Search Results

Search found 29053 results on 1163 pages for 'line spacing'.

Page 216/1163 | < Previous Page | 212 213 214 215 216 217 218 219 220 221 222 223  | Next Page >

  • how to pass the parameters to the urlconnection in java/android?

    - by androidbase
    hi all, i can establish a connection using HttpUrlConnection. my code below. client = new DefaultHttpClient(); URL action_url = new URL(actionUrl); conn = (HttpURLConnection) action_url.openConnection(); conn.setDoOutput(true); conn.setDoInput(true); conn.setRequestProperty("domain", "bschool.hbs.edu"); conn.setRequestProperty("userType", "2"); conn.setRequestProperty("referer", "http://www.alumni.hbs.edu/"); conn.setRequestProperty("Content-Type", "application/x-www-form-urlencoded"); conn.setRequestMethod(HttpPost.METHOD_NAME); DataOutputStream ds = new DataOutputStream(conn.getOutputStream()); String content = "username=username1&password=password11"; Log.v(TAG, "content: " + content); ds.writeBytes(content); ds.flush(); ds.close(); InputStream in = conn.getInputStream();//**getting filenotfound exception here.** BufferedReader reader = new BufferedReader( new InputStreamReader(in)); StringBuilder str1 = new StringBuilder(); String line = null; while ((line = reader.readLine()) != null) { str1.append(line); Log.v(TAG, "line:" + line); } in.close(); s = str1.toString(); getting filenotfound exception. dont know why? else give me some suggestion to pass username and passwrod parameter to the url by code..

    Read the article

  • Android NDK r4 san-angeles problem

    - by Goz
    Hi All, I'm starting to learn the android NDK and I've instantly come up against a problem. I'e built the tool chain (which took a LOT longer than I was expecting!!) and I've compiled the C++ code with no problems and now I'm trying to build the java code. Instantly I come up against a problem. There is a file "main.xml" <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="match_parent" android:layout_height="match_parent" > <TextView android:layout_width="match_parent" android:layout_height="wrap_content" android:text="Hello World, DemoActivity" /> </LinearLayout> and I get the following errors: Description Resource Path Location Type error: Error: String types not allowed (at 'layout_height' with value 'match_parent'). main.xml /DemoActivity/res/layout line 2 Android AAPT Problem error: Error: String types not allowed (at 'layout_height' with value 'match_parent'). main.xml /DemoActivity/res/layout line 2 Android AAPT Problem error: Error: String types not allowed (at 'layout_width' with value 'match_parent'). main.xml /DemoActivity/res/layout line 2 Android AAPT Problem error: Error: String types not allowed (at 'layout_width' with value 'match_parent'). main.xml /DemoActivity/res/layout line 7 Android AAPT Problem error: Error: String types not allowed (at 'layout_width' with value 'match_parent'). main.xml /DemoActivity/res/layout line 7 Android AAPT Problem So I can see the problem lies in the fact that these "match_parent" strings are in there. Anyone know how to fix this?

    Read the article

  • Accessing the Atlassian Crowd SOAP API with Suds (python SOAP library)

    - by SeanOC
    Has anybody had any recent success with accessing the Crowd SOAP API via the Suds Python library? I've found a few people successfully doing it in the past but Atlassian seems to have changed their WSDL since then to make the existing advice not entirely helpful. Below is the simplest example I've been trying: from suds.client import Client url = 'https://crowd.hugeinc.com/services/SecurityServer?wsdl' client = Client(url) Unfortunately that generates the following error: Traceback (most recent call last): File "<input>", line 1, in <module> File "/Users/soconnor/.virtualenvs/hugeface/lib/python2.6/site-packages/suds/client.py", line 116, in __init__ sd = ServiceDefinition(self.wsdl, s) File "/Users/soconnor/.virtualenvs/hugeface/lib/python2.6/site-packages/suds/servicedefinition.py", line 58, in __init__ self.paramtypes() File "/Users/soconnor/.virtualenvs/hugeface/lib/python2.6/site-packages/suds/servicedefinition.py", line 137, in paramtypes item = (pd[1], pd[1].resolve()) File "/Users/soconnor/.virtualenvs/hugeface/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve raise TypeNotFound(qref) TypeNotFound: Type not found: '(AuthenticatedToken, http://authentication.integration.crowd.atlassian.com, )' I've tried to both binding and doctors to fix this problem to no avail. Neither approach resulted in any change. Any further recommendations or suggestions would be incredibly helpful.

