Search Results

Search found 48927 results on 1958 pages for 'connection string'.

Page 22/1958 | < Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >

  • SQL Anywhere 11, JZ0C0: Connection is already closed

    - by Alex
    SLOVED see commend I develop am webservice based on apache tomcat 6.0.26, apache cxf 2.2.7, spring 3.0, hibernate 3.3 and sybase sqlanywhere 11. im using the latest JDBC Driver from SYBASE jconn.jar Version 6. The persistence layer is based on spring + hibernate dao, the connection is configured via a JNDI datasoure (META-INF directory). It seems that, during longer times of inactivity, the connection from the webservice to the database is closed. Exception: java.sql.SQLException: JZ0C0: Connection is already closed. Best regards, Alex

    Read the article

  • Spring.Data.NHibernate12:::Application not closing database connection(Getting max connection pool

    - by anupam3m
    Even after successful transaction.Application connection with the database persist.in Nhibernate log it shows Nhibernate Log 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.SessionImpl [(null)] <(null) - executing flush 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.ConnectionManager [(null)] < (null) - registering flush begin 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.ConnectionManager [(null)] < (null) - registering flush end 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.SessionImpl [(null)] <(null) - post flush 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.SessionImpl [(null)] <(null) - before transaction completion 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.ConnectionManager [(null)] < (null) - aggressively releasing database connection 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Connection.ConnectionProvider [(null)] <(null) - Closing connection 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.SessionImpl [(null)] <(null) - transaction completion 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Transaction.AdoTransaction [(null)] < (null) - running AdoTransaction.Dispose() 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.SessionImpl [(null)] <(null) - closing session 2010-05-21 14:45:08,428 [Worker] [0] DEBUG NHibernate.Impl.BatcherImpl [(null)] <(null) - running BatcherImpl.Dispose(true) Underneath given is my dataconfiguration file < ?xml version="1.0" encoding="utf-8" ? < objects xmlns="http://www.springframework.net" xmlns:db="http://www.springframework.net/database" xmlns:tx="http://www.springframework.net/tx"> <property name="CacheSettings" ref="CacheSettings"/> type="Risco.Rsp.Ac.AMAC.CacheMgmt.Utilities.UpdateEntityCacheHelper, Risco.Rsp.Ac.AMAC.CacheMgmt.Utilities" singleton="false"/ < object type="Spring.Objects.Factory.Config.PropertyPlaceholderConfigurer, Spring.Core" < property name="ConfigSections" value="databaseSettings"/ < db:provider id="AMACDbProvider" provider="OracleClient-2.0" connectionString="Data Source=RISCODEVDB;User ID=amacdevuser; Password=amacuser1234;"/> < object id="NHibernateSessionFactory" type="Spring.Data.NHibernate.LocalSessionFactoryObject,Spring.Data.NHibernate12" < property name="DbProvider" ref="AMACDbProvider"/ <value> Risco.Rsp.Ac.AMAC.CacheMappings</value> </property> <dictionary> < entry key="hibernate.connection.provider" value="NHibernate.Connection.DriverConnectionProvider" /> <entry key="hibernate.dialect" value="NHibernate.Dialect.Oracle9Dialect"/ value="NHibernate.Driver.OracleClientDriver"/ singleton="false" <property name="SessionFactory" ref="NHibernateSessionFactory" /> <property name="TemplateFlushMode" value="Auto" /> <property name="CacheQueries" value="true" /> <property name="EntityInterceptor" ref="AuditLogger"/> type="Spring.Data.NHibernate.HibernateTransactionManager, >Spring.Data.NHibernate12"> <property name="DbProvider" ref="AMACDbProvider"/> <property name="SessionFactory" ref="NHibernateSessionFactory"/> <property name="EntityInterceptor" ref="AuditLogger"/> type="Spring.Transaction.Interceptor.TransactionProxyFactoryObject,Spring.Data" <property name="PlatformTransactionManager" ref="transactionManager"/> <property name="Target" ref="EventPubSubDAO"/> <property name="TransactionAttributes"> <name-values> <add key="Save*" value="PROPAGATION_REQUIRES_NEW"/> <add key="Delete*" value="PROPAGATION_REQUIRED"/> </name-values> </property> type="Risco.Rsp.Ac.AMAC.DAO.EventPubSubMgmt.EventPubSubDAO, Risco.Rsp.Ac.AMAC.DAO.EventPubSubMgmt" < /object < tx:attribute-driven/ < /objects Please help me out with this issue.Thanks

    Read the article

  • The connection was reset error

    - by swetha kulkarni
    hi, i am trying to upload video in DotNetNuke CMS using Telerik Editor. But it was giving me error The connection was reset The connection to the server was reset while the page was loading. * The site could be temporarily unavailable or too busy. Try again in a few moments. * If you are unable to load any pages, check your computer's network connection. * If your computer or network is protected by a firewall or proxy, make sure that Firefox is permitted to access the Web. How to solve this error. Please help me.

    Read the article

  • SqlServer / MySql Connection pool: is it really important ?

    - by stighy
    Hy guys, after a lot of problem with my hoster, i decided to disable connection pooling of my application. The problem was related to the number of concurrent connections : only five. So i decided to disable connection pooling: the result is that my web app don't crash. So i'm asking you: are there some "collateral" effect disabling connection pooling ? Is it so important ? I didn't noticed bad performance after disabling it. Thank you for your (i'm sure) precious advice!

    Read the article

  • C# MySQL Lost Connection

    - by Adam
    Hi. I have C# application and I'm using MySQL database. Everything seems to be fine except one thing. Our computer network is little bit unstable. When I'm trying to execute query and the computer simultaneously loses connection to the mysql server (I'm simulating this situation by unplugging the network cable from computer which is mysql server), the program is trying to do something for long time (tens seconds). I would like to specify something like timeout which ends the query by exception or something similar. I tried to add timeout parameters to connection string but with no effect (I've used ConnectionTimeout and DefaultCommandTimeout). Is there any other way to identify lost connection after few seconds? Thank you Adam P.S. Sorry for my english, I'm not native speaker.

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • Artificially create a connection timeout error

    - by Mark Ingram
    I've had a bug in our software that occurs when I receive a connection timeout. These errors are very rare (usually when my connection gets dropped by our internal network). How can I generate this kind of effect artificially so I can test our software? If it matters the app is written in C++/MFC using CAsyncSocket classes. Edit: I've tried using a non-existant host, and I get the socket error: WSAEINVAL (10022) Invalid argument My next attempt was to use Alexander's suggestion of connecting to a different port, e.g. 81 (on my own server though). That worked great. Exactly the same as a dropped connection (60 second wait, then error). Thank you!

    Read the article

  • How to check connection leak using regular expression ?

    - by gauravkarnatak
    I have to check connection leak in my application i.e. open connections which have not been closed. After searching, after I found out that a thousands times connections have been opened but I can't manually go to each and every code fragment and check for connection close thing. I think, it could be possible using a regular expression but the fact is, I am not that well versed with regex that I could write one. Please suggest a regular expression for checking in a no of java files that a opened connection has been closed or not. My code pattern is something like this. try { /* Some code goes here */ con = EJBUtil.getConnection(JNDI_NAME); /* Some code goes here */ } finally { /* Some code goes here */ DBUtil.close(con); or closeConnection.close(con); /* Some code goes here */ }

    Read the article

  • MySQL with Java: Open connection only if possible

    - by emempe
    I'm running a database-heavy Java application on a cluster, using Connector/J 5.1.14. Therefore, I have up to 150 concurrent tasks accessing the same MySQL database. I get the following error: Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.MySQLNonTransientConnectionException: Too many connections This happens because the server can't handle so many connections. I can't change anything on the database server. So my question is: Can I check if a connection is possible BEFORE I actually connect to the database? Something like this (pseudo code): check database for open connection slots if (slot is free) { Connection cn = DriverManager.getConnection(url, username, password); } else { wait ... } Cheers

    Read the article

  • how to add connection string for a windows form applicaton in asp.net

    - by manoj chalode
    i am working on windows form application and i want to add connection string of a database in. Right now, though i can access database i don't know the proper reasoning behind it. I have created a database and added it in a "Database" folder. The code for it is given below. i also want to know how can I make a connection string which can work on different PCs without changing it (I'm talking about relative path given in the "AttachDbFilename" attribute in the connection string). Reply... Conn = new SqlConnection(@"Data Source=.\SQLEXPRESS;AttachDbFilename="+ Application.StartupPath + "\\Database\\Database.mdf;Integrated Security=True;User Instance=True");

    Read the article

  • What is the correct connection string for SQL 2000 server in entity framework

    - by M-Askman
    I success to use entity framework for MySQL but reverse code can not be used with SQL Server 2000, then i guess to change connection string to connect SQL Server 2000, however, got error <add name="BetterContext" connectionString="Data Source=server2;Initial Catalog=GoodDB;User ID=sa;Password=hello;MultipleActiveResultSets=True;" providerName="System.Data.SqlClient" /> An error occurred while getting provider information from the database. This can be caused by Entity Framework using an incorrect connection string. Check the inner exceptions for details and ensure that the connection string is correct public partial class BetterContext : DbContext { static BetterContext() { Database.SetInitializer<BetterContext>(null); } public livefeedContext() : base("Name=BetterContext") { }

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • java: decoding URI query string

    - by Jason S
    I need to decode a URI that contains a query string; expected input/output behavior is something like the following: abstract class URIParser { /** example input: * something?alias=pos&FirstName=Foo+A%26B%3DC&LastName=Bar */ URIParser(String input) { ... } /** should return "something" for the example input */ public String getPath(); /** should return a map * {alias: "pos", FirstName: "Foo+A&B=C", LastName: "Bar"} */ public Map<String,String> getQuery(); } I've tried using java.net.URI, but it seems to decode the query string so in the above example I'm left with "alias=pos&FirstName=Foo+A&B=C&LastName=Bar" so there is ambiguity whether a "&" is a query separator or is a character in a query component. edit: just tried URI.getRawQuery() and it doesn't do the encoding, so I can split the query string with a "&", but then what do I do? Any suggestions?

    Read the article

  • Java: Print and access List <String[]>

    - by battousai622
    Im reading in a file and storing it in t1. How do i access the elements in t1? When i try to print it i get addresses instead of values. Also whats the dif between string and string[]? CSVReader reader = new CSVReader(new FileReader("src/new_acquisitions.csv")); List <String[]> t1 = reader.readAll(); int i = 0 while(i < t1.size()) { System.out.println(t1.get(i)); i++; } output: [Ljava.lang.String;@9304b1 [Ljava.lang.String;@190d11 [Ljava.lang.String;@a90653 [Ljava.lang.String;@de6ced

    Read the article

  • return new string vs .ToString()

    - by Leroy Jenkins
    Take the following code: public static string ReverseIt(string myString) { char[] foo = myString.ToCharArray(); Array.Reverse(foo); return new string(foo); } I understand that strings are immutable, but what I dont understand is why a new string needs to be called return new string(foo); instead of return foo.ToString(); I have to assume it has something to do with reassembling the CharArray (but thats just a guess). Whats the difference between the two and how do you know when to return a new string as opposed to returning a System.String that represents the current object?

    Read the article

  • Formatting a string in Java using class attributes

    - by Jason R. Coombs
    I have a class with an attribute and getter method: public Class MyClass { private String myValue = "foo"; public String getMyValue(); } I would like to be able to use the value of foo in a formatted string as such: String someString = "Your value is {myValue}." String result = Formatter.format(someString, new MyClass()); // result is now "Your value is foo." That is, I would like to have some function like .format above which takes a format string specifying properties on some object, and an instance with those properties, and formats the string accordingly. Is it possible to do accomplish this feat in Java?

    Read the article

  • How do I connect to SQL Server with VB?

    - by Wayne Werner
    Hi, I'm trying to connect to a SQL server from VB. The SQL server is across the network uses my windows login for authentication. I can access the server using the following python code: import odbc conn = odbc.odbc('SignInspection') c = conn.cursor() c.execute("SELECT * FROM list_domain") c.fetchone() This code works fine, returning the first result of the SELECT. However, I've been trying to use the SqlClient.SqlConnection in VB, and it fails to connect. I've tried several different connection strings but this is the current code: Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Dim conn As New SqlClient.SqlConnection conn.ConnectionString = "data source=signinspection;initial catalog=signinspection;integrated security=SSPI" Try conn.Open() MessageBox.Show("Sweet Success") 'Insert some code here, woo Catch ex As Exception MessageBox.Show("Failed to connect to data source.") MessageBox.Show(ex.ToString()) Finally conn.Close() End Try End Sub It fails miserably, and it gives me an error that says "A network-related or instance-specific error occurred... (provider: Named Pipes Provider, error: 40 - Could not open a connection to SQL Server) I'm fairly certain it's my connection string, but nothing I've found has given me any solid examples (server=mySQLServer is not a solid example) of what I need to use. Thanks! -Wayne

    Read the article

  • Only show items owned by the currently logged in user in category list view

    - by jalbasri
    I'd like to be able to provide a "Category List" view that only shows Articles that the currently logged in user owns. Is there somewhere I can edit the query used to populate the Category List view or an extension that provides this functionality. Thank you for any help you can provide. -J. Thank you for your answer. I've written the plugin. Instead of passing in an array of Articles the onContentBeforeDisplay function is called for every article and an ArrayObject of the single article gets passed in. I've been able to identify the articles I want not to be displayed but still cannot get them not to display. The $params variable has values such as "list_show_xxx" but I can't seem to change or access them. here is a var_dump($params): object(Joomla\Registry\Registry)#190 (1) { ["data":protected]=> object(stdClass)#250 (83) { ["article_layout"]=> string(9) "_:default" ["show_title"]=> string(1) "1" ["link_titles"]=> string(1) "1" ["show_intro"]=> string(1) "1" ["info_block_position"]=> string(1) "1" ["show_category"]=> string(1) "1" ["link_category"]=> string(1) "1" ["show_parent_category"]=> string(1) "0" ["link_parent_category"]=> string(1) "0" ["show_author"]=> string(1) "1" ["link_author"]=> string(1) "0" ["show_create_date"]=> string(1) "0" ["show_modify_date"]=> string(1) "0" ["show_publish_date"]=> string(1) "1" ["show_item_navigation"]=> string(1) "1" ["show_vote"]=> string(1) "0" ["show_readmore"]=> string(1) "1" ["show_readmore_title"]=> string(1) "1" ["readmore_limit"]=> string(3) "100" ["show_tags"]=> string(1) "1" ["show_icons"]=> string(1) "1" ["show_print_icon"]=> string(1) "1" ["show_email_icon"]=> string(1) "1" ["show_hits"]=> string(1) "1" ["show_noauth"]=> string(1) "0" ["urls_position"]=> string(1) "0" ["show_publishing_options"]=> string(1) "0" ["show_article_options"]=> string(1) "0" ["save_history"]=> string(1) "1" ["history_limit"]=> int(10) ["show_urls_images_frontend"]=> string(1) "0" ["show_urls_images_backend"]=> string(1) "1" ["targeta"]=> int(0) ["targetb"]=> int(0) ["targetc"]=> int(0) ["float_intro"]=> string(4) "left" ["float_fulltext"]=> string(4) "left" ["category_layout"]=> string(9) "_:default" ["show_category_heading_title_text"]=> string(1) "1" ["show_category_title"]=> string(1) "0" ["show_description"]=> string(1) "0" ["show_description_image"]=> string(1) "0" ["maxLevel"]=> string(1) "1" ["show_empty_categories"]=> string(1) "0" ["show_no_articles"]=> string(1) "1" ["show_subcat_desc"]=> string(1) "1" ["show_cat_num_articles"]=> string(1) "0" ["show_base_description"]=> string(1) "1" ["maxLevelcat"]=> string(2) "-1" ["show_empty_categories_cat"]=> string(1) "0" ["show_subcat_desc_cat"]=> string(1) "1" ["show_cat_num_articles_cat"]=> string(1) "1" ["num_leading_articles"]=> string(1) "1" ["num_intro_articles"]=> string(1) "4" ["num_columns"]=> string(1) "1" ["num_links"]=> string(1) "4" ["multi_column_order"]=> string(1) "0" ["show_subcategory_content"]=> string(1) "0" ["show_pagination_limit"]=> string(1) "1" ["filter_field"]=> string(5) "title" ["show_headings"]=> string(1) "1" ["list_show_date"]=> string(1) "0" ["date_format"]=> string(0) "" ["list_show_hits"]=> string(1) "1" ["list_show_author"]=> string(1) "1" ["orderby_pri"]=> string(5) "order" ["orderby_sec"]=> string(5) "rdate" ["order_date"]=> string(9) "published" ["show_pagination"]=> string(1) "2" ["show_pagination_results"]=> string(1) "1" ["show_feed_link"]=> string(1) "1" ["feed_summary"]=> string(1) "0" ["feed_show_readmore"]=> string(1) "0" ["display_num"]=> string(2) "10" ["menu_text"]=> int(1) ["show_page_heading"]=> int(0) ["secure"]=> int(0) ["page_title"]=> string(16) "Non-K2 News List" ["page_description"]=> string(33) "Bahrain Business Incubator Centre" ["page_rights"]=> NULL ["robots"]=> NULL ["access-edit"]=> bool(true) ["access-view"]=> bool(true) } } I've tried $params-data-list_show_author = "0" but then the page doesn't load, problem is accessing and changing the variables in $param. So the last step is to figure out how not to show the article. Any ideas?

    Read the article

  • Parsing String to TreeNode

    - by Krusu70
    Anyone have a good algorithm how to parse a String to TreeNode in Java? Let's say we have a string s which says how to build a TreeNode. A(B,C) means that A is the name (String) of TreeNode, B is child of A (Treenode), C is sibling of A (TreeNode). So if I call function with string A(B(D,E(F,G)),C) (just a example), then I get a TreeNode equals to: level A (String: name), B - Child (TreeNode), C - Sibling (TreeNode) level B (String: name), D - Child of B (TreeNode), E - Sibling of B (TreeNode) level E (String: name), F - Child of E (TreeNode), G - Sibling of E (TreeNode) The name may not be 1 letter, it could be like real name (many letters).

    Read the article

  • PHP strip_tags only at the end of the string

    - by Solomon Closson
    Ok, well, I just want to use strip_tags function on the very end of a string to get rid of any <br /> tags. Here's what I have now, but this is no good because it strips these tags from everywhere in the string, which is not what I want. I only need them stripped out if it's at the end of the string... $string = strip_tags($string, strtr($string, array('<br />' => '&#10;'))); How can I do this same thing, except only at the very end of a string?? Thanks guys!!

    Read the article

  • Trimming byte array when converting byte array to string in Java/Scala

    - by prosseek
    Using ByteBuffer, I can convert a string into byte array: val x = ByteBuffer.allocate(10).put("Hello".getBytes()).array() > Array[Byte] = Array(104, 101, 108, 108, 111, 0, 0, 0, 0, 0) When converting the byte array into string, I can use new String(x). However, the string becomes hello?????, and I need to trim down the byte array before converting it into string. How can I do that? I use this code to trim down the zeros, but I wonder if there is simpler way. def byteArrayToString(x: Array[Byte]) = { val loc = x.indexOf(0) if (-1 == loc) new String(x) else if (0 == loc) "" else new String(x.slice(0,loc)) }

    Read the article

  • SAP Business One: Connection Error When I try to connect to UI API

    - by RedsDevils
    Hi All, I got this error message "Connection - Could not find SBO that match the connection string [66000-85]" when I try to connect SAP Business One UI API. I connect like the following : private void SetApplication() { SAPbouiCOM.SboGuiApi SboGuiApi = null; string sConnectionString = null; SboGuiApi = new SAPbouiCOM.SboGuiApi(); // connect to a running SBO Application sConnectionString = Environment.GetCommandLineArgs().GetValue(1).ToString() ; SboGuiApi.Connect(sConnectionString); SBO_Application = SboGuiApi.GetApplication(-1); }

    Read the article

< Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >