Search Results

Search found 7400 results on 296 pages for 'fedora 13'.

Page 219/296 | < Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >

  • Xcodebuild throws assert failures after successful build?

    - by Derek Clarkson
    Hi all, I'me getting the following after building from he command line using xcodebuild, ay ideas what might be wrong? ** BUILD SUCCEEDED ** 2010-06-06 20:20:12.916 xcodebuild[8267:80b] [MT] ASSERTION FAILURE in /SourceCache/DevToolsBase/DevToolsBase-1648/pbxcore/Target.subproj/PBXTarget.m:597 Details: Assertion failed: (nil == _buildContext) || (nil == [_buildContext target]) Object: <PBXLegacyTarget:0x104b97370> Method: -dealloc Thread: <NSThread: 0x100b141a0>{name = (null), num = 1} Backtrace: 0 0x000000010035feaf -[XCAssertionHandler handleFailureInMethod:object:fileName:lineNumber:messageFormat:arguments:] (in DevToolsCore) 1 0x000000010035fc1a _XCAssertionFailureHandler (in DevToolsCore) 2 0x00000001002790d1 -[PBXTarget dealloc] (in DevToolsCore) 3 0x00000001002911e8 -[PBXLegacyTarget dealloc] (in DevToolsCore) 4 0x00000001002c5b16 -[PBXTargetBookmark dealloc] (in DevToolsCore) 5 0x00007fff8224ff71 __CFBasicHashStandardCallback (in CoreFoundation) 6 0x00007fff82250931 __CFBasicHashDrain (in CoreFoundation) 7 0x00007fff822396b3 _CFRelease (in CoreFoundation) 8 0x0000000100254171 -[PBXProject dealloc] (in DevToolsCore) 9 0x00007fff82262d56 _CFAutoreleasePoolPop (in CoreFoundation) 10 0x00007fff841b530c -[NSAutoreleasePool drain] (in Foundation) 11 0x000000010000c60d 12 0x00000001000014f4 ** INTERNAL ERROR: Uncaught Exception ** Exception: ASSERTION FAILURE in /SourceCache/DevToolsBase/DevToolsBase-1648/pbxcore/Target.subproj/PBXTarget.m:597 Details: Assertion failed: (nil == _buildContext) || (nil == [_buildContext target]) Object: <PBXLegacyTarget:0x104b97370> Method: -dealloc Thread: <NSThread: 0x100b141a0>{name = (null), num = 1} Backtrace: 0 0x000000010035feaf -[XCAssertionHandler handleFailureInMethod:object:fileName:lineNumber:messageFormat:arguments:] (in DevToolsCore) 1 0x000000010035fc1a _XCAssertionFailureHandler (in DevToolsCore) 2 0x00000001002790d1 -[PBXTarget dealloc] (in DevToolsCore) 3 0x00000001002911e8 -[PBXLegacyTarget dealloc] (in DevToolsCore) 4 0x00000001002c5b16 -[PBXTargetBookmark dealloc] (in DevToolsCore) 5 0x00007fff8224ff71 __CFBasicHashStandardCallback (in CoreFoundation) 6 0x00007fff82250931 __CFBasicHashDrain (in CoreFoundation) 7 0x00007fff822396b3 _CFRelease (in CoreFoundation) 8 0x0000000100254171 -[PBXProject dealloc] (in DevToolsCore) 9 0x00007fff82262d56 _CFAutoreleasePoolPop (in CoreFoundation) 10 0x00007fff841b530c -[NSAutoreleasePool drain] (in Foundation) 11 0x000000010000c60d 12 0x00000001000014f4 Stack: 0 0x00007fff822ded06 __exceptionPreprocess (in CoreFoundation) 1 0x00007fff832470f3 objc_exception_throw (in libobjc.A.dylib) 2 0x00007fff823369b9 -[NSException raise] (in CoreFoundation) 3 0x000000010035ff6a -[XCAssertionHandler handleFailureInMethod:object:fileName:lineNumber:messageFormat:arguments:] (in DevToolsCore) 4 0x000000010035fc1a _XCAssertionFailureHandler (in DevToolsCore) 5 0x00000001002790d1 -[PBXTarget dealloc] (in DevToolsCore) 6 0x00000001002911e8 -[PBXLegacyTarget dealloc] (in DevToolsCore) 7 0x00000001002c5b16 -[PBXTargetBookmark dealloc] (in DevToolsCore) 8 0x00007fff8224ff71 __CFBasicHashStandardCallback (in CoreFoundation) 9 0x00007fff82250931 __CFBasicHashDrain (in CoreFoundation) 10 0x00007fff822396b3 _CFRelease (in CoreFoundation) 11 0x0000000100254171 -[PBXProject dealloc] (in DevToolsCore) 12 0x00007fff82262d56 _CFAutoreleasePoolPop (in CoreFoundation) 13 0x00007fff841b530c -[NSAutoreleasePool drain] (in Foundation) 14 0x000000010000c60d 15 0x00000001000014f4 Abort trap

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • GCC emits extra code for boost::shared_ptr dereference

    - by Checkers
    I have the following code: #include <boost/shared_ptr.hpp> struct Foo { int a; }; static int A; void func_shared(const boost::shared_ptr<Foo> &foo) { A = foo->a; } void func_raw(Foo * const foo) { A = foo->a; } I thought the compiler would create identical code, but for shared_ptr version an extra seemingly redundant instruction is emitted. Disassembly of section .text: 00000000 <func_raw(Foo*)>: 0: 55 push ebp 1: 89 e5 mov ebp,esp 3: 8b 45 08 mov eax,DWORD PTR [ebp+8] 6: 5d pop ebp 7: 8b 00 mov eax,DWORD PTR [eax] 9: a3 00 00 00 00 mov ds:0x0,eax e: c3 ret f: 90 nop 00000010 <func_shared(boost::shared_ptr<Foo> const&)>: 10: 55 push ebp 11: 89 e5 mov ebp,esp 13: 8b 45 08 mov eax,DWORD PTR [ebp+8] 16: 5d pop ebp 17: 8b 00 mov eax,DWORD PTR [eax] 19: 8b 00 mov eax,DWORD PTR [eax] 1b: a3 00 00 00 00 mov ds:0x0,eax 20: c3 ret I'm just curious, is this necessary, or it is just an optimizer's shortcoming? Compiling with g++ 4.1.2, -O3 -NDEBUG.