    Read the article

  • Git: Remove specific commit

    - by Joshua Cheek
    I was working with a friend on a project, and he edited a bunch of files that shouldn't have been edited. Somehow I merged his work into mine, either when I pulled it, or when I tried to just pick the specific files out that I wanted. I've been looking and playing for a long time, trying to figure out how to remove the commits that contain the edits to those files, it seems to be a toss up between revert and rebase, and there are no straightforward examples, and the docs assume I know more than I do. So here is a simplified version of the question: Given the following scenario, how do I remove commit 2? $ mkdir git_revert_test && cd git_revert_test $ git init Initialized empty Git repository in /Users/josh/deleteme/git_revert_test/.git/ $ echo "line 1" > myfile $ git add -A $ git commit -m "commit 1" [master (root-commit) 8230fa3] commit 1 1 files changed, 1 insertions(+), 0 deletions(-) create mode 100644 myfile $ echo "line 2" >> myfile $ git commit -am "commit 2" [master 342f9bb] commit 2 1 files changed, 1 insertions(+), 0 deletions(-) $ echo "line 3" >> myfile $ git commit -am "commit 3" [master 1bcb872] commit 3 1 files changed, 1 insertions(+), 0 deletions(-) The expected result is $ cat myfile line 1 line 3 Here is an example of how I have been trying to revert $ git revert 342f9bb Automatic revert failed. After resolving the conflicts, mark the corrected paths with 'git add <paths>' or 'git rm <paths>' and commit the result.

    Read the article

  • Looping to provide multiple lines in linechart (django-googlecharts)

    - by mighty_bombero
    Hi, I'm trying to generate some charts using django-googlecharts. This works fine for rather static data but in one case I would like to render a different number of lines, based on a variable. I tried this: {% chart %} {% for line in line_data %} {% chart-data line %} {% endfor %} {% chart-size "390x200" %} {% chart-type "line" %} {% chart-labels days %} {% endchart %} Line data is a list containing lists. The template code fails with "Caught an exception while rendering: max() arg is an empty sequence". I guess the problem is that I try to loop over templatetags. What approach could be used here? Or am I completely missing something? Is this doable using inclusion tags? Thanks for your help.

    Read the article

  • Invalid message signature when running OpenId Provider on Cluster

    - by Garth
    Introduction We have an OpenID Provider which we created using the DotNetOpenAuth component. Everything works great when we run the provider on a single node, but when we move the provider to a load balanced cluster where multiple servers are handling requests for each session we get issue with the message signing as the DotNetOpenAuth component seems to be using something unique from each cluster node to create the signature. Exception DotNetOpenAuth.Messaging.Bindings.InvalidSignatureException: Message signature was incorrect. at DotNetOpenAuth.OpenId.ChannelElements.SigningBindingElement.ProcessIncomingMessage(IProtocolMessage message) in c:\BuildAgent\work\7ab20c0d948e028f\src\DotNetOpenAuth\OpenId\ChannelElements\SigningBindingElement.cs:line 139 at DotNetOpenAuth.Messaging.Channel.ProcessIncomingMessage(IProtocolMessage message) in c:\BuildAgent\work\7ab20c0d948e028f\src\DotNetOpenAuth\Messaging\Channel.cs:line 940 at DotNetOpenAuth.OpenId.ChannelElements.OpenIdChannel.ProcessIncomingMessage(IProtocolMessage message) in c:\BuildAgent\work\7ab20c0d948e028f\src\DotNetOpenAuth\OpenId\ChannelElements\OpenIdChannel.cs:line 172 at DotNetOpenAuth.Messaging.Channel.ReadFromRequest(HttpRequestInfo httpRequest) in c:\BuildAgent\work\7ab20c0d948e028f\src\DotNetOpenAuth\Messaging\Channel.cs:line 378 at DotNetOpenAuth.OpenId.RelyingParty.OpenIdRelyingParty.GetResponse(HttpRequestInfo httpRequestInfo) in c:\BuildAgent\work\7ab20c0d948e028f\src\DotNetOpenAuth\OpenId\RelyingParty\OpenIdRelyingParty.cs:line 493 Setup We have the machine config setup to use the same machine key on all cluster nodes and we have setup an out of process session with SQL Server. Question How do we configure the key used by DotNetOpenAuth to sign its messages so that the client will trust responses from all servers in the cluster during the same session?

