Search Results

Search found 54055 results on 2163 pages for 'multiple files'.

Page 217/2163 | < Previous Page | 213 214 215 216 217 218 219 220 221 222 223 224  | Next Page >

• NAT Policy Inbound Source Problem on SonicWall TZ-210 with Multiple DSL Lines

  - by HK1

  We recently added three more DSL connections to our SonicWall TZ-210. My NAT Policies work fine as long as I leave them set with an inbound interface of X1, which hosts our original DSL connection. However, I'd like to change some of the NAT Policies to use inbound source/interface X2, X3, X4 or Any. In my initial tests, when I change one of the policies to use an inbound interface of X2, that port forward policy does not work at all. Traffic never makes it to the internal destination. What could be the problem?

  Read the article

• EF 4.x generated entity classes (POCO) and Map files

  - by JBeckton

  I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

  Read the article

• Best Place to Store Config Files and Log Files on Windows for My Program?

  - by Dave

  I need to store log files and config files for my application. Where is the best place to store them? Right now I'm just using the current directory, which ends up putting them in the Program Files directory where my program lives. The log files will probably be accessed by the user somewhat regularly, so %APPDATA% seems a little hard to get to. Is a directory under %USERPROFILE%\My Documents the best? It needs to work for all versions of Windows from 2000 forward.

  Read the article

• outgoing mail for web app (multiple domains as sender)

  - by solid

  I have a web app "myapp.com" that users can use to set up their own websites. Our application is written in php and should be able to do the following: send mails to our own users "from: [email protected]" send mails from our clients to their clients "from: [email protected]" We don't need to take care of incoming mails, just send out mails with the correct from and reply-to addresses. We cannot make this work using Google Apps (limited to our own domain in the from-field) and we cannot make google apps or google apps domains for all our clients, so we are looking for another simple to manage and set up solution. Does anyone have experience with this, please let me know! Thanks

  Read the article

• Preventing logrotate's dateext from overwriting files

  - by Thirler

  I'm working with a system where I would like to use the dateext function of logrotate (or some other way) to add the date to a logfile when it is rotated. However in this system it is important that no logging is missing and dateext will overwrite any existing files (which will happen if logrotate is called twice on a day). Is there a reliable way to prevent dateext to overwrite existing files, but instead make another file?. It is acceptable that either no rotate happens or a file is created with a less predictable name (date with an extra number, or the time or something).

  Read the article

• VLC Dynamic Range compression multiple songs

  - by Sion

  In my collection of music I have some songs which seem to be compressed nicely. But in addition to those I have songs which are overly quite compared to the louder compressed songs. So maybe the problem isn't compression but average volume. Would the Dynamic Range Compressor in VLC work for this type of problem or would I have better luck using external speakers and running it through a guitar compressor?

  Read the article

• Restreaming video from XSplit to multiple JustinTV/TwitchTV channels in different resolutions and bitrates

  - by lmojzis

  I have a really simple question but the answer may be a little more complex I guess. Okay. Let's go. I have an Application called Xsplit Broadcaster (http://www.xsplit.com/). It supports streaming video through RTMP. Now what I want to do is this: +--(720p)--> TwitchTV FirstChannel XSplit --(720p RTMP)-->[MyTranscodingServer]--+ +--(360p)--> TwitchTV SecondChannel Is there a simple way to do this? Additional info: Both channels accept standard RTMP stream on their RTMP endpoint using either username/password or streamkey. The server operating system is GNU/Linux

  Read the article

• visual-studio-2008 versioninfo for all files updated from one place

  - by ravenspoint

  The version information, displayed when the mouse cursor hovers over the file in windows explorer, is set for a file built by visual studio in the VERSION resource. I would like to set the version in one place for all the files built by a solution, preferably when I change the version in the install properties. Is there a way to do this? The motivation for this is that if the version is not updated for a file, then the installer will leave previous versions of files instead of replacing them with new files. This happens even when the 'RemovePreviousVersions' property is set. In order to save the tedious and error prone task of updating the version in every file built and installed, I remove the version resource from all files - which is not elegant.

  Read the article

• Getting data from closed files with concatenate formula

  - by Pav

  Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

  Read the article

• postgresql 9.1 Multiple Cluster on same host

  - by user1272305

  I have 2 cluster databases, running on the same host, Ubuntu. My fist database port is set to default but my second database port is set to 5433 in the postgresql.conf file. While everything is ok with local connections, I cannot connect using any of my tools to the second database with port 5433, including pgAdmin. Please help. Any parameter that I need to modify for the new database with port 5433? netstat -an | grep 5433 shows, tcp 0 0 0.0.0.0:5433 0.0.0.0:* LISTEN tcp6 0 0 :::5433 :::* LISTEN unix 2 [ ACC ] STREAM LISTENING 72842 /var/run/postgresql/.s.PGSQL.5433 iptables -L shows, Chain INPUT (policy ACCEPT) target prot opt source destination Chain FORWARD (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

  Read the article

• Considering modified files for rebuild

  - by harik

  I have a C++ project, I am using Bakefile for build process, Makefiles are generated for msvc, mingw, gnu etc for cross-platform support. Now the problem is that if I change any .h files (which are included in other .cpp files) and performing a rebuild does not recompile modified files. But changing any .cpp file gets recompiled. Based on modified time-stamp of any file which is included in the project I expect to consider that file for rebuild. Am I missing something which required to be added as a tag in .bkl files? Please help.

  Read the article

• Hosting multiple websites from home

  - by dean nolan

  I have just been accepted for Microsofts Wevsite Spark program which I mainly got for the tools, Visual Studio, Blend. I also have a few of my own websites, personal and a couple of business ones. I also work freelance and sometimes I would like a place to just put a demo up of a clients project. The websites I currently have are all on differnet hosting provders and domain registrars. The WebsiteSpark comes with Windows Server 2008 and SQL Server 2008. It would be really advantagous of me to have all these in one place but also so I have complete control over the database and the environment. So I am thinking over the next 4-6 months of migrating all this to my own server that I will host from home, or maybe even setup at home and then store in a proper datacentre. I was wondering what steps I should take and what to be aware of, specifically: 1) having all these different websites on one computer and having the url got to the proper place. 2) Cost effectiveness? Having the server in home as apposed to datacentre. Most solutions I see charge over £1000 a month to have a machine in datacentre. This is mostly for my own ease of management and shared hosting which I currently have is very limited configuration wise. Would getting a server in house be beneficial for then upgrading to the cloud? What measures should I take with my ISP? I know this is a lot I've asked but just even links to good articles would be good. Thanks

  Read the article

• How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

  - by Ivan

  How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

  Read the article

• ProFTPd: Multiple Domain VirtualHosts on one IP address

  - by Badger

  I have a webserver that we are giving a consultant FTP access to. For one domain hosted on that server he needs access to a "dev" directory and for a different domain hosted on that server he needs access to a different directory. I am trying to set this up with VirtualHosts, but I am having issues. Here is the VirtualHost bit of my proftpd.conf file: <VirtualHost www.example2.com> ServerName "Example 2" DefaultRoot /var/www/example2/dev </VirtualHost> <VirtualHost www.example1.com> ServerName "Example 1" DefaultServer on DefaultRoot /var/www/example1 </VirtualHost> When I FTP to either domain I always get the first VirtualHost, even if I FTP to the second domain.

  Read the article

• Connect to multiple proxy server

  - by mostafa

  my company share internet through two proxy server. without enterning proxy detail in program such as firefox, I don't have any access to internet. each proxy server bandwidth limit is 512kbps. how can i combine two proxy server traffic to get 1mbps bandwidth? client sucsh as proxifier chain both proxy but only use one of them at a time. if one failed to connect, proxifier connect to other proxy in the chain list.

  Read the article

• Which open source repository or version control systems store files' original mtime, ctime and atime

  - by sampablokuper

  I want to create a personal digital archive. I want to be able to check digital files (some several years old, some recent, some not yet created) into that archive and have them preserved, along with their metadata such as ctime, atime and mtime. I want to be able to check these files out of that archive, modify their contents and commit the changes back to the archive, while keeping the earlier commits and their metadata intact. I want the archive to be very reliable and secure, and able to be backed up remotely. I want to be able to check files in and out of the archive from PCs running Linux, Mac OS X 10.5+ or Win XP+. I want to be able to check files in and out of the archive from PCs with RAM capacities lower than the size of the files. E.g. I want to be able to check in/out a 13GB file using a PC with 2GB RAM. I thought Subversion could do all this, but apparently it can't. (At least, it couldn't a couple of years ago and as far as I know it still can't; correct me if I'm wrong.) Is there a libre VCS or similar capable of all these things? Thanks for your help.

  Read the article

• Cloning single disk drive to multiple drives simultaneously

  - by mr.b

  I am looking for a way to clone single disk drive to more than one disk drive at the same time. I have prepared system images on 1TB disks, and it takes almost 2 hours to clone one disk to another, and then it goes up exponentially, in order to have say 30 disks cloned. If it was possible to clone one disk to more than single target, it would simplify whole procedure a lot. Also, is there something that prevents this kind of operation? I mean, is there some special reason why every disk cloning software that I know about supports only single target drive? Thanks!

  Read the article

• jquery autocomplete: works for first value, how to enable it for next?

  - by Toni Michel Caubet

  hello there! I'm using autocomplete so user can easly enter data on inputs, like this: <? $a = new etiqueta(0, ''); $b = $a->autocomplete_etiquetas(); ?> <script type="text/javascript"> function cargar_autocomplete_etiquetas(){ $("#tags").autocomplete({ source: [<? echo $b; ?>] }); } </script> $a = $b its an array with a result like: 'help','please',i','need','to,'be able to', 'select next item',' with autocomplete'; and i checked the ui documentation, but it doesn't fith with my source method.. any idea? I'm trying like this (edited with Bugai13 aportation): <? $a = new etiqueta(0, ''); $b = $a->autocomplete_etiquetas(); ?> <script type="text/javascript"> function cargar_autocomplete_etiquetas(){ $("#tags").autocomplete({ source: [<? echo $b; ?>], multiple: true, multipleSeparator: ", ", matchContains: true }); } </script> but i don't know how to do it.. any idea? are .push and .pop functions from the autocomplete? or shall i define, them? thanks again! PS: i'm getting adicted to this site! PS: come on dudes, i think the answer will be very usefull for many people PS: is it allowed to offer paypal reward?

  Read the article

• Setting up Multiple Routers (as Hardware Firewalls) behind a Home Router

  - by Synetech

  I’ve currently got one computer behind a router with built-in firewall functionality, connected to a home cable-modem that has a single Ethernet port and one IP. I’m going to have to set up another computer for the rest of the family to use which of course will need to be connected to the Internet, probably wirelessly since the modem is in my room and the new system would not be. What I would like to do is to get two more small routers with firewall capability and connect each computer to a router, which would in turn connect to the main router which connects to the cable-modem. That way, both systems have a hardware firewall protecting them (particularly the wireless system) and the burden of blocking would be reduced on both the computer CPUs and the main router because the secondary routers would handle some of the workload. I’m trying to find out about the complexities inherent in this design and how I could set it up to work, specifically the IP handling and NAT aspect. Thanks a lot.

  Read the article

• C#: How to gracefully pass multiple conditions to Equals()

  - by Roy

  I'm new to C#, and I'm trying to write a program that selects file types from a FileInfo list. So far I have something along the lines of: List<FileInfo> files = new List<FileInfo>(); IEnumerable<FileInfo> result = files.Where(f=>f.Extension.Equals(".jpg", StringComparison.InvariantCultureIgnoreCase)|| f.Extension.Equals(".gif", StringComparison.InvariantCultureIgnoreCase) ); etc Obviously I'm not happy with this solution, but I don't know how to do this otherwise in a single call. What's the better way to go about it?

  Read the article

• How to Add cursor files in resources of control Library project

  - by prashant

  Hi, I am creating a Control Library project. I have some Cursor files which i want to add on resources. Because on Resources.resx---Add resources is only for String, Icon (.ico), Text file(.txt), Image (Png,bmp,jpeg,gif, tiff) files. So where i can add *.cur files. How can i do it? thanks

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Advanced ID3 tags handling and audio files ordering

  - by Juhele

  Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

  Read the article

• Webserver sending corrupt or corrupting served files

  - by NotIan

  EDIT: Looks like the problem was a rootkit that corrupted a bunch of low level linux commands, including top, ps, ifconfig, netstat and others. The problem was resolved by taking all web files off the server and wiping it. A dedicated server we operate is having a strange issue. Files are not be sent complete or are showing up with garbage data. Example: http://sustainablefitness.com/images/banner_bootcamps.jpg To make matters more confusing this corruption does NOT happen when the files are served as https, (I would post a link, but I don't have enough rep points, just add an 's' after http in the link above.) When I throw load at the server, I get dozens of (swapd)s in top this is the only thing that really jumps out. I can't post images but ( imgur.com / ZArSq.png ) is a screenshot of top. I have tried a lot of stuff so far, I am willing to try anything that I can. A dedicated server we operate is having a strange issue. Files are not be sent complete or are showing up with garbage data. Example: http://sustainablefitness.com/images/banner_bootcamps.jpg To make matters more confusing this corruption does NOT happen when the files are served as https, (I would post a link, but I don't have enough rep points, just add an 's' after http in the link above.) When I throw load at the server, I get dozens of (swapd)s in top this is the only thing that really jumps out. I can't post images but ( imgur.com / ZArSq.png ) is a screenshot of top. I have tried a lot of stuff so far, I am willing to try anything that I can.

  Read the article

• How to maintain long-lived python projects w.r.t. dependencies and python versions ?

  - by Gyom

  short version: how can I get rid of the multiple-versions-of-python nightmare ? long version: over the years, I've used several versions of python, and what is worse, several extensions to python (e.g. pygame, pylab, wxPython...). Each time it was on a different setup, with different OSes, sometimes different architectures (like my old PowerPC mac). Nowadays I'm using a mac (OSX 10.6 on x86-64) and it's a dependency nightmare each time I want to revive script older than a few months. Python itself already comes in three different flavours in /usr/bin (2.5, 2.6, 3.1), but I had to install 2.4 from macports for pygame, something else (cannot remember what) forced me to install all three others from macports as well, so at the end of the day I'm the happy owner of seven (!) instances of python on my system. But that's not the problem, the problem is, none of them has the right (i.e. same set of) libraries installed, some of them are 32bits, some 64bits, and now I'm pretty much lost. For example right now I'm trying to run a three-year-old script (not written by me) which used to use matplotlib/numpy to draw a real-time plot within a rectangle of a wxwidgets window. But I'm failing miserably: py26-wxpython from macports won't install, stock python has wxwidgets included but also has some conflict between 32 bits and 64 bits, and it doesn't have numpy... what a mess ! Obviously, I'm doing things the wrong way. How do you usally cope with all that chaos ?

  Read the article

< Previous Page | 213 214 215 216 217 218 219 220 221 222 223 224  | Next Page >