    Read the article

  • Project Euler 7 Scala Problem

    - by Nishu
    I was trying to solve Project Euler problem number 7 using scala 2.8 First solution implemented by me takes ~8 seconds def problem_7:Int = { var num = 17; var primes = new ArrayBuffer[Int](); primes += 2 primes += 3 primes += 5 primes += 7 primes += 11 primes += 13 while (primes.size < 10001){ if (isPrime(num, primes)) primes += num if (isPrime(num+2, primes)) primes += num+2 num += 6 } return primes.last; } def isPrime(num:Int, primes:ArrayBuffer[Int]):Boolean = { // if n == 2 return false; // if n == 3 return false; var r = Math.sqrt(num) for (i <- primes){ if(i <= r ){ if (num % i == 0) return false; } } return true; } Later I tried the same problem without storing prime numbers in array buffer. This take .118 seconds. def problem_7_alt:Int = { var limit = 10001; var count = 6; var num:Int = 17; while(count < limit){ if (isPrime2(num)) count += 1; if (isPrime2(num+2)) count += 1; num += 6; } return num; } def isPrime2(n:Int):Boolean = { // if n == 2 return false; // if n == 3 return false; var r = Math.sqrt(n) var f = 5; while (f <= r){ if (n % f == 0) { return false; } else if (n % (f+2) == 0) { return false; } f += 6; } return true; } I tried using various mutable array/list implementations in Scala but was not able to make solution one faster. I do not think that storing Int in a array of size 10001 can make program slow. Is there some better way to use lists/arrays in scala?

    Read the article

  • Add fields to Django ModelForm that aren't in the model

    - by Cyclic
    I have a model that looks like: class MySchedule(models.Model): start_datetime=models.DateTimeField() name=models.CharField('Name',max_length=75) With it comes its ModelForm: class MyScheduleForm(forms.ModelForm): startdate=forms.DateField() starthour=forms.ChoiceField(choices=((6,"6am"),(7,"7am"),(8,"8am"),(9,"9am"),(10,"10am"),(11,"11am"), (12,"noon"),(13,"1pm"),(14,"2pm"),(15,"3pm"),(16,"4pm"),(17,"5pm"), (18,"6pm" startminute=forms.ChoiceField(choices=((0,":00"),(15,":15"),(30,":30"),(45,":45")))),(19,"7pm"),(20,"8pm"),(21,"9pm"),(22,"10pm"),(23,"11pm"))) class Meta: model=MySchedule def clean(self): starttime=time(int(self.cleaned_data.get('starthour')),int(self.cleaned_data.get('startminute'))) return self.cleaned_data try: self.instance.start_datetime=datetime.combine(self.cleaned_data.get("startdate"),starttime) except TypeError: raise forms.ValidationError("There's a problem with your start or end date") Basically, I'm trying to break the DateTime field in the model into 3 more easily usable form fields -- a date picker, an hour dropdown, and a minute dropdown. Then, once I've gotten the three inputs, I reassemble them into a DateTime and save it to the model. A few questions: 1) Is this totally the wrong way to go about doing it? I don't want to create fields in the model for hours, minutes, etc, since that's all basically just intermediary data, so I'd like a way to break the DateTime field into sub-fields. 2) The difficulty I'm running into is when the startdate field is blank -- it seems like it never gets checked for non-blankness, and just ends up throwing up a TypeError later when the program expects a date and gets None. Where does Django check for blank inputs, and raise the error that eventually goes back to the form? Is this my responsibility? If so, how do I do it, since it doesn't evaluate clean_startdate() since startdate isn't in the model. 3) Is there some better way to do this with inheritance? Perhaps inherit the MyScheduleForm in BetterScheduleForm and add the fields there? How would I do this? (I've been playing around with it for over an hours and can't seem to get it) Thanks! [Edit:] Left off the return self.cleaned_data -- lost it in the copy/paste originally

    Read the article

  • Programming Technique: How to create a simple card game

    - by Shyam
    Hi, As I am learning the Ruby language, I am getting closer to actual programming. So I was thinking of creating a simple card game. My question isn't Ruby orientated, but I do know want to learn how to solve this problem with a genuine OOP approach. In my card game I want to have four players. Using a standard deck with 52 cards, no jokers/wildcards. In the game I won't use the Ace as a dual card, it is always the highest card. So, the programming problems I wonder about are the following: How can I sort/randomize the deck of cards? There are four types, each having 13 values. Eventually there can be only unique values, so picking random values could generate duplicates. How can I implement a simple AI? As there are tons of card games, someone would have figured this part out already, so references would be great. I am a truly Ruby nuby, and my goal here is to learn to solve problems, so pseudo code would be great, just to understand how to solve the problem programmatically. I apologize for my grammar and writing style if it's unclear, for it is not my native language. Also pointers to sites where such challenges are explained, would be a great resource! Thank you for your comments, answers and feedback!

    Read the article

  • Why do I get "file is not of required architecture" when I try to build my app on an iphone?

