max_allocations > class LocalAllocator { public: typedef T value_type; typedef size_t size_type; typedef ptrdiff_t difference_type; typedef T* pointer; typedef const T* const_pointer; typedef T& reference; typedef const T& const_reference; pointer address( reference r ) const { return &r; }; const_pointer address( const_reference r ) const { return &r; }; LocalAllocator() throw() : c_( NULL ) { }; /// Attempt to allocate a block of storage with enough space for n elements /// of type T. n>=1 && n<=max_allocations. /// If memory cannot be allocated, a std::bad_alloc() exception is thrown. pointer allocate( size_type n, const void* /*hint*/ = 0 ) { if( NULL == c_ ) { c_ = LocalAlloc( LPTR, sizeof( T ) * n ); } else { HLOCAL c = LocalReAlloc( c_, sizeof( T ) * n, LHND ); if( NULL == c ) LocalFree( c_ ); c_ = c; } if( NULL == c_ ) throw std::bad_alloc(); return reinterpret_cast< T* >( c_ ); }; /// Normally, this would release a block of previously allocated storage. /// Since that's not what we want, this function does nothing. void deallocate( pointer /*p*/, size_type /*n*/ ) { // no deallocation is performed. that is up to the user. }; /// maximum number of elements that can be allocated size_type max_size() const throw() { return max_allocations; }; private: /// current allocation point HLOCAL c_; }; // class LocalAllocator My application is using that allocator implementation in a std::vector< #define MAX_DIRECTORY_LISTING 512 std::vector< WIN32_FIND_DATA, LocalAllocator< WIN32_FIND_DATA, MAX_DIRECTORY_LISTING > > file_list; WIN32_FIND_DATA find_data = { 0 }; HANDLE find_file = ::FindFirstFile( folder.c_str(), &find_data ); if( NULL != find_file ) { do { // access violation here on the 257th item. file_list.push_back( find_data ); } while ( ::FindNextFile( find_file, &find_data ) ); ::FindClose( find_file ); } // data submitted to the API that requires LocalAlloc()'d array of WIN32_FIND_DATA structures SubmitData( &file_list.front() ); On the 257th item added to the vector<, the application crashes with an access violation: Data Abort: Thread=8e1b0400 Proc=8031c1b0 'rapiclnt' AKY=00008001 PC=03f9e3c8(coredll.dll+0x000543c8) RA=03f9ff04(coredll.dll+0x00055f04) BVA=21ae0020 FSR=00000007 First-chance exception at 0x03f9e3c8 in rapiclnt.exe: 0xC0000005: Access violation reading location 0x01ae0020. LocalAllocator::allocate is called with an n=512 and LocalReAlloc() succeeds. The actual Access Violation exception occurs within the std::vector< code after the LocalAllocator::allocate call: 0x03f9e3c8 0x03f9ff04 > MyLib.dll!stlp_std::priv::__copy_trivial(const void* __first = 0x01ae0020, const void* __last = 0x01b03020, void* __result = 0x01b10020) Line: 224, Byte Offsets: 0x3c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::_M_insert_overflow(_WIN32_FIND_DATAW* __pos = 0x01b03020, _WIN32_FIND_DATAW& __x = {...}, stlp_std::__true_type& __formal = {...}, unsigned int __fill_len = 1, bool __atend = true) Line: 112, Byte Offsets: 0x5c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::push_back(_WIN32_FIND_DATAW& __x = {...}) Line: 388, Byte Offsets: 0xa0 C++ MyLib.dll!Foo(unsigned long int cbInput = 16, unsigned char* pInput = 0x01a45620, unsigned long int* pcbOutput = 0x1dabfbbc, unsigned char** ppOutput = 0x1dabfbc0, IRAPIStream* __formal = 0x00000000) Line: 66, Byte Offsets: 0x1e4 C++ If anybody can point out what I may be doing wrong, I would appreciate it. Thanks, PaulH

    Read the article

  • Pull specific information from a long list with Perl

    - by melignus
    The file that I've got to work with here is the result of an LDAP extraction but I need to ultimately get the information formatted over to something that a spreadsheet can use. So, the data is as follows: DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: John Doe name: ##userName DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: Jane Doe name: ##userName DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData DataDataDataDataDataDataDataDataDataDataDataDataDataDataDataData displayName: Ted Doe name: ##userName The format that I need to export to is: firstName lastName userName firstName lastName userName firstName lastName userName Where the spaces are tabs so I can then impor that file into a database. I have experience doing this in VBScript but I'm trying to switch over to using Perl for as much server administration as possible. I'm not sure on the syntax for what I want which is basically while not endoffile{ detect "displayName: " & $firstName & " " & $lastName detect "name: ##" & $userName write $firstName tab $lastName tab $userName to file } Also if someone could point me to a resource specifically on the text parsing syntax that Perl uses, I'd be very grateful. Most of the resources that I've come across haven't been very helpful.

    Read the article

  • Is it possible to transfer data between html pages driven by spring web flow?

    - by Easwaramoorthy Kanagaraj
    I am aware of passing data between jsp in spring web flow. Is it possible to transfer data between html pages driven by spring web flow. I don't want to use the HTML5 local storage capabilities. Example: Page 1: Search box for an employee id. Page 2: Search result for the employee details. Two ways that I could think: Get the employee details in page 1 by ajax and pass the result to the page two. Pass the employee id to page 2 and get the result by ajax in onload. In both case I need to pass any variable/data. I am confused in doing this. Is there anything in the Spring webflow using which I could do this? Thanks in advance, Easwar

    Read the article

  • Free and Simple Hosting Solution with DB Support?

    - by darren
    Hi everyone I have compiled an sqlite database that I would like to make public. I want to provide a very simple webpage that has a few form elements which are used to query the database. Does anybody know of a free hosting solution that would provide me with free web and database functionality? I am familiar with Google App Engine and that would work but I don't want to spend time using their custom storage scheme. I'm looking for something free that I can put together very quickly. Thanks for any suggestions.

    Read the article

< Previous Page | 211 212 213 214 215 216 217 218 219 220 221 222  | Next Page >