    Read the article

  • VB.Net: exception on ExecuteReader() using OleDbCommand and Access

    - by Shane Fagan
    Hi again all, im getting the error below for this SQL statement in VB.Net 'Fill in the datagrid with the info needed from the accdb file 'to make it simple to access the db connstring = "Provider=Microsoft.ACE.OLEDB.12.0;Data " connstring += "Source=" & Application.StartupPath & "\AuctioneerSystem.accdb" 'make the new connection conn = New System.Data.OleDb.OleDbConnection(connstring) 'the sql command SQLString = "SELECT AllPropertyDetails.PropertyID, Street, Town, County, Acres, Quotas, ResidenceDetails, Status, HighestBid, AskingPrice FROM AllPropertyDetails " SQLString += "INNER JOIN Land ON AllPropertyDetails.PropertyID = Land.PropertyID " SQLString += "WHERE Deleted = False " If PriceRadioButton.Checked = True Then SQLString += "ORDER BY AskingPrice ASC" ElseIf AcresRadioButton.Checked = True Then SQLString += "ORDER BY Acres ASC" End If 'try to open the connection conn.Open() 'if the connection is open If ConnectionState.Open.ToString = "Open" Then 'use the sqlstring and conn to create the command cmd = New System.Data.OleDb.OleDbCommand(SQLString, conn) 'read the db and put it into dr dr = cmd.ExecuteReader If dr.HasRows Then 'if there is rows in the db then make sure the list box is clear 'clear the rows and columns if there is rows in the data grid LandDataGridView.Rows.Clear() LandDataGridView.Columns.Clear() 'add the columns LandDataGridView.Columns.Add("PropertyNumber", "Property Number") LandDataGridView.Columns.Add("Address", "Address") LandDataGridView.Columns.Add("Acres", "No. of Acres") LandDataGridView.Columns.Add("Quotas", "Quotas") LandDataGridView.Columns.Add("Details", "Residence Details") LandDataGridView.Columns.Add("Status", "Status") LandDataGridView.Columns.Add("HighestBid", "Highest Bid") LandDataGridView.Columns.Add("Price", "Asking Price") While dr.Read 'output the fields into the data grid LandDataGridView.Rows.Add( _ dr.Item("PropertyID").ToString _ , dr.Item("Street").ToString & " " & dr.Item("Town").ToString & ", " & dr.Item("County").ToString _ , dr.Item("Acres").ToString _ , dr.Item("Quota").ToString _ , dr.Item("ResidenceDetails").ToString _ , dr.Item("Status").ToString _ , dr.Item("HighestBid").ToString _ , dr.Item("AskingPrice").ToString) End While End If 'close the data reader dr.Close() End If 'close the connection conn.Close() Any ideas why its not working? The fields in the DB and the table names seem ok but its not working :/ The tables are AllPropertyDetails ProperyID:Number Street: text Town: text County: text Status: text HighestBid: Currency AskingPrice: Currency Land PropertyID: Number Acres: Number Quotas: Text ResidenceDetails: text System.InvalidOperationException was unhandled Message="An error occurred creating the form. See Exception.InnerException for details. The error is: No value given for one or more required parameters." Source="AuctioneerProject" StackTrace: at AuctioneerProject.My.MyProject.MyForms.Create__Instance__[T](T Instance) in 17d14f5c-a337-4978-8281-53493378c1071.vb:line 190 at AuctioneerProject.My.MyProject.MyForms.get_LandReport() at AuctioneerProject.ReportsMenu.LandButton_Click(Object sender, EventArgs e) in C:\Users\admin\Desktop\Auctioneers\AuctioneerProject\AuctioneerProject\ReportsMenu.vb:line 4 at System.Windows.Forms.Control.OnClick(EventArgs e) at System.Windows.Forms.Button.OnClick(EventArgs e) at System.Windows.Forms.Button.OnMouseUp(MouseEventArgs mevent) at System.Windows.Forms.Control.WmMouseUp(Message& m, MouseButtons button, Int32 clicks) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.ButtonBase.WndProc(Message& m) at System.Windows.Forms.Button.WndProc(Message& m) at System.Windows.Forms.Control.ControlNativeWindow.OnMessage(Message& m) at System.Windows.Forms.Control.ControlNativeWindow.WndProc(Message& m) at System.Windows.Forms.NativeWindow.DebuggableCallback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) at System.Windows.Forms.UnsafeNativeMethods.DispatchMessageW(MSG& msg) at System.Windows.Forms.Application.ComponentManager.System.Windows.Forms.UnsafeNativeMethods.IMsoComponentManager.FPushMessageLoop(Int32 dwComponentID, Int32 reason, Int32 pvLoopData) at System.Windows.Forms.Application.ThreadContext.RunMessageLoopInner(Int32 reason, ApplicationContext context) at System.Windows.Forms.Application.ThreadContext.RunMessageLoop(Int32 reason, ApplicationContext context) at System.Windows.Forms.Application.Run(ApplicationContext context) at Microsoft.VisualBasic.ApplicationServices.WindowsFormsApplicationBase.OnRun() at Microsoft.VisualBasic.ApplicationServices.WindowsFormsApplicationBase.DoApplicationModel() at Microsoft.VisualBasic.ApplicationServices.WindowsFormsApplicationBase.Run(String[] commandLine) at AuctioneerProject.My.MyApplication.Main(String[] Args) in 17d14f5c-a337-4978-8281-53493378c1071.vb:line 81 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at System.AppDomain.ExecuteAssembly(String assemblyFile, Evidence assemblySecurity, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ThreadHelper.ThreadStart_Context(Object state) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: System.Data.OleDb.OleDbException ErrorCode=-2147217904 Message="No value given for one or more required parameters." Source="Microsoft Office Access Database Engine" StackTrace: at System.Data.OleDb.OleDbCommand.ExecuteCommandTextErrorHandling(OleDbHResult hr) at System.Data.OleDb.OleDbCommand.ExecuteCommandTextForSingleResult(tagDBPARAMS dbParams, Object& executeResult) at System.Data.OleDb.OleDbCommand.ExecuteCommandText(Object& executeResult) at System.Data.OleDb.OleDbCommand.ExecuteCommand(CommandBehavior behavior, Object& executeResult) at System.Data.OleDb.OleDbCommand.ExecuteReaderInternal(CommandBehavior behavior, String method) at System.Data.OleDb.OleDbCommand.ExecuteReader(CommandBehavior behavior) at System.Data.OleDb.OleDbCommand.ExecuteReader() at AuctioneerProject.LandReport.load_Land() in C:\Users\admin\Desktop\Auctioneers\AuctioneerProject\AuctioneerProject\LandReport.vb:line 37 at AuctioneerProject.LandReport.PriceRadioButton_CheckedChanged(Object sender, EventArgs e) in C:\Users\admin\Desktop\Auctioneers\AuctioneerProject\AuctioneerProject\LandReport.vb:line 79 at System.Windows.Forms.RadioButton.OnCheckedChanged(EventArgs e) at System.Windows.Forms.RadioButton.set_Checked(Boolean value) at AuctioneerProject.LandReport.InitializeComponent() in C:\Users\admin\Desktop\Auctioneers\AuctioneerProject\AuctioneerProject\LandReport.designer.vb:line 40 at AuctioneerProject.LandReport..ctor() in C:\Users\admin\Desktop\Auctioneers\AuctioneerProject\AuctioneerProject\LandReport.vb:line 5 InnerException:

    Read the article

  • How can I run BitchX when I don't have ssh or shell access?

    - by Christopher
    I just installed an IRC bot, B****X (Don't ask, I don't know - the real name is not censored). I did all of the configuration and chmod'ed the pl files to 755, but running it won't work. My host does not allow SSH/Shell (which is how the documentation says to runs he script), but just going to the URL usually works because of this. However, I get a 500 (Internal Server Error) error. I have logged errors: Possible unintended interpolation of @moz in string at ./bitch.conf line 78 (#1) (W ambiguous) You said something like `@foo' in a double-quoted string but there was no array @foo in scope at the time. If you wanted a literal @foo, then write it as \@foo; otherwise find out what happened to the array you apparently lost track of. [Fri Mar 19 16:31:43 2010] bitch.pl: Possible unintended interpolation of @moz in string at ./bitch.conf line 78. Uncaught exception from user code: [Fri Mar 19 16:31:46 2010] bitch.pl: [[31mFAILED[0m] (connect error: Connection refused) at /usr/local/lib/perl5/5.8.8/CGI/Carp.pm line 354 CGI::Carp::realdie('[Fri Mar 19 16:31:46 2010] bitch.pl: [\x{1b}[31mFAILED\x{1b}[0m] (conne...') called at /usr/local/lib/perl5/5.8.8/CGI/Carp.pm line 446 CGI::Carp::die('[\x{1b}[31mFAILED\x{1b}[0m] (connect error: Connection refused)\x{a}') called at bitch.pl line 555 Thanks in advance

    Read the article

  • Detecting EOF in a Binary File using Scheme

    - by yuguang
    (define (read-all-input) (local ((define line (bytes->list (read-bytes 4)))) (if (eof-object? line) empty (cons line (read-all-input))))) (void (read-all-input)) The above code fails because bytes-list expects an argument of type byte string, but is given #

    Read the article

  • Graphing perpendicular offsets in a least squares regression plot in R

    - by D W
    I'm interested in making a plot with a least squares regression line and line segments connecting the datapoints to the regression line as illustrated here in the graphic called perpendicular offsets: http://mathworld.wolfram.com/LeastSquaresFitting.html I have the plot and regression line done here: ## Dataset from http://www.apsnet.org/education/advancedplantpath/topics/RModules/doc1/04_Linear_regression.html ## Disease severity as a function of temperature # Response variable, disease severity diseasesev<-c(1.9,3.1,3.3,4.8,5.3,6.1,6.4,7.6,9.8,12.4) # Predictor variable, (Centigrade) temperature<-c(2,1,5,5,20,20,23,10,30,25) ## Fit a linear model for the data and summarize the output from function lm() severity.lm <- lm(diseasesev~temperature,data=severity) # Take a look at the data plot( diseasesev~temperature, data=severity, xlab="Temperature", ylab="% Disease Severity", pch=16 ) abline(severity.lm,lty=1) title(main="Graph of % Disease Severity vs Temperature") Should I use some kind of for loop and segments http://www.iiap.res.in/astrostat/School07/R/html/graphics/html/segments.html to do the perpendicular offsets? Is there a more efficient way? Please provide an example if possible.

    Read the article

  • eventmachine on debian fails install via rubygems

    - by Max
    this has been killing me for the last 5 hours. I don't seem to be able to get eventmachine running on my debian box. here this output: $ gem install thin Building native extensions. This could take a while... ERROR: Error installing thin: ERROR: Failed to build gem native extension. /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/bin/ruby extconf.rb checking for rb_trap_immediate in ruby.h,rubysig.h... no checking for rb_thread_blocking_region()... yes checking for inotify_init() in sys/inotify.h... yes checking for writev() in sys/uio.h... yes checking for rb_wait_for_single_fd()... yes checking for rb_enable_interrupt()... yes checking for rb_time_new()... yes checking for sys/event.h... no checking for epoll_create() in sys/epoll.h... yes creating Makefile make compiling kb.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from kb.cpp:20: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from kb.cpp:20: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from kb.cpp:20: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from kb.cpp:20: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type compiling rubymain.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from rubymain.cpp:20: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from rubymain.cpp:20: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from rubymain.cpp:20: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from rubymain.cpp:20: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type compiling ssl.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from ssl.cpp:23: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from ssl.cpp:23: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from ssl.cpp:23: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from ssl.cpp:23: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type compiling cmain.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from cmain.cpp:20: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from cmain.cpp:20: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from cmain.cpp:20: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from cmain.cpp:20: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type cmain.cpp:96: warning: type qualifiers ignored on function return type cmain.cpp:107: warning: type qualifiers ignored on function return type cmain.cpp:117: warning: type qualifiers ignored on function return type cmain.cpp:127: warning: type qualifiers ignored on function return type cmain.cpp:269: warning: type qualifiers ignored on function return type cmain.cpp:279: warning: type qualifiers ignored on function return type cmain.cpp:289: warning: type qualifiers ignored on function return type cmain.cpp:299: warning: type qualifiers ignored on function return type cmain.cpp:309: warning: type qualifiers ignored on function return type cmain.cpp:329: warning: type qualifiers ignored on function return type cmain.cpp:678: warning: type qualifiers ignored on function return type compiling em.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from em.cpp:23: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from em.cpp:23: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from em.cpp:23: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from em.cpp:23: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type em.cpp: In member function 'bool EventMachine_t::_RunEpollOnce()': em.cpp:578: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp:578: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp: In member function 'bool EventMachine_t::_RunSelectOnce()': em.cpp:974: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp:974: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp: At global scope: em.cpp:1057: warning: type qualifiers ignored on function return type em.cpp:1079: warning: type qualifiers ignored on function return type em.cpp:1265: warning: type qualifiers ignored on function return type em.cpp:1338: warning: type qualifiers ignored on function return type em.cpp:1510: warning: type qualifiers ignored on function return type em.cpp:1593: warning: type qualifiers ignored on function return type em.cpp:1856: warning: type qualifiers ignored on function return type em.cpp:1982: warning: type qualifiers ignored on function return type em.cpp:2046: warning: type qualifiers ignored on function return type em.cpp:2070: warning: type qualifiers ignored on function return type em.cpp:2142: warning: type qualifiers ignored on function return type em.cpp:2361: fatal error: error writing to /tmp/ccdlOK0T.s: No space left on device compilation terminated. make: *** [em.o] Error 1 Gem files will remain installed in /home/eventhub/.rvm/gems/ruby-1.9.3-p125/gems/eventmachine-1.0.1 for inspection. Results logged to /home/eventhub/.rvm/gems/ruby-1.9.3-p125/gems/eventmachine-1.0.1/ext/gem_make.out Any thoughts? I read a lot of different ways to solve this issue, but none of them worked. Thanks

    Read the article

  • WCF service errors after installing WindowsXP updates

    - by niao
    Greeting, today before I start working on my application I updated my WinXP. After all updates have been installed my WCF service stop working. There is a following error when I try to open service.svc file in the browser: Configuration Error Description: An error occurred during the processing of a configuration file required to service this request. Please review the specific error details below and modify your configuration file appropriately. Parser Error Message: An error occurred creating the configuration section handler for system.serviceModel/bindings: Could not load type 'System.Security.Authentication.ExtendedProtection.Configuration.ExtendedProtectionPolicyElement' from assembly 'System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. Source Error: Line 131: </behaviors> Line 132: Line 133: <bindings> Line 134: <wsHttpBinding> Line 135: <binding name="MyWSHttpBinding" maxReceivedMessageSize="2147483647"> The colleague of my tried to run the same service before update and it works fine. He has the same problem after installing updates. Can someone please help me?

    Read the article

  • Lost connection to MySQL server during query

    - by Otavio
    I have a huge table and I need to process all rows in it. I'm always getting this Lost connection message and I'm not able to reconnect and restore the cursor to the last position it was. This is basically the code I have here: # import MySQLdb class DB: conn = None def connect(self): self.conn = MySQLdb.connect('hostname', 'user', '*****', 'some_table', cursorclass=MySQLdb.cursors.SSCursor) def query(self, sql): try: cursor = self.conn.cursor() cursor.execute(sql) except (AttributeError, MySQLdb.OperationalError): self.connect() cursor = self.conn.cursor() cursor.execute(sql) return cursor # # db = DB() sql = "SELECT bla FROM foo" data = db.query(sql) for row in data: do_something(row) # But I'm always getting this: # Traceback (most recent call last): File "teste.py", line 124, in <module> run() File "teste.py", line 109, in run for row in data: File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 417, in next row = self.fetchone() File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 388, in fetchone r = self._fetch_row(1) File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 285, in _fetch_row return self._result.fetch_row(size, self._fetch_type) _mysql_exceptions.OperationalError: (2013, 'Lost connection to MySQL server during query') Exception _mysql_exceptions.OperationalError: (2013, 'Lost connection to MySQL server during query') in <bound method SSCursor.__del__ of <MySQLdb.cursors.SSCursor object at 0x7f7e3c8da410>> ignored # Do you have any idea?

    Read the article

  • pyscripter Rpyc error

    - by jf328
    pyscripter 2.5.3.0 x64, python 2.7.7 anaconda 2.0.1, windows 7 I was using pyscripter and EPD python happily in 32 bit, no problem. Just changed to 64 bit anaconda version and re-installed everything but now pyscripter cannot import rpyc -- it runs with internal engine (no anaconda), but no such error in pure python. Thanks very much! btw, there is a similar SO post few years ago, but the answer there does not work. *** Python 2.7.3 (default, Apr 10 2012, 23:24:47) [MSC v.1500 64 bit (AMD64)] on win32. *** Internal Python engine is active *** *** Internal Python engine is active *** >>> import rpyc Traceback (most recent call last): File "<interactive input>", line 1, in <module> File "C:\Anaconda\lib\site-packages\rpyc\__init__.py", line 44, in <module> from rpyc.core import (SocketStream, TunneledSocketStream, PipeStream, Channel, File "C:\Anaconda\lib\site-packages\rpyc\core\__init__.py", line 1, in <module> from rpyc.core.stream import SocketStream, TunneledSocketStream, PipeStream File "C:\Anaconda\lib\site-packages\rpyc\core\stream.py", line 7, in <module> import socket File "C:\Anaconda\Lib\socket.py", line 47, in <module> import _socket ImportError: DLL load failed: The specified procedure could not be found. >>> C:\research>python Python 2.7.7 |Anaconda 2.0.1 (64-bit)| (default, Jun 11 2014, 10:40:02) [MSC v.1500 64bit (AMD64)] on win32 Type "help", "copyright", "credits" or "license" for more information. Anaconda is brought to you by Continuum Analytics. Please check out: http://continuum.io/thanks and https://binstar.org >>> import rpyc >>>

    Read the article

  • c# asp.net How to return a usercontrol from a handeler ashx?

    - by Justin808
    I want to return the HTML output of the control from a handler. My code looks like this: <%@ WebHandler Language="C#" Class="PopupCalendar" % using System; using System.IO; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; public class PopupCalendar : IHttpHandler { public void ProcessRequest (HttpContext context) { context.Response.ContentType = "text/plain"; System.Web.UI.Page page = new System.Web.UI.Page(); UserControl ctrl = (UserControl)page.LoadControl("~/Controls/CalendarMonthView.ascx"); page.Form.Controls.Add(ctrl); StringWriter stringWriter = new StringWriter(); HtmlTextWriter tw = new HtmlTextWriter(stringWriter); ctrl.RenderControl(tw); context.Response.Write(stringWriter.ToString()); } public bool IsReusable { get { return false; } } } I'm getting the error: Server Error in '/CMS' Application. Object reference not set to an instance of an object. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.NullReferenceException: Object reference not set to an instance of an object. Source Error: Line 14: System.Web.UI.Page page = new System.Web.UI.Page(); Line 15: UserControl ctrl = (UserControl)page.LoadControl("~/Controls/CalendarMonthView.ascx"); Line 16: page.Form.Controls.Add(ctrl); Line 17: Line 18: StringWriter stringWriter = new StringWriter(); How can I return the output of a Usercontrol via a handler?

    Read the article

  • Jython 2.5.1: "ImportError: No Module named os"

    - by Leonidas
    I looked through the other posts and bug reports and couldn't figure out what's causing this. I'm using Jython 2.5.1, in a Java project in Eclipse (Ubuntu 8.10). It has been added to the project as a standalone .jar file (I just replaced the old Jython 2.1 jar with this one). I'm running a script that uses the threading.py class. At some point the statement "import os" is evaluated from linecache.py and I get this error, which I can't seem to figure out how to fix: 'Execution failed. Traceback (most recent call last): File "<string>", line 1, in <module> File "../lib/python/threading.py", line 6, in <module> import traceback File "../lib/python/traceback.py", line 3, in <module> import linecache File "../lib/python/linecache.py", line 9, in <module> import os ImportError: No module named os'

    Read the article

  • Castle Windsor upgrade causes TypeLoadException for generic types

    - by Neil Barnwell
    I have the following mapping in my Castle Windsor xml file which has worked okay (unchanged) for some time: <component id="defaultBasicRepository" service="MyApp.Models.Repositories.IBasicRepository`1, MyApp.Models" type="MyApp.Models.Repositories.Linq.BasicRepository`1, MyApp.Models" lifestyle="perWebRequest"/> I got this from the Windsor documentation at http://www.castleproject.org/container/documentation/v1rc3/usersguide/genericssupport.html. Since I upgraded Windsor, I now get the following exception at runtime: Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.TypeLoadException: GenericArguments[0], 'T', on 'MyApp.Models.Repositories.Linq.BasicRepository`1[TEntity]' violates the constraint of type parameter 'TEntity'. Source Error: Line 44: public static void ConfigureIoC() Line 45: { Line 46: var windsor = new WindsorContainer("Windsor.xml"); Line 47: Line 48: ServiceLocator.SetLocatorProvider(() = new WindsorServiceLocator(windsor)); I'm using ASP.NET MVC 1.0, Visual Studio 2008 and Castle Windsor as downloaded from http://sourceforge.net/projects/castleproject/files/InversionOfControl/2.1/Castle-Windsor-2.1.1.zip/download Can anyone shed any light on this? I'm sure the upgrade of Castle Windsor is what caused it - it's been working well for ages.

    Read the article

  • Can you return an assignable lvalue in Scala?

    - by Alex R
    (note, lvalue is actually a term from the C grammar, I don't know what it's called in Scala!) Trying to learn Scala... this evening I'm working on an internal DSL for a dynamically scoped language that might resemble PHP syntax. My REPL is: Welcome to Scala version 2.7.6.final (Java HotSpot(TM) Client VM, Java 1.6.0). I have some made-up example code: class $(any: Any) { def update(sym: Symbol, any: Any) { println("line 2 executed");} def -(sym: Symbol) : $ = { println("line 1 executed"); return this } def update(any: Any) { println("line 3 executed");} } The following works as expected: scala var a = new $(0) a: $ = $@19238ad scala a('x) = "blah" line 2 executed On the other hand, why does the following not invoke the 1-parameter update method? scala a = 1 :6: error: type mismatch; found : Int(1) required: $ a = 1 ^ Ultimately, I would like this to work: a-'x = "blah" Thanks

    Read the article

  • AttributeError while adding colorbar in matplotlib

    - by bgbg
    The following code fails to run on Python 2.5.4: from matplotlib import pylab as pl import numpy as np data = np.random.rand(6,6) fig = pl.figure(1) fig.clf() ax = fig.add_subplot(1,1,1) ax.imshow(data, interpolation='nearest', vmin=0.5, vmax=0.99) pl.colorbar() pl.show() The error message is C:\temp>python z.py Traceback (most recent call last): File "z.py", line 10, in <module> pl.colorbar() File "C:\Python25\lib\site-packages\matplotlib\pyplot.py", line 1369, in colorbar ret = gcf().colorbar(mappable, cax = cax, ax=ax, **kw) File "C:\Python25\lib\site-packages\matplotlib\figure.py", line 1046, in colorbar cb = cbar.Colorbar(cax, mappable, **kw) File "C:\Python25\lib\site-packages\matplotlib\colorbar.py", line 622, in __init__ mappable.autoscale_None() # Ensure mappable.norm.vmin, vmax AttributeError: 'NoneType' object has no attribute 'autoscale_None' How can I add colorbar to this code? Following is the interpreter information: Python 2.5.4 (r254:67916, Dec 23 2008, 15:10:54) [MSC v.1310 32 bit (Intel)] on win32 Type "help", "copyright", "credits" or "license" for more information. >>>

    Read the article

  • Send ESC commands to a printer in C#

    - by Ewerton
    My application needs to print invoices, then a get the invoice from database, insert informations os the invoice in a big string (tellling the line, column, etc). after this a have the string ready to be sent to a printer. My problem is: I need to put some ESC/P commands/characters in my big string i try to do something like this: char formFeed = (char)12; Convert.ToChar(12); MyBigString.Insert(10, formFeed); whit this, the line 10 will do a FormFeed, but this not work NOTE: i send the MybigString all at once to printer. to make my code works i need to send the data line by line to a printer ? Thanks for the helps. PS: Sorry my English, i'am a Brazilian developer which dont speak English (yet).

    Read the article

  • importing pywiiuse to test out

    - by Patrick Burton
    This is probably a simple problem. But I downloaded the pywiiuse library from here and I also downloaded the examples. However when I try to run one of the examples I end up with import issues. I'm not certain I have everything configured properly to run. One error I receive when trying to run example.py: Press 1&2 Traceback (most recent call last): File "example.py", line 73, in <module> wiimotes = wiiuse.init(nmotes) File "/home/thed0ctor/Descargas/wiiuse-0.12/wiiuse/__init__.py", line 309, in init dll = ctypes.cdll.LoadLibrary('libwiiuse.so') File "/usr/lib/python2.7/ctypes/__init__.py", line 431, in LoadLibrary return self._dlltype(name) File "/usr/lib/python2.7/ctypes/__init__.py", line 353, in __init__ self._handle = _dlopen(self._name, mode) OSError: libwiiuse.so: cannot open shared object file: No such file or directory I'm really just starting out with this library and don't really see any documentation on how to configure pywiiuse so any help is much appreciated.

    Read the article

  • Installing psycopg2 (postgresql) in virtualenv on windows

    - by StackUnderflow
    I installed psycopg2 in virtualenv using easy_install psycopg2. I did not see any errors and looks like installation went fine.. there is an egg file created in the site-packages dir for psycopg2.. but when I run import psycopg2 in the interpreter, I am getting following error.. any clue? How can I fix it.. any other way to install psycopg2 in virtualenv.. Traceback (most recent call last): File "<stdin>", line 1, in <module> File "build\bdist.win32\egg\psycopg2\__init__.py", line 69, in <module> File "build\bdist.win32\egg\psycopg2\_psycopg.py", line 7, in <module> File "build\bdist.win32\egg\psycopg2\_psycopg.py", line 6, in __bootstrap__ Thanks.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • How to insert a word into a string in Perl

    - by Nano HE
    #!C:\Perl\bin\perl.exe use strict; use warnings; use Data::Dumper; my $fh = \*DATA; while(my $line = <$fh>) { $line =~ s/ ^/male /x ; print $line ; } __DATA__ 1 0104 Mike Lee 2:01:48 output male 1 0104 Mike Lee 2:01:48 Then I tried to insert male after the racenumber(0104), I replaced the code with style. $line =~ s/ ^\d+\s+\d+\s+ /male /x ; # but failed Acturally I want the output. thank you. 1 0104 male Mike Lee 2:01:48

    Read the article

  • Is there a stylesheet or Windows commandline tool for controllable XML formatting, specifically putt

    - by Scott Stafford
    Hi - I am searching for an XSLT or command-line tool (or C# code that can be made into a command-line tool, etc) for Windows that will do XML pretty-printing. Specifically, I want one that has the ability to put attributes one-to-a-line, something like: <Node> <ChildNode value1='5' value2='6' value3='happy' /> </Node> It doesn't have to be EXACTLY like that, but I want to use it for an XML file that has nodes with dozens of attributes and spreading them across multiple lines makes them easier to read, edit, and text-diff. NOTE: I think my preferred solution is an XSLT sheet I can pass through a C# method, though a Windows command-line tool is good too.

    Read the article

< Previous Page | 212 213 214 215 216 217 218 219 220 221 222 223  | Next Page >