Search Results

Search found 50150 results on 2006 pages for 'page search'.

Page 223/2006 | < Previous Page | 219 220 221 222 223 224 225 226 227 228 229 230  | Next Page >

  • Unknown redirect & slow page load

    - by Andrew
    Hello: I am hosting a website with GoDaddy's "Deluxe Linux" package. Of late, I noticed my website is loading nearly 10x slower. As I begin to debug, I noticed the following redirect occurring however nothing in my script would be causing it. It hits the URL, www.domain.com, then a 302 fires to www.domain.com/39dnda, then another 302 back to www.doamin.com ??? The first 302 is random each time... You can see the images here: http://yfrog.com/4jredirectvp

    Read the article

  • ASP.net Pop up Alert without page load

    - by Sunny
    Hi, In ASP.NET -- I want to popup an alert window in the case of an event. I don't have a button, i do not load the page at that event. When I searched i got a lot of java script examples but I can't use them as they work either on a button click or on page load. I just want a pop window to come as soon as I capture a particular event. I keep checking for the events every 5 second, as soon as i capture one event, there is a switch case for the actions to follow according to the event captured. For one particular case, i need one pop up "Sorry" along with an OK button. Can someone tell me what to do. Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • jQuery - How to remove a DOM element BEFORE complete page load

    - by webfac
    Now this may seem like a silly question, but I need to know how to remove a DOM element BEFORE it is displayed to the user. In short, I am using a div that has a background image alerting the user to enable javascript before proceeding. If the user has javascript enabled I am using jQuery to remove the DOM element, in this case $(".check-js") which is the div housing the image. Using the conventional methods to unload DOM objects as follows does not work because it waits for the page load to complete, then removes the element, causing the image to flicker on and off each time the page loads: $(function(){ $(".check-js").css( {display:"none"} ) }) I simply want to remove the div if the user has js enabled, and he must never see this div. Any suggestions and I will be grateful, thanks.

    Read the article

  • Including Applet in JSP page

    - by Hara Chaitanya
    Hi everyone, I wrote an Applet program which draws a pie chart. The values for the applet should be passed from JSP page. I wrote the following lines of code in JSP jsp:plugin type="applet" code="drawPie" codebase="." width="750" heigth="300" jsp:params jsp:param name="user_id" value="<% =user %" /jsp:params /jsp:plugin and in applet i used String user=getParameter("user_id"); when i open the jsp page nothing comes neither error nor the chart ........ What is the problem/error in the above code snippet.....

    Read the article

  • How to get the client ip address in ASP.Net MVC?

    - by melaos
    hi guys, i'm totally new to the asp.net mvc stack and i was wondering what happened to the simple Page object and the Request ServerVariables object? basically what i wanted to do is to pull out the client's pc ip address. but i fail to understand how the current MVC structure has changed all of this. as far as i can understand, most of the variable object has been replaced by the HttpRequest variants? anybody care to share some resources? really a sea of stuff to learn in the asp.net mvc world :) thanks.

    Read the article

  • PHP page load seems to be requesting itself and misinterpreting the result

    - by Regis Frey
    I'm working on a messy PHP page by another developer and I was analyzing the resource view in the Webkit developer tools and noticed that the page (index.php) makes an HTTP requests for itself and then interprets the results as an image despite it being sent with the text/html header. Because of this it throws the warning: Resource interpreted as image but transferred with MIME type text/html. Looking at the time graph the call comes after the <head> because it has already requested images for the body. Sometimes there are even two 'bad' requests. Can anyone explain what might be happening and/or suggest how to fix this? Could these be related to PHP includes?

    Read the article

  • Quickly check which part of the page lifecycle a control is in

    - by Khanzor
    Is there any way to check what events have fired during the asp.net webforms page/control lifecycle? I know that I can manually add handlers for each event, but that seems a bit ... inefficient. Is there a visualiser, or a property that I can check that will tell me whether these events have fired? EDIT The reason I want to know this is that I am overriding the ViewState property of a custom control, and the viewstate disappears at some point, and I'd like to know at which point in the page lifecycle it is being overriden.

    Read the article

  • Javascript undefined behavior with string.replace

    - by epochwolf
    I've been messing around with string.replace and I noticed something very odd with Webkit and Firebug's javascript consoles. I can repeat this behavior in a blank browser window. (Look at the first and last lines) >>> "/literature?page=".replace(/page=/i, "page=2") "/literature?page=" >>> "/literature?page=".replace("page=", "page=2") "/literature?page=2" >>> "/literature?page=".replace(/page=/, "page=2") "/literature?page=2" >>> "/literature?page=".replace(/page=/i, "page=2") "/literature?page=2" Just so nobody thinks I mistyped something, here are screenshots. Firebug (3.0.14) Webkit (Latest nightly as of this post's creation.)

    Read the article

  • Javascript - how to change elements content inside a page when using iframes, using dom, not jquery

    - by Erez
    Hello all, I have this iframe and as u can see it call a js function with the onload trigger. <iframe name="top" id="top" width="99%" height="20%" src="top.htm" frameborder="0" scrolling="no" onload="log_in()"></iframe> What i need to do is to effect the element inside "top.htm" (change innerHTML and stuff like that) from that function. But the problem is that the funnction does not recognize the elements of the "top.htm" page, only the ones in index.htm (the page with the iframes). p.s. i have to use DOM and i have to use iframes. Any one knows how to do that? 10x :-)

    Read the article

  • Why Does Thread.CurrentThread.CurrentCulture Change between Page Rendering and HttpModule.PostReques

    - by Chad
    I'm creating an HttpModule that needs to know the value of Thread.CurrentThread.CurrentCulture as set in an MVC application. That value is currently being set by the BaseController, but when my HttpModule.PostRequestHandlerExecute() method fires, it reverts to what the Culture was prior to page rendering. I have duplicated this by creating a simple web app with these steps: Module.PreRequestHandlerExecute: Set culture to A Page_Load: Culture is currently A. Set culture to B Module.PostRequestHandlerExecute: Current thread culture is A. I expected it to be B but it was changed between page rendering and PostRequestHandlerExecute Any idea why .Net changes this value or how I could get around it? The thread is the same, so something in .Net must be explicitly reverting the culture.

    Read the article

  • 404 when page exists - IIS 5, ASP.NET 4.0

    - by tsilb
    I have a webserver running Server 2003 Datacenter and IIS 5 which is hosting a variety of ASP.NET 2.0 websites. I'm attempting to add an ASP.NET 4.0 website which I wrote via the VS2010 Beta, and I have .NET 4.0 Beta 1 installed on the server. The website appears to be configured correctly; anonymous access is on, it points to the right folder, and is set to asp.net 4.0. Why might it be giving me a 404 error when I browse to it, both locally and remotely?

    Read the article

  • Sending message to windows service by web page

    - by Enriquev
    Hello, How could I do this with no access denied problem? I have a windows service: protected override void OnCustomCommand(int command) { if (command == 1) { foreach (Process traceProcess in Process.GetProcessesByName("notepad.exe")) { traceProcess.Kill(); } } } when I do this: ServiceController sc = new ServiceController("ProjectManager"); if (sc != null) sc.ExecuteCommand(1); From a windows forms it works, but not from a web page, I get access denied on sc.ExecuteCommand. What's the best way for a web page to talk to a service?

    Read the article

  • Window Media Player issues two requests for the audio on web page

    - by Ron Harlev
    I'm using Windows Media Player in a web page. I have version 11 installed so that is the version I'm testing with right now. The player is embedded on the page with this HTML: <OBJECT id='MS_mediaPlayer' width="400" height="45" classid='CLSID:6BF52A52-394A-11D3-B153-00C04F79FAA6' codebase='http://activex.microsoft.com/activex/controls/mplayer/en/nsmp2inf.cab#Version=5,1,52,701' standby='Loading Microsoft Windows Media Player components...' type='application/x-oleobject'> <param name='autoStart' value="false"> <param name='uiMode' value="invisible"> <param name='loop' value="false"> </OBJECT> I'm calling in JavaScript: MS_mediaPlayer.URL = "SomeAudioFile.mp3" MS_mediaPlayer.controls.play(); When I look at Fiddler I can see that the player actually downloads "SomeAudioFile.mp3" twice. Is there some setting I have wrong? I was trying to set the "autoPlay" to true and avoid calling "play()". Got the same result - two downloads. UPDATE: The first request's user-agent is "Windows-Media-Player/11.0.5721.5268". The second has "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 5.1; GTB6; .NET CLR 1.1.4322; .NET CLR 2.0.50727; .NET CLR 3.0.04506.30; .NET CLR 3.0.04506.648; .NET CLR 3.5.21022; .NET CLR 3.0.4506.2152; .NET CLR 3.5.30729)". Looks like the browser is running the same request the second time. No Idea why Any ideas? UPDATE (4/1/10): Still no solution. I debugged the JS thoroughly and there is only one call to MediaPlayer.URL='.....' to set the audio file. Nothing else triggers the media player to load the file and there is no other place referencing the audio file on the page. One other interesting fact is that this doesn't happen (the double loading of the audio) when I run the browser locally on my development web server. But other remote requests to the same web server generate the double audio loading. I believe I eliminated any correlation with specific IE version or media player version. This happens with IE6-8 and WM9-12

    Read the article

  • Advice for printing a colored page

    - by eSKay
    If I need to print a colored document on a black and white printer, then which one of these options do you think is better: desaturating the document first and then sending it to printer giving the print command on the colored document only (trusting the printer for the job) I know most of us use the second option. I want to know if there is any possible advantage of using the first option?

    Read the article

  • Add Today's Date to SharePoint Master Page

    - by soniiic
    Surely there must be a simple way of putting a simple code block into a master page :( I've tried using the obvious <%= "Hello, World!" %> syntax but code blocks aren't allowed. Then tried a site column, but don't know how to use them. Then tried web zones but master pages can't use them. Tried putting a web part (which are super difficult to make and deploy btw) into the page layout, but it just doesn't render :/ All I want is something nice and simple at the top of my site which shows today's date and the format I want to use is DateTime.Today.ToString("ddd, d MMMM yyyy") (Otherwise I'm resorting to javascript document.write!) Thanks all,

    Read the article

  • Making footer image stick to bottom of web browser or page

    - by Slyphee
    Hello, I know this has been asked alot of times in the past but for the life of me I can't seem to get any of the other solutions to work. What I'm trying to do is to get the footer (which is an image that repeats across the width of the page) to stick to the bottom of the browser when there isn't enough content to naturally push it to the bottom of the page and when there IS enough content to push it to the bottom it does just that. An example is the one at http://www.themaninblue.com/experiment/footerStickAlt/good_example_short.htm which does exactly what I want but I can't get to work either. The code that I've currently got implemented makes the footer stick to a certain section of the page with text going under it. You can see it at sourcectrl.co.uk but its not much to look at. Heres the code for your viewing pleasure. html, body { font: 100% Arial, Helvetica, sans-serif; height: 100%; color: #597347; margin: 0; padding: 0; background: #573909; } header { display: block; position: relative; top: 0; left: 0; width: 100%; height: 66px; background: url(../images/FillerPage_01.gif) repeat-x left bottom; } section { width: 940px; margin: 0 auto; font-size: 1.4em; overflow: auto; min-height: 100%; height: auto !important; height: 100%; margin-bottom: 87px; position: relative; padding-bottom: 90px; } footer { display:block; position: absolute; bottom: 0; width: 100%; height: 87px; background: url(../images/FillerPage_08.gif) repeat-x left bottom; } Sorry if it seems messy! I'd just like to know if I'm heading in the right direction or theres something I'm just not getting? Oh yeah I'm trying to do all of this with the html 5 markup which is why there is no #footer and the like (could this be why none of the solutions work?). If anyone could give me any help or guidance I'd be soooooo grateful.

    Read the article

  • ASP.NET MVC ,Maintaining Model State between Ajax requests

    - by Podders
    problem: On first full page request, my controller invokes an applicationServices Layer (Web Service Proxy to my business tier) in order to populate a collection of current services that is stored in my own controller base class property. This is then to be displayed within a view. Everything within the context of that controller has access to this "Services Collection". Now when i make further calls to the same action method via an AJAX Call, i obviously hitt a different instance of that controller meaning my services collection is empty. So other than re-getting the whole collection again, where would i store this collection so it gets persisted between ajax requests? Should i persist it as a seperate DomainModel Object, Session object?....as ViewData is not working for me obv. Excuse my MVC ignorance :) Any help would be greatly appreciated :)

    Read the article

< Previous Page | 219 220 221 222 223 224 225 226 227 228 229 230  | Next Page >