    - by Dale
    My app seemingly runs fine in the simulator but the first time I hooked a phone up to my system and had it build for it I got a huge error log with things like: Build SCCUI of project SCCUI with configuration Debug CompileXIB HandleAlert.xib cd /Users/gdbriggs/Desktop/SCCUI setenv IBC_MINIMUM_COMPATIBILITY_VERSION 3.1 setenv PATH "/Developer/Platforms/iPhoneOS.platform/Developer/usr/bin:/Developer/usr /bin:/usr/bin:/bin:/usr/sbin:/sbin" /Developer/usr/bin/ibtool --errors --warnings --notices --output-format human-readable-text --compile /Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos/SCCUI.app/HandleAlert.nib /Users/gdbriggs/Desktop/SCCUI/HandleAlert.xib /* com.apple.ibtool.document.warnings */ /Users/gdbriggs/Desktop/SCCUI/HandleAlert.xib:13: warning: UITextView does not support data detectors when the text view is editable. Ld build/Debug-iphoneos/SCCUI.app/SCCUI normal armv6 cd /Users/gdbriggs/Desktop/SCCUI setenv IPHONEOS_DEPLOYMENT_TARGET 3.1 setenv MACOSX_DEPLOYMENT_TARGET 10.5 setenv PATH "/Developer/Platforms/iPhoneOS.platform/Developer/usr/bin:/Developer/usr/bin:/usr/bin:/bin:/usr/sbin:/sbin" /Developer/Platforms/iPhoneOS.platform/Developer/usr/bin/gcc-4.2 -arch armv6 -isysroot /Developer/Platforms/iPhoneOS.platform/Developer/SDKs/iPhoneOS3.1.sdk -L/Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos -F/Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos -F/Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks -filelist /Users/gdbriggs/Desktop/SCCUI/build/SCCUI.build/Debug-iphoneos/SCCUI.build/Objects-normal/armv6/SCCUI.LinkFileList -mmacosx-version-min=10.5 -dead_strip -miphoneos-version-min=3.1 -framework Foundation -framework UIKit -framework CoreGraphics -framework MessageUI -o /Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos/SCCUI.app/SCCUI ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/Foundation.framework/Foundation, file is not of required architecture ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/UIKit.framework/UIKit, file is not of required architecture ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/CoreGraphics.framework/CoreGraphics, file is not of required architecture ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/MessageUI.framework/MessageUI, file is not of required architecture Undefined symbols: "_OBJC_CLASS_$_UIDevice", referenced from: __objc_classrefs__DATA@0 in SCAuthenticationHandler.o "_OBJC_CLASS_$_NSString", referenced from: __objc_classrefs__DATA@0 in CCProxy.o __objc_classrefs__DATA@0 in AlertSummaryViewController.o __objc_classrefs__DATA@0 in HomeLevelController.o __objc_classrefs__DATA@0 in SCAuthenticationHandler.o __objc_classrefs__DATA@0 in SCRequestHandler.o "_UIApplicationMain", referenced from: _main in main.o "_objc_msgSend", referenced from: _main in main.o _main in main.o _main in main.o -[SCCUIAppDelegate applicationDidFinishLaunching:] in and it just keeps going. At / near the bottom it says: ld: symbol(s) not found collect2: ld returned 1 exit status What am I doing wrong?

    Read the article

  • SharpPcap issue

    - by Eyla
    This is my first time to use SharpPcap library. I created new project with VC# 2008 and I added SharpPcap as a reference to my project. I post a sample code to get interface of my pc but I'm getting this error: Error 1 The type or namespace name 'PcapDeviceList' could not be found (are you missing a using directive or an assembly reference?) C:\Users\Ali\Documents\Visual Studio 2008\Projects\Pcap\Pcap\Form1.cs 28 13 Pcap please advice to solve this problem. here is my code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; using SharpPcap; using SharpPcap.Packets; using SharpPcap.Protocols; using SharpPcap.Util; namespace Pcap { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { /* Retrieve the device list */ PcapDeviceList devices = SharpPcap.GetAllDevices(); /*If no device exists, print error */ if (devices.Count < 1) { Console.WriteLine("No device found on this machine"); return; } int i = 0; /* Scan the list printing every entry */ foreach (PcapDevice dev in devices) { /* Description */ label1.Text = "{0}) {1}" + i + dev.PcapDescription +"\n"+ /* Name */ "\tName:\t{0}" + dev.PcapName+"\n"+ /* IP Address */ "\tIP Address: \t\t{0}"+ dev.PcapIpAddress+"\n"+ /* Is Loopback */ "\tLoopback: \t\t{0}"+ dev.PcapLoopback; i++; } } } }

    Read the article

  • understanding valgrind output

    - by sbsp
    Hi, i made a post earlier asking about checking for memory leaks etc, i did say i wasnt to familiar with the terminal in linux but someone said to me it was easy with valgrind i have managed to get it running etc but not to sure what the output means. Glancing over, all looks good to me but would like to run it past you experience folk for confirmation if possible. THe output is as follows ^C==2420== ==2420== HEAP SUMMARY: ==2420== in use at exit: 2,240 bytes in 81 blocks ==2420== total heap usage: 82 allocs, 1 frees, 2,592 bytes allocated ==2420== ==2420== LEAK SUMMARY: ==2420== definitely lost: 0 bytes in 0 blocks ==2420== indirectly lost: 0 bytes in 0 blocks ==2420== possibly lost: 0 bytes in 0 blocks ==2420== still reachable: 2,240 bytes in 81 blocks ==2420== suppressed: 0 bytes in 0 blocks ==2420== Reachable blocks (those to which a pointer was found) are not shown. ==2420== To see them, rerun with: --leak-check=full --show-reachable=yes ==2420== ==2420== For counts of detected and suppressed errors, rerun with: -v ==2420== ERROR SUMMARY: 0 errors from 0 contexts (suppressed: 13 from 8) Is all good here? the only thing concerning me is the still reachable part. Is that ok? Thanks everyone

    Read the article

  • How to migrate project from RCS to git? (SOLVED)

    - by Norman Ramsey
    I have a 20-year-old project that I would like to migrate from RCS to git, without losing the history. All web pages suggest that the One True Path is through CVS. But after an hour of Googling and trying different scripts, I have yet to find anything that successfully converts my RCS project tree to CVS. I'm hoping the good people at Stackoverflow will know what actually works, as opposed to what is claimed to work and doesn't. (I searched Stackoverflow using both the native SO search and a Google search, but if there's a helpful answer in the database, I missed it.) UPDATE: The rcs-fast-export tool at http://git.oblomov.eu/rcs-fast-export was repaired on 14 April 2009, and this version seems to work for me. This tool converts straight to git with no intermediate CVS. Thanks Giuseppe and Jakub!!! Things that did not work that I still remember: The rcs-to-cvs script that ships in the contrib directory of the CVS sources The rcs-fast-export tool at http://git.oblomov.eu/rcs-fast-export in versions before 13 April 2010 The rcs2cvs script found in a document called "CVS-RCS- HOW-TO Document for Linux"

    Read the article

  • crash when linking swc with Alchemy

    - by paleozogt
    I have a project I'm trying to compile with alchemy. It will compile .o and .a files, but when trying to create a .swc, it will fail. It appears to crash with this error: g++ -swc -o mylib.swc my-flex-interface.cpp mylib.a Cannot yet select: 0x279c810: ch,flag = AVM2ISD::CALL - A call instruction 0x279c7a0, 0x29c4350 0 llc 0x00636dfe _ZNSt8_Rb_treeIN4llvm3sys4PathES2_St9_IdentityIS2_ESt4lessIS2_ESaIS2_EE13insert_uniqueERKS2_ + 6078 1 llc 0x006373a2 _ZNSt8_Rb_treeIN4llvm3sys4PathES2_St9_IdentityIS2_ESt4lessIS2_ESaIS2_EE13insert_uniqueERKS2_ + 7522 2 libSystem.B.dylib 0x9530942b _sigtramp + 43 3 ??? 0xffffffff 0x0 + 4294967295 4 libSystem.B.dylib 0x953968e5 raise + 26 5 libSystem.B.dylib 0x953ac99c abort + 93 6 llc 0x002f4fe0 _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel6Emit_7ERKN4llvm9SDOperandEj + 0 7 llc 0x002f8e1b _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel10SelectCodeEN4llvm9SDOperandE + 2219 8 llc 0x002fa193 _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel10SelectRootEN4llvm9SDOperandE + 819 9 llc 0x002e6a2c _ZN4llvm19X86_64TargetMachineD0Ev + 65116 10 llc 0x003de4ca _ZN4llvm11StoreSDNodeD1Ev + 1610 11 llc 0x0040d3fe _ZN4llvm11StoreSDNodeD1Ev + 193918 12 llc 0x0040f92e _ZN4llvm11StoreSDNodeD1Ev + 203438 13 llc 0x005d1926 _ZN4llvm12FunctionPassD1Ev + 20998 14 llc 0x005d1f3a _ZN4llvm12FunctionPassD1Ev + 22554 15 llc 0x005d20c5 _ZN4llvm12FunctionPassD1Ev + 22949 16 llc 0x00002e44 0x0 + 11844 17 llc 0x00001f36 0x0 + 7990 18 ??? 0x00000006 0x0 + 6 make[2]: *** [src/app/alchemy/sonic.swc] Error 6 make[1]: *** [src/app/alchemy/CMakeFiles/alchemy.dir/all] Error 2 make: *** [all] Error 2 I'm not familiar enough with LLVM (which Alchemy uses under the hood) to figure out what this error means. Any ideas?

    Read the article

  • Java errors on Lotus Domino Designer Client 8.5.1

    - by ajcooper
    I have a clean install of Lotus Notes 8.5.1 (now with FP3) and I'm getting the following errors in Designer. This is with a new database with a couple of forms and views. I'm finding this is typical across all databases. Is there something I need to install/configure etc.? I'm not new to Notes, but I'm new to 8.5 Thanks Aidan Description Resource Path Location Type Cannot resolve plug-in: org.eclipse.core.runtime plugin.xml TestAgent.nsf line 9 Plug-in Problem Cannot resolve plug-in: org.eclipse.ui plugin.xml TestAgent.nsf line 8 Plug-in Problem Cannot resolve plug-in: com.ibm.commons plugin.xml TestAgent.nsf line 10 Plug-in Problem Cannot resolve plug-in: com.ibm.commons.vfs plugin.xml TestAgent.nsf line 12 Plug-in Problem Cannot resolve plug-in: com.ibm.commons.xml plugin.xml TestAgent.nsf line 11 Plug-in Problem Cannot resolve plug-in: com.ibm.designer.runtime plugin.xml TestAgent.nsf line 15 Plug-in Problem Cannot resolve plug-in: com.ibm.designer.runtime.directory plugin.xml TestAgent.nsf line 14 Plug-in Problem Cannot resolve plug-in: com.ibm.jscript plugin.xml TestAgent.nsf line 13 Plug-in Problem Cannot resolve plug-in: com.ibm.notes.java.api plugin.xml TestAgent.nsf line 20 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.core plugin.xml TestAgent.nsf line 16 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.core plugin.xml TestAgent.nsf line 21 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.designer plugin.xml TestAgent.nsf line 18 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.designer plugin.xml TestAgent.nsf line 22 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.domino plugin.xml TestAgent.nsf line 19 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.domino plugin.xml TestAgent.nsf line 23 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.extsn plugin.xml TestAgent.nsf line 17 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.extsn plugin.xml TestAgent.nsf line 24 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.rcp plugin.xml TestAgent.nsf line 25 Plug-in Problem

    Read the article

  • Bibliography behaves strange in lyx.

    - by Orjanp
    Hi! I have created a Bibliography section in my document written in lyx. It uses a book layout. For some reason it did start over again when I added some more entries. The new entries was made some time later than the first ones. I just went down to key-27 and hit enter. Then it started on key-1 again. Does anyone know why it behaves like this? The lyx code is below. \begin{thebibliography}{34} \bibitem{key-6}Lego mindstorms, http://mindstorms.lego.com/en-us/default.aspx \bibitem{key-7}C.A.R. Hoare. Communicating sequential processes. Communications of the ACM, 21(8):666-677, pages 666\textendash{}677, August 1978. \bibitem{key-8}C.A.R. Hoare. Communicating sequential processes. Prentice-Hall, 1985. \bibitem{key-9}CSPBuilder, http://code.google.com/p/cspbuilder/ \bibitem{key-10}Rune Møllegård Friborg and Brian Vinter. CSPBuilder - CSP baset Scientific Workflow Modelling, 2008. \bibitem{key-11}Labview, http://www.ni.com/labview \bibitem{key-12}Robolab, http://www.lego.com/eng/education/mindstorms/home.asp?pagename=robolab \bibitem{key-13}http://code.google.com/p/pycsp/ \bibitem{key-14}Paparazzi, http://paparazzi.enac.fr \bibitem{key-15}Debian, http://www.debian.org \bibitem{key-16}Ubuntu, http://www.ubuntu.com \bibitem{key-17}GNU, http://www.gnu.org \bibitem{key-18}IVY, http://www2.tls.cena.fr/products/ivy/ \bibitem{key-19}Tkinter, http://wiki.python.org/moin/TkInter \bibitem{key-20}pyGKT, http://www.pygtk.org/ \bibitem{key-21}pyQT4, http://wiki.python.org/moin/PyQt4 \bibitem{key-22}wxWidgets, http://www.wxwidgets.org/ \bibitem{key-23}wxPython GUI toolkit, http://www.wxPython.org \bibitem{key-24}Python programming language, http://www.python.org \bibitem{key-25}wxGlade, http://wxglade.sourceforge.net/ \bibitem{key-26}http://numpy.scipy.org/ \bibitem{key-27}http://www.w3.org/XML/ \bibitem{key-1}IVY software bus, http://www2.tls.cena.fr/products/ivy/ \bibitem{key-2}sdas \bibitem{key-3}sad \bibitem{key-4}sad \bibitem{key-5}fsa \bibitem{key-6}sad \bibitem{key-7} \end{thebibliography}

    Read the article

  • Calculation Conundrum - how do I influence another textfield?

    - by LawVS
    Hey! Basically I have a problem in that when certain parameters are used in my calculator app - it makes the result incorrect. The issue is that I have separate text fields for hours and minutes and say for example I have as the start time "13" in one text field and "30" in the other with the finish time "24" and "00" in their respective text fields. The answer should be 10 hours 30 minutes, but the answer I get is 11 hours 30 minutes. The code for this is the following. -(IBAction)done:(id)sender { int result = [finishHours.text intValue] - [startHours.text intValue]; totalHours.text = [NSString stringWithFormat:@"%d", result]; if (result < 0) { totalHours.text = [NSString stringWithFormat:@"%d", result + 24]; } -(IBAction)done2:(id)sender { int result = [startMinutes.text intValue] - [finishMinutes.text intValue]; totalMinutes.text = [NSString stringWithFormat:@"%d", result]; if (result < 0) { totalMinutes.text = [NSString stringWithFormat:@"%d", result + 60]; } } I want to make it so if certain parameters are met, then the totalHours.text is reduced by 1 hour to reflect the total minutes. How would I go about that calculation in code? Thanks!

    Read the article

  • How to tell endianness from this output?

    - by Nick Rosencrantz
    I'm running this example program and I'm suppossed to be able to tell from the output what machine type it is. I'm certain it's from inspecting one or two values but how should I perform this inspection? /* pointers.c - Test pointers * Written 2012 by F Lundevall * Copyright abandoned. This file is in the public domain. * * To make this program work on as many systems as possible, * addresses are converted to unsigned long when printed. * The 'l' in formatting-codes %ld and %lx means a long operand. */ #include <stdio.h> #include <stdlib.h> int * ip; /* Declare a pointer to int, a.k.a. int pointer. */ char * cp; /* Pointer to char, a.k.a. char pointer. */ /* Declare fp as a pointer to function, where that function * has one parameter of type int and returns an int. * Use cdecl to get the syntax right, http://cdecl.org/ */ int ( *fp )( int ); int val1 = 111111; int val2 = 222222; int ia[ 17 ]; /* Declare an array of 17 ints, numbered 0 through 16. */ char ca[ 17 ]; /* Declare an array of 17 chars. */ int fun( int parm ) { printf( "Function fun called with parameter %d\n", parm ); return( parm + 1 ); } /* Main function. */ int main() { printf( "Message PT.01 from pointers.c: Hello, pointy World!\n" ); /* Do some assignments. */ ip = &val1; cp = &val2; /* The compiler should warn you about this. */ fp = fun; ia[ 0 ] = 11; /* First element. */ ia[ 1 ] = 17; ia[ 2 ] = 3; ia[ 16 ] = 58; /* Last element. */ ca[ 0 ] = 11; /* First element. */ ca[ 1 ] = 17; ca[ 2 ] = 3; ca[ 16 ] = 58; /* Last element. */ printf( "PT.02: val1: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val1, val1, val1 ); printf( "PT.03: val2: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val2, val2, val2 ); printf( "PT.04: ip: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &ip, (long) ip, (long) ip ); printf( "PT.05: Dereference pointer ip and we find: %d \n", *ip ); printf( "PT.06: cp: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &cp, (long) cp, (long) cp ); printf( "PT.07: Dereference pointer cp and we find: %d \n", *cp ); *ip = 1234; printf( "\nPT.08: Executed *ip = 1234; \n" ); printf( "PT.09: val1: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val1, val1, val1 ); printf( "PT.10: ip: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &ip, (long) ip, (long) ip ); printf( "PT.11: Dereference pointer ip and we find: %d \n", *ip ); printf( "PT.12: val1: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val1, val1, val1 ); *cp = 1234; /* The compiler should warn you about this. */ printf( "\nPT.13: Executed *cp = 1234; \n" ); printf( "PT.14: val2: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val2, val2, val2 ); printf( "PT.15: cp: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &cp, (long) cp, (long) cp ); printf( "PT.16: Dereference pointer cp and we find: %d \n", *cp ); printf( "PT.17: val2: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val2, val2, val2 ); ip = ia; printf( "\nPT.18: Executed ip = ia; \n" ); printf( "PT.19: ia[0]: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &ia[0], ia[0], ia[0] ); printf( "PT.20: ia[1]: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &ia[1], ia[1], ia[1] ); printf( "PT.21: ip: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &ip, (long) ip, (long) ip ); printf( "PT.22: Dereference pointer ip and we find: %d \n", *ip ); ip = ip + 1; /* add 1 to pointer */ printf( "\nPT.23: Executed ip = ip + 1; \n" ); printf( "PT.24: ip: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &ip, (long) ip, (long) ip ); printf( "PT.25: Dereference pointer ip and we find: %d \n", *ip ); cp = ca; printf( "\nPT.26: Executed cp = ca; \n" ); printf( "PT.27: ca[0]: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &ca[0], ca[0], ca[0] ); printf( "PT.28: ca[1]: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &ca[1], ca[1], ca[1] ); printf( "PT.29: cp: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &cp, (long) cp, (long) cp ); printf( "PT.30: Dereference pointer cp and we find: %d \n", *cp ); cp = cp + 1; /* add 1 to pointer */ printf( "\nPT.31: Executed cp = cp + 1; \n" ); printf( "PT.32: cp: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &cp, (long) cp, (long) cp ); printf( "PT.33: Dereference pointer cp and we find: %d \n", *cp ); ip = ca; /* The compiler should warn you about this. */ printf( "\nPT.34: Executed ip = ca; \n" ); printf( "PT.35: ca[0]: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &ca[0], ca[0], ca[0] ); printf( "PT.36: ca[1]: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &ca[1], ca[1], ca[1] ); printf( "PT.37: ip: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &ip, (long) ip, (long) ip ); printf( "PT.38: Dereference pointer ip and we find: %d \n", *ip ); cp = ia; /* The compiler should warn you about this. */ printf( "\nPT.39: Executed cp = ia; \n" ); printf( "PT.40: cp: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &cp, (long) cp, (long) cp ); printf( "PT.41: Dereference pointer cp and we find: %d \n", *cp ); printf( "\nPT.42: fp: stored at %lx (hex); value is %ld (dec), %lx (hex)\n", (long) &fp, (long) fp, (long) fp ); printf( "PT.43: Dereference fp and see what happens.\n" ); val1 = (*fp)(42); printf( "PT.44: Executed val1 = (*fp)(42); \n" ); printf( "PT.45: val1: stored at %lx (hex); value is %d (dec), %x (hex)\n", (long) &val1, val1, val1 ); return( 0 ); } Output Message PT.01 from pointers.c: Hello, pointy World! PT.02: val1: stored at 21e50 (hex); value is 111111 (dec), 1b207 (hex) PT.03: val2: stored at 21e54 (hex); value is 222222 (dec), 3640e (hex) PT.04: ip: stored at 21eb8 (hex); value is 138832 (dec), 21e50 (hex) PT.05: Dereference pointer ip and we find: 111111 PT.06: cp: stored at 21e6c (hex); value is 138836 (dec), 21e54 (hex) PT.07: Dereference pointer cp and we find: 0 PT.08: Executed *ip = 1234; PT.09: val1: stored at 21e50 (hex); value is 1234 (dec), 4d2 (hex) PT.10: ip: stored at 21eb8 (hex); value is 138832 (dec), 21e50 (hex) PT.11: Dereference pointer ip and we find: 1234 PT.12: val1: stored at 21e50 (hex); value is 1234 (dec), 4d2 (hex) PT.13: Executed *cp = 1234; PT.14: val2: stored at 21e54 (hex); value is -771529714 (dec), d203640e (hex) PT.15: cp: stored at 21e6c (hex); value is 138836 (dec), 21e54 (hex) PT.16: Dereference pointer cp and we find: -46 PT.17: val2: stored at 21e54 (hex); value is -771529714 (dec), d203640e (hex) PT.18: Executed ip = ia; PT.19: ia[0]: stored at 21e74 (hex); value is 11 (dec), b (hex) PT.20: ia[1]: stored at 21e78 (hex); value is 17 (dec), 11 (hex) PT.21: ip: stored at 21eb8 (hex); value is 138868 (dec), 21e74 (hex) PT.22: Dereference pointer ip and we find: 11 PT.23: Executed ip = ip + 1; PT.24: ip: stored at 21eb8 (hex); value is 138872 (dec), 21e78 (hex) PT.25: Dereference pointer ip and we find: 17 PT.26: Executed cp = ca; PT.27: ca[0]: stored at 21e58 (hex); value is 11 (dec), b (hex) PT.28: ca[1]: stored at 21e59 (hex); value is 17 (dec), 11 (hex) PT.29: cp: stored at 21e6c (hex); value is 138840 (dec), 21e58 (hex) PT.30: Dereference pointer cp and we find: 11 PT.31: Executed cp = cp + 1; PT.32: cp: stored at 21e6c (hex); value is 138841 (dec), 21e59 (hex) PT.33: Dereference pointer cp and we find: 17 PT.34: Executed ip = ca; PT.35: ca[0]: stored at 21e58 (hex); value is 11 (dec), b (hex) PT.36: ca[1]: stored at 21e59 (hex); value is 17 (dec), 11 (hex) PT.37: ip: stored at 21eb8 (hex); value is 138840 (dec), 21e58 (hex) PT.38: Dereference pointer ip and we find: 185664256 PT.39: Executed cp = ia; PT.40: cp: stored at 21e6c (hex); value is 138868 (dec), 21e74 (hex) PT.41: Dereference pointer cp and we find: 0 PT.42: fp: stored at 21e70 (hex); value is 69288 (dec), 10ea8 (hex) PT.43: Dereference fp and see what happens. Function fun called with parameter 42 PT.44: Executed val1 = (*fp)(42); PT.45: val1: stored at 21e50 (hex); value is 43 (dec), 2b (hex)

    Read the article

  • Instruments (Leaks) and NSDateFormatter

    - by Cal
    When I run my iPhone app with Instruments Leaks and parse a bunch of NSDates using NSDateFormatter my memory goes up about 1mb and stays even though these NSDates should be dealloc'd after the parsing (I just discard them if they aren't new). I thought the malloc (in my heaviest stack trace below) could become part of the NSDate but I also thought it could be memory that only used during some intermediate step in parsing. Does anyone know which one it is or how to find out? Also, is there a way to put a breakpoint on NSDate dealloc to see if that memory is really being reclaimed? Here's what my date formatter looks like for parsing these dates: df = [[NSDateFormatter alloc] init]; [df setDateFormat:@"EEE, d MMM yyyy H:m:s z"]; Here's the Heaviest Stack trace when the memory bumps up and stays there: 0 libSystem.B.dylib 208.80 Kb malloc 1 libicucore.A.dylib 868.19 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 2 libicucore.A.dylib 868.66 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 3 libicucore.A.dylib 868.67 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 4 libicucore.A.dylib 868.67 Kb icu::DateFormatSymbols::initZoneStringFormat() 5 libicucore.A.dylib 868.67 Kb icu::DateFormatSymbols::getZoneStringFormat() const 6 libicucore.A.dylib 868.67 Kb icu::SimpleDateFormat::subParse(icu::UnicodeString const&, int&, unsigned short, int, signed char, signed char, signed char*, icu::Calendar&) const 7 libicucore.A.dylib 868.67 Kb icu::SimpleDateFormat::parse(icu::UnicodeString const&, icu::Calendar&, icu::ParsePosition&) const 8 libicucore.A.dylib 868.67 Kb icu::DateFormat::parse(icu::UnicodeString const&, icu::ParsePosition&) const 9 libicucore.A.dylib 868.67 Kb udat_parse 10 CoreFoundation 868.67 Kb CFDateFormatterGetAbsoluteTimeFromString 11 CoreFoundation 868.67 Kb CFDateFormatterCreateDateFromString 12 Foundation 868.67 Kb -[NSDateFormatter getObjectValue:forString:range:error:] 13 Foundation 868.75 Kb -[NSDateFormatter getObjectValue:forString:errorDescription:] 14 Foundation 868.75 Kb -[NSDateFormatter dateFromString:] Thanks!

    Read the article

  • Trying to access a specific option value to generate a popup window

    - by Isaac
    I am trying to use a click event to generate a popup window based off of the specific value chosen. I am having trouble with the if statement and trying to access each specific option value. Can any of you give me some hints? <select id="offices"> <option value="Choose an Office">Choose an Office</option> <option value="Residential Education (ResEd)" >Residential Education (ResEd)</option> <option value="Dean of Students">Dean of Students</option> <option value="Office of Student Affairs">Office of Student Affairs</option> <option value="Vice-Provost of Student Affairs">Vice-Provost of Student Affairs</option> </select> </div> function display(){ var officearray = [{ Office: "Residential Education (ResEd)", ID: "725-2800", Description: "The Office of Residential Education is responsible for developing the policies, programs, and staffing which support the intellectual, educational, and community-building activities in student residences. Second Floor. " }, { Office: "Dean of Students", ID: "723-7833", Description: "The Dean of Students office is composed of 13 individual administrative units that are concerned with the general welfare of both undergraduate and graduate students, in and out of the classroom. Second floor." }, { Office: "Office of Student Activities (OSA)", ID: "723-2733", Description: "Services for student organizations, student-initiated major events and programs, and fraternities and sororities. Second floor." }, { Office: "Vice-Provost of Student Affairs", ID: "725-0911", Description: "The Vice Provost for Student Affairs is responsible to the Provost for providing services and programs to undergraduate and graduate students in support of the academic mission of the University. Second floor." }] for(var i = 0; i < officearray.length; i++) { var o = document.getElementById("offices") var oString = o.options[o.selectedIndex].value; newwindow2 = window.open('', 'name', 'height=200, width=150') var tmp = newwindow2.document if (oString == officearray[i].Office) { tmp.writeln(officearray[i].Description) } } } document.getElementsByTagName('option').addEventListener("click",display,false)

    Read the article

  • check status application pool iis7 with csharp (access-denied)

    - by jack
    I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

    Read the article

  • How can I handle these different HTML chunks in Perl?

    - by kkchaitu
    I need to write a single regular expression with the three possible cases. case1 <td width="100%" align="left" bgcolor="#001E5A"><font face="Arial" size="2" color="#FFFFFF"><font size="1"><b>[Punjabi Music]</font></b> <a id="listlinks" target="_scurl" href="http://www.apnaradio.com/">Apna Radio Broadcast Live 24x7: Indian - Pakistani - Punjabi - Bhangra and Hindi Music !!</a> </font></td> <td nowrap align="center" width="10" bgcolor="#001E5A">&nbsp;</td> case2 <td width="100%" align="left" bgcolor="#001E32"><font face="Arial" size="2" color="#FFFFFF"><font size="1"><b>[jazz]</font></b> <a id="listlinks" target="_scurl" href="http://www.dinnerjazzexcursion.com">Dinner Jazz Excursion</a> <br> <font size="1"><a id="chatstuff" href="aim:goim?screenname=NA">[ AIM ]</a>&nbsp;<font color="#FF0000">Now Playing:</font> Ken Peplowski - Indian Summer</font></font></td> <td nowrap align="center" width="10" bgcolor="#001E32">&nbsp;</td> case 3 <td width="100%" align="left" bgcolor="#001E5A"><font face="Arial" size="2" color="#FFFFFF"><font size="1"><b>[World Bollywood Hindi]</font></b> <a id="listlinks" target="_scurl" href="http://www.bollywoodmusicradio.com/">Bollywood Music Radio :: Indian Music :: Request your Hindi Songs</a> <br> <font size="1"><font color="#FF0000">Now Playing:</font> Bollywood Music Radio - Fear (2007) - Tu Hai Ishq @ 13:46</font></font></td> <td nowrap align="center" width="10" bgcolor="#001E5A">&nbsp;</td>

    Read the article

  • ABAddressBookGetPersonCount(ab) problem

    - by prathumca
    Why the call to ABAddressBookGetPersonCount(ab); is giving the problem? I have around 2000 contacts in my address book. When my app gets started I'm trying to read the entire address book. This works perfectly on simulator but causing crash on IPhone. The crash report is pointing to 9 AppSupport 0x31fbca1e 0x31fb6000 + 27166 // CPRecordStoreGetCountOfInstancesOfClassWhere + 0x7e 10 AddressBook 0x318df668 0x318d5000 + 42600 // ABCGetPersonCountInStore + 0x88 11 AddressBook 0x318ea450 0x318d5000 + 87120 // ABAddressBookGetPersonCount + 0x8 12 MyAddressBook 0x0000ad30 0x1000 + 40240 // -[MyAddressBookController readAB] + 0x2c0 13 MyAddressBook 0x0000a8ce 0x1000 + 39118 // -[MyAddressBookController start] + 0x4a What I'm doing in "readAB"? - (void) readAB { ABAddressBookRef ab = ABAddressBookCreate(); CFArrayRef contacts = ABAddressBookCopyArrayOfAllPeople(ab); CFIndex count = ABAddressBookGetPersonCount(ab); for(int i = 0; i < count; i++) { //doing some thing... } } If you observe the above crash report, it is clearly pointing to CFIndex count = ABAddressBookGetPersonCount(ab);. Whats wrong with this code? I'm sure that this code works perfectly on firmware 3.1.2. But now I upgraded firmware to 3.1.3. Is this upgrade is causing any trouble? Regards, prathumca.

    Read the article

  • Getting percentage of "Count(*)" to the number of all items in "GROUP BY"

    - by celalo
    Let's say I need to have the ratio of "number of items available from certain category" to "the the number of all items". Please consider a MySQL table like this: /* mysql> select * from Item; +----+------------+----------+ | ID | Department | Category | +----+------------+----------+ | 1 | Popular | Rock | | 2 | Classical | Opera | | 3 | Popular | Jazz | | 4 | Classical | Dance | | 5 | Classical | General | | 6 | Classical | Vocal | | 7 | Popular | Blues | | 8 | Popular | Jazz | | 9 | Popular | Country | | 10 | Popular | New Age | | 11 | Popular | New Age | | 12 | Classical | General | | 13 | Classical | Dance | | 14 | Classical | Opera | | 15 | Popular | Blues | | 16 | Popular | Blues | +----+------------+----------+ 16 rows in set (0.03 sec) mysql> SELECT Category, COUNT(*) AS Total -> FROM Item -> WHERE Department='Popular' -> GROUP BY Category; +----------+-------+ | Category | Total | +----------+-------+ | Blues | 3 | | Country | 1 | | Jazz | 2 | | New Age | 2 | | Rock | 1 | +----------+-------+ 5 rows in set (0.02 sec) */ What I need is basically a result set resembles this one: /* +----------+-------+-----------------------------+ | Category | Total | percentage to the all items | (Note that number of all available items is "9") +----------+-------+-----------------------------+ | Blues | 3 | 33 | (3/9)*100 | Country | 1 | 11 | (1/9)*100 | Jazz | 2 | 22 | (2/9)*100 | New Age | 2 | 22 | (2/9)*100 | Rock | 1 | 11 | (1/9)*100 +----------+-------+-----------------------------+ 5 rows in set (0.02 sec) */ How can I achieve such a result set in a single query? Thanks in advance.

    Read the article

  • Hibernate bit array to entity mapping

    - by teabot
    I am trying to map a normalized Java model to a legacy database schema using Hibernate 3.5. One particular table encodes a foreign keys in a one-to-many relationship as a bit array column. Consider tables 'person' and 'clubs' that describes people's affiliations to clubs: person .----.------. club: .----.---------.---------------------------. | id | name | | id | name | members | binary(members) | |----+------| |----+---------|---------+-----------------| | 1 | Bob | | 10 | Cricket | 0 | 000 | | 2 | Joe | | 11 | Tennis | 5 | 101 | | 3 | Sue | | 12 | Cooking | 7 | 111 | '----'------' | 13 | Golf | 3 | 100 | '----'---------'---------'-----------------' So hopefully it is clear that person.id is used as the bit index in the bit array club.members. In this example the members column tells us that: no one is a member of Cricket, Bob/Sue - Tennis, Bob/Sue/Joe - Cooking and Sue - Golf. In my Java domain I'd like to declare this with entities like so: class Person { private int id; private String name; ... } class Club { private Set<Person> members; private int id; private String name; ... } I am assuming that I must use a UserType implementation but have been unable to find any examples where the items described by the user type are references to entities - not literal field values - or composites thereof. Additionally I am aware that I'll have to consider how the person entities are fetched when a club instance is loaded. Can anyone tell me how I can tame this legacy schema with Hibernate?

    Read the article

  • Academic question: typename

    - by Arman
    Hi, recently I accounted with a "simple problem" of porting code from VC++ to gcc/intel. The code is compiles w/o error on VC++: #include <vector> using std::vector; template <class T> void test_vec( std::vector<T> &vec) { typedef std::vector<T> M; /*==> add here typename*/ M::iterator ib=vec.begin(),ie=vec.end(); }; int main() { vector<double> x(100, 10); test_vec<double>(x); return 0; } then with g++ we have some unclear errors: g++ t.cpp t.cpp: In function 'void test_vec(std::vector<T, std::allocator<_CharT> >&)': t.cpp:13: error: expected `;' before 'ie' t.cpp: In function 'void test_vec(std::vector<T, std::allocator<_CharT> >&) [with T = double]': t.cpp:18: instantiated from here t.cpp:12: error: dependent-name 'std::M::iterator' is parsed as a non-type, but instantiation yields a type t.cpp:12: note: say 'typename std::M::iterator' if a type is meant If we add typename before iterator the code will compile w/o pb. If it is possible to make a compiler which can understand the code written in the more "natural way", then for me is unclear why we should add typename? Which rules of "C++ standards"(if there are some) will be broken if we allow all compilers to use without "typename"? kind regards Arman.

    Read the article

  • Capture *all* display-characters in JavaScript?

    - by Jean-Charles
    I was given an unusual request recently that I'm having the most difficult time addressing that involves capturing all display-characters when typed into a text box. The set up is as follows: I have a text box that has a maxlength of 10 characters. When the user attempts to type more than 10 characters, I need to notify the user that they're typing beyond the character count limit. The simplest solution would be to specify a maxlength of 11, test the length on every keyup, and truncate back down to 10 characters but this solution seems a bit kludgy. What I'd prefer to do is capture the character before keyup and, depending on whether or not it is a display-character, present the notification to the user and prevent the default action. A white-list would be challenging since we handle a lot of international data. I've played around with every combination of keydown, keypress, and keyup, reading event.keyCode, event.charCode, and event.which, but I can't find a single combination that works across all browsers. The best I could manage is the following that works properly in =IE6, Chrome5, FF3.6, but fails in Opera: NOTE: The following code utilizes jQuery. $(function(){ $('#textbox').keypress(function(e){ var $this = $(this); var key = ('undefined'==typeof e.which?e.keyCode:e.which); if ($this.val().length==($this.attr('maxlength')||10)) { switch(key){ case 13: //return case 9: //tab case 27: //escape case 8: //backspace case 0: //other non-alphanumeric break; default: alert('no - '+e.charCode+' - '+e.which+' - '+e.keyCode); return false; }; } }); }); I'll grant that what I'm doing is likely over-engineering the solution but now that I'm invested in it, I'd like to know of a solution. Thanks for your help!

    Read the article

  • Excel VBA: Passing a collection from a class to a module issue

    - by Martin
    Hello, I have been trying to return a collection from a property within a class to a routine in a normal module. The issue I am experiencing is that the collection is getting populated correctly within the property in the class (FetchAll) but when I pass the collection back to the module (Test) all the entries are populated with the last item in the list. This is the Test sub-routine in the standard module: Sub Test() Dim QueryType As New QueryType Dim Item Dim QueryTypes As Collection Set QueryTypes = QueryType.FetchAll For Each Item In QueryTypes Debug.Print Item.QueryTypeID, _ Left(Item.Description, 4) Next Item End Sub This is the FetchAll property in the QueryType class: Public Property Get FetchAll() As Collection Dim RS As Variant Dim Row As Long Dim QTypeList As Collection Set QTypeList = New Collection RS = .Run ' populates RS with a record set from a database (as an array), ' some code removed ' goes through the array and sets up objects for each entry For Row = LBound(RS, 2) To UBound(RS, 2) Dim QType As New QueryType With QType .QueryTypeID = RS(0, Row) .Description = RS(1, Row) .Priority = RS(2, Row) .QueryGroupID = RS(3, Row) .ActiveIND = RS(4, Row) End With ' adds new QType to collection QTypeList.Add Item:=QType, Key:=CStr(RS(0, Row)) Debug.Print QTypeList.Item(QTypeList.Count).QueryTypeID, _ Left(QTypeList.Item(QTypeList.Count).Description, 4) Next Row Set FetchAll = QTypeList End Property This is the output I get from the debug in FetchAll: 1 Numb 2 PBM 3 BPM 4 Bran 5 Claw 6 FA C 7 HNW 8 HNW 9 IFA 10 Manu 11 New 12 Non 13 Numb 14 Repo 15 Sell 16 Sms 17 SMS 18 SWPM This is the output I get from the debug in Test: 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM 18 SWPM Anyone got any ideas? I am probably totally overlooking something! Thanks, Martin

    Read the article

< Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >