Search Results

Search found 6152 results on 247 pages for 'known'.

Page 224/247 | < Previous Page | 220 221 222 223 224 225 226 227 228 229 230 231  | Next Page >

  • Quick question regarding this issue, Why doesnt it print out the second value(converted second value

    - by sil3nt
    Quick question, What have I done wrong here. The purpose of this code is to get the input into a string, the input being "12 34", with a space in between the "12" and "32" and to convert and print the two separate numbers from an integer variable known as number. Why doesn't the second call to the function copyTemp, not produce the value 34?. I have an index_counter variable which keeps track of the string index and its meant to skip the 'space' character?? what have i done wrong? thanks. #include <stdio.h> #include <string.h> int index_counter = 0; int number; void copyTemp(char *expr,char *temp); int main(){ char exprstn[80]; //as global? char tempstr[80]; gets(exprstn); copyTemp(exprstn,tempstr); printf("Expression: %s\n",exprstn); printf("Temporary: %s\n",tempstr); printf("number is: %d\n",number); copyTemp(exprstn,tempstr); //second call produces same output shouldnt it now produce 34 in the variable number? printf("Expression: %s\n",exprstn); printf("Temporary: %s\n",tempstr); printf("number is: %d\n",number); return 0; } void copyTemp(char *expr,char *temp){ int i; for(i = index_counter; expr[i] != '\0'; i++){ if (expr[i] == '0'){ temp[i] = expr[i]; } if (expr[i] == '1'){ temp[i] = expr[i]; } if (expr[i] == '2'){ temp[i] = expr[i]; } if (expr[i] == '3'){ temp[i] = expr[i]; } if (expr[i] == '4'){ temp[i] = expr[i]; } if (expr[i] == '5'){ temp[i] = expr[i]; } if (expr[i] == '6'){ temp[i] = expr[i]; } if (expr[i] == '7'){ temp[i] = expr[i]; } if (expr[i] == '8'){ temp[i] = expr[i]; } if (expr[i] == '9'){ temp[i] = expr[i]; } if (expr[i] == ' '){ temp[i] = '\0'; sscanf(temp,"%d",&number); index_counter = i+1; //skips? } } // is this included here? temp[i] = '\0'; }

    Read the article

  • Nested Execution Flow Control

    - by chris
    I've read tens of answers related to callbacks, promises and other ways to control flow, but I can't still wrap my head around this task, obviously due to my lack of competence. I have a nested problem: In test_1() (and the other functions) I would like to ensure that the rows are added to the table according to the order in which the elements are in the object; I would like to execute either test_2 or test_3 (or both after each other) only after test_1 has finished completely. Actually the right sequence will only be known at runtime (there will be a switch with the possible sequences, like 1,2,3 or 1,3,2 or 1,2,1,3 or 1,3,3,2, etc...) Code: $(function () { // create table tbl = document.createElement('table'); tbl.className = "mainTbl"; $("body").append(tbl); }); function test_1() { $.each(obj, function () { var img = new Image(); img.onload = function () { // add row of data to table var row = tbl.insertRow(-1); var c1 = row.insertCell(0); c1.innerHTML = "loaded"; }; img.onerror = function () { // add row of data to table var row = tbl.insertRow(-1); var c1 = row.insertCell(0); c1.innerHTML = "not loaded"; }; img.src = this.url; }); } function test_2() { $.each(obj, function () { var img = new Image(); img.onload = function () { // add row of data to table var row = tbl.insertRow(-1); var c1 = row.insertCell(0); c1.innerHTML = "loaded"; }; img.onerror = function () { // add row of data to table var row = tbl.insertRow(-1); var c1 = row.insertCell(0); c1.innerHTML = "not loaded"; }; img.src = this.url; }); } function test_3() { $.each(obj, function () { var img = new Image(); img.onload = function () { // add row of data to table var row = tbl.insertRow(-1); var c1 = row.insertCell(0); c1.innerHTML = "loaded"; }; img.onerror = function () { // add row of data to table var row = tbl.insertRow(-1); var c1 = row.insertCell(0); c1.innerHTML = "not loaded"; }; img.src = this.url; }); } I know that calling the functions in sequence doesn't work as they don't wait for each other... I think promises are they way to go but I can't find the right combination and the documentation is way too complex for my skills. What's the best way to structure the code so that it's executed in the right order?

    Read the article

  • IE CSS bug: table border showing div with visibility: hidden, position: absolute

    - by Alessandro Vernet
    The issue I have a <div> on a page which is initially hidden with a visibility: hidden; position: absolute. The issue is that if a <div> hidden this way contains a table which uses border-collapse: collapse and has a border set on it cells, that border still shows "through" the hidden <div> on IE. Try this for yourself by running the code below on IE6 or IE7. You should get a white page, but instead you will see: Possible workaround Since this is happening on IE and not on other browsers, I assume that this is an IE bug. One workaround is to add the following code which will override the border: .hide table tr td { border: none; } I am wondering: Is this a known IE bug? Is there a more elegant solution/workaround? The code <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <style type="text/css"> /* Style for tables */ .table tr td { border: 1px solid gray; } .table { border-collapse: collapse; } /* Class used to hide a section */ .hide { visibility: hidden; position: absolute; } </style> </head> <body> <div class="hide"> <table class="table"> <tr> <td>Gaga</td> </tr> </table> </div> </body> </html>

    Read the article

  • WPF: How to properly override the methods when creating custom control

    - by EV
    Hi, I am creating a custom control Toolbox that is derived from ItemsControl. This toolbox is supposed to be filled with icons coming from the database. The definition looks like this: public class Toolbox : ItemsControl { protected override DependencyObject GetContainerForItemOverride() { return new ToolboxItem(); } protected override bool IsItemItsOwnContainerOverride(object item) { return (item is ToolboxItem); } } Toolboxitem is derived from ContentControl. public class ToolboxItem : ContentControl { static ToolboxItem() { FrameworkElement.DefaultStyleKeyProperty.OverrideMetadata(typeof(ToolboxItem), new FrameworkPropertyMetadata(typeof(ToolboxItem))); } } Since the number of icons stored in a database is not known I want to use the data template: <DataTemplate x:Key="ToolBoxTemplate"> <StackPanel> <Image Source="{Binding Path=url}" /> </StackPanel> </DataTemplate> Then I want the Toolbox to use the template. <Toolbox x:Name="NewLibrary" ItemsSource="{Binding}" ItemTemplate="ToolBoxtemplate"> </Toolbox> I'm using ADO.NET entity framework to connect to a database. The code behind: SystemicsAnalystDBEntities db = new SystemicsAnalystDBEntities(); private void Window_Loaded(object sender, RoutedEventArgs e) { NewLibrary.ItemsSource = from c in db.Components select c; } However, there is a problem. When the code is executed, it displays the object from the database (as the ItemSource property is set to the object from the database) and not the images. It does not use the template. When I use the static images source it works in the right way I found out that I need to override the PrepareContainerForItemOverride method.But I don't know how to add the template to it. Thanks a lot for any comments. Additional Information Here is the ControlTemplate for ToolboxItem: <ControlTemplate TargetType="{x:Type s:ToolboxItem}"> <Grid> <Rectangle Name="Border" StrokeThickness="1" StrokeDashArray="2" Fill="Transparent" SnapsToDevicePixels="true" /> <ContentPresenter Content="{TemplateBinding ContentControl.Content}" Margin="{TemplateBinding Padding}" SnapsToDevicePixels="{TemplateBinding UIElement.SnapsToDevicePixels}" /> </Grid> <ControlTemplate.Triggers> <Trigger Property="IsMouseOver" Value="true"> <Setter TargetName="Border" Property="Stroke" Value="Gray" /> </Trigger> </ControlTemplate.Triggers> </ControlTemplate>

    Read the article

  • Schema to support dynamic properties

    - by Johan Fredrik Varen
    Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

    Read the article

  • Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

    - by Ted
    There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • Dynamically find other hosts in a LAN in Java

    - by Federico Cristina
    A while ago I developed a little LAN chat app. in Java which allows chatting with other hosts, send images, etc. Although it was created just for fun, now it's being used where I work. Currently, there is no "chat server" on the app. where each client registers, updates it's status, etc. (I liked the idea of symmetric design and not depending on a server running on some other machine). Instead, each host is a client/server which has a hosts.properties file with the hostname of the other hosts, and - for instance - broadcasts to each one of them when sending a massive message/image/whatever. In the beginning there were just a couple of hosts, so this hosts.properties file wasn't an issue. But as the amount of users increased, the need of updating that file was a bit daunting. So now I've decided to get rid of it, and each time the app. starts, dynammically find the other active hosts. However, I cannot find the correct way of implement this. I've tried starting different threads, each one of them searching for other hosts in a known range of IP addresses. Something like this (simplified for the sake of readability): /** HostsLocator */ public static void searchForHosts(boolean waitToEnd) { for (int i=0; i < MAX_IP; i+= MAX_IP / threads) { HostsLocator detector = new HostsLocator(i, i+(MAX_IP / threads - 1)); // range: from - to new Thread(detector).start(); } } public void run() { for (int i=from; i<=to; i++) findHosts( maskAddress + Integer.toString(i) ); } public static boolean findHosts(String IP) { InetAddress address = InetAddress.getByName(IP); if ( address.isReachable(CONNECTION_TIME_OUT) ) // host found! } However: With a single thread and a low value in CONNECTION_TIME_OUT (500ms) I get wrong Host Not Found status for for hosts actually active. With a high value in CONNECTION_TIME_OUT (5000ms) and only one single thread takes forever to end With several threads I've also found problems similar like the first one, due to collisions. So... I guess there's a better way of solving this problem but I couldn't find it. Any advice? Thanks!

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • Combining FileStream and MemoryStream to avoid disk accesses/paging while receiving gigabytes of data?

    - by w128
    I'm receiving a file as a stream of byte[] data packets (total size isn't known in advance) that I need to store somewhere before processing it immediately after it's been received (I can't do the processing on the fly). Total received file size can vary from as small as 10 KB to over 4 GB. One option for storing the received data is to use a MemoryStream, i.e. a sequence of MemoryStream.Write(bufferReceived, 0, count) calls to store the received packets. This is very simple, but obviously will result in out of memory exception for large files. An alternative option is to use a FileStream, i.e. FileStream.Write(bufferReceived, 0, count). This way, no out of memory exceptions will occur, but what I'm unsure about is bad performance due to disk writes (which I don't want to occur as long as plenty of memory is still available) - I'd like to avoid disk access as much as possible, but I don't know of a way to control this. I did some testing and most of the time, there seems to be little performance difference between say 10 000 consecutive calls of MemoryStream.Write() vs FileStream.Write(), but a lot seems to depend on buffer size and the total amount of data in question (i.e the number of writes). Obviously, MemoryStream size reallocation is also a factor. Does it make sense to use a combination of MemoryStream and FileStream, i.e. write to memory stream by default, but once the total amount of data received is over e.g. 500 MB, write it to FileStream; then, read in chunks from both streams for processing the received data (first process 500 MB from the MemoryStream, dispose it, then read from FileStream)? Another solution is to use a custom memory stream implementation that doesn't require continuous address space for internal array allocation (i.e. a linked list of memory streams); this way, at least on 64-bit environments, out of memory exceptions should no longer be an issue. Con: extra work, more room for mistakes. So how do FileStream vs MemoryStream read/writes behave in terms of disk access and memory caching, i.e. data size/performance balance. I would expect that as long as enough RAM is available, FileStream would internally read/write from memory (cache) anyway, and virtual memory would take care of the rest. But I don't know how often FileStream will explicitly access a disk when being written to. Any help would be appreciated.

    Read the article

  • Perfect Forwarding to async lambda

    - by Alexander Kondratskiy
    I have a function template, where I want to do perfect forwarding into a lambda that I run on another thread. Here is a minimal test case which you can directly compile: #include <thread> #include <future> #include <utility> #include <iostream> #include <vector> /** * Function template that does perfect forwarding to a lambda inside an * async call (or at least tries to). I want both instantiations of the * function to work (one for lvalue references T&, and rvalue reference T&&). * However, I cannot get the code to compile when calling it with an lvalue. * See main() below. */ template <typename T> std::string accessValueAsync(T&& obj) { std::future<std::string> fut = std::async(std::launch::async, [](T&& vec) mutable { return vec[0]; }, std::forward<T>(obj)); return fut.get(); } int main(int argc, char const *argv[]) { std::vector<std::string> lvalue{"Testing"}; // calling with what I assume is an lvalue reference does NOT compile std::cout << accessValueAsync(lvalue) << std::endl; // calling with rvalue reference compiles std::cout << accessValueAsync(std::move(lvalue)) << std::endl; // I want both to compile. return 0; } For the non-compiling case, here is the last line of the error message which is intelligible: main.cpp|13 col 29| note: no known conversion for argument 1 from ‘std::vector<std::basic_string<char> >’ to ‘std::vector<std::basic_string<char> >&’ I have a feeling it may have something to do with how T&& is deduced, but I can't pinpoint the exact point of failure and fix it. Any suggestions? Thank you! EDIT: I am using gcc 4.7.0 just in case this could be a compiler issue (probably not)

    Read the article

  • Code Golf: Countdown Number Game

    - by Noldorin
    Challenge Here is the task, inspired by the well-known British TV game show Countdown. The challenge should be pretty clear even without any knowledge of the game, but feel free to ask for clarifications. And if you fancy seeing a clip of this game in action, check out this YouTube clip. It features the wonderful late Richard Whitely in 1997. You are given 6 numbers, chosen at random from the set {1, 2, 3, 4, 5, 6, 8, 9, 10, 25, 50, 75, 100}, and a random target number between 100 and 999. The aim is to make use the six given numbers and the four common arithmetic operations (addition, subtraction, multiplication, division; all over the rational numbers) to generate the target - or as close as possible either side. Each number may only be used once at most, while each arithmetic operator may be used any number of times (including zero.) Note that it does not matter how many numbers are used. Write a function that takes the target number and set of 6 numbers (can be represented as list/collection/array/sequence) and returns the solution in any standard numerical notation (e.g. infix, prefix, postfix). The function must always return the closest-possible result to the target, and must run in at most 1 minute on a standard PC. Note that in the case where more than one solution exists, any single solution is sufficient. Examples: {50, 100, 4, 2, 2, 4}, target 203 e.g. 100 * 2 + 2 + (4 / 4) e.g. (100 + 50) * 4 * 2 / (4 + 2) {25, 4, 9, 2, 3, 10}, target 465 e.g. (25 + 10 - 4) * (9 * 2 - 3) {9, 8, 10, 5, 9, 7), target 241 e.g. ((10 + 9) * 9 * 7) + 8) / 5 Rules Other than mentioned in the problem statement, there are no further restrictions. You may write the function in any standard language (standard I/O is not necessary). The aim as always is to solve the task with the smallest number of characters of code. Saying that, I may not simply accept the answer with the shortest code. I'll also be looking at elegance of the code and time complexity of the algorithm! My Solution I'm attempting an F# solution when I find the free time - will post it here when I have something! Format Please post all answers in the following format for the purpose of easy comparison: Language Number of characters: ??? Fully obfuscated function: (code here) Clear (ideally commented) function: (code here) Any notes on the algorithm/clever shortcuts it takes.

    Read the article

  • How to design service that can provide interface as JAX-WS web service, or via JMS, or as local meth

    - by kevinegham
    Using a typical JEE framework, how do I develop and deploy a service that can be called as a web service (with a WSDL interface), be invoked via JMS messages, or called directly from another service in the same container? Here's some more context: Currently I am responsible for a service (let's call it Service X) with the following properties: Interface definition is a human readable document kept up-to-date manually. Accepts HTTP form-encoded requests to a single URL. Sends plain old XML responses (no schema). Uses Apache to accept requests + a proprietary application server (not servlet or EJB based) containing all logic which runs in a seperate tier. Makes heavy use of a relational database. Called both by internal applications written in a variety of languages and also by a small number of third-parties. I want to (or at least, have been told to!): Switch to a well-known (pref. open source) JEE stack such as JBoss, Glassfish, etc. Split Service X into Service A and Service B so that we can take Service B down for maintenance without affecting Service A. Note that Service B will depend on (i.e. need to make requests to) Service A. Make both services easier for third parties to integrate with by providing at least a WS-I style interface (WSDL + SOAP + XML + HTTP) and probably a JMS interface too. In future we might consider a more lightweight API too (REST + JSON? Google Protocol Buffers?) but that's a nice to have. Additional consideration are: On a smaller deployment, Service A and Service B will likely to running on the same machine and it would seem rather silly for them to use HTTP or a message bus to communicate; better if they could run in the same container and make method calls to each other. Backwards compatibility with the existing ad-hoc Service X interface is not required, and we're not planning on re-using too much of the existing code for the new services. I'm happy with either contract-first (WSDL I guess) or (annotated) code-first development. Apologies if my terminology is a bit hazy - I'm pretty experienced with Java and web programming in general, but am finding it quite hard to get up to speed with all this enterprise / SOA stuff - it seems I have a lot to learn! I'm also not very used to using a framework rather than simply writing code that calls some packages to do things. I've got as far as downloading Glassfish, knocking up a simple WSDL file and using wsimport + a little dummy code to turn that into a WAR file which I've deployed.

    Read the article

  • Dynamically loading modules in Python (+ threading question)

    - by morpheous
    I am writing a Python package which reads the list of modules (along with ancillary data) from a configuration file. I then want to iterate through each of the dynamically loaded modules and invoke a do_work() function in it which will spawn a new thread, so that the code runs in a separate thread. At the moment, I am importing the list of all known modules at the beginning of my main script - this is a nasty hack I feel, and is not very flexible, as well as being a maintenance pain. This is the function that spawns the threads. I will like to modify it to dynamically load the module when it is encountered. The key in the dictionary is the name of the module containing the code: def do_work(work_info): for (worker, dataset) in work_info.items(): #import the module defined by variable worker here... t = threading.Thread(target=worker.do_work, args=[dataset]) # I'll NOT dameonize since spawned children need to clean up on shutdown # Since the threads will be holding resources #t.daemon = True t.start() Question 1 When I call the function in my script (as written above), I get the following error: AttributeError: 'str' object has no attribute 'do_work' Which makes sense, since the dictionary key is a string (name of the module to be imported). When I add the statement: import worker before spawning the thread, I get the error: ImportError: No module named worker This is strange, since the variable name rather than the value it holds are being used - when I print the variable, I get the value (as I expect) whats going on? Question 2 As I mentioned in the comments section, I realize that the do_work() function written in the spawned children needs to cleanup after itself. My understanding is to write a clean_up function that is called when do_work() has completed successfully, or an unhandled exception is caught - is there anything more I need to do to ensure resources don't leak or leave the OS in an unstable state? Question 3 If I comment out the t.daemon flag statement, will the code stil run ASYNCHRONOUSLY?. The work carried out by the spawned children are pretty intensive, and I don't want to have to be waiting for one child to finish before spawning another child. BTW, I am aware that threading in Python is in reality, a kind of time sharing/slicing - thats ok Lastly is there a better (more Pythonic) way of doing what I'm trying to do?

    Read the article

  • Returning JSON in CFFunction and appending it to layer is causing an error

    - by Mel
    I'm using the qTip jQuery plugin to generate a dynamic tooltip. I'm getting an error in my JS, and I'm unsure if its source is the JSON or the JS. The tooltip calls the following function: (sorry about all this code, but it's necessary) <cffunction name="fGameDetails" access="remote" returnType="any" returnformat="JSON" output="false" hint="This grabs game details for the games.cfm page"> <!---Argument, which is the game ID---> <cfargument name="gameID" type="numeric" required="true" hint="CFC will look for GameID and retrieve its details"> <!---Local var---> <cfset var qGameDetails = ""> <!---Database query---> <cfquery name="qGameDetails" datasource="#REQUEST.datasource#"> SELECT titles.titleName AS tName, titles.titleBrief AS tBrief, games.gameID, games.titleID, games.releaseDate AS rDate, genres.genreName AS gName, platforms.platformAbbr AS pAbbr, platforms.platformName AS pName, creviews.cReviewScore AS rScore, ratings.ratingName AS rName FROM games Inner Join platforms ON platforms.platformID = games.platformID Inner Join titles ON titles.titleID = games.titleID Inner Join genres ON genres.genreID = games.genreID Inner Join creviews ON games.gameID = creviews.gameID Inner Join ratings ON ratings.ratingID = games.ratingID WHERE (games.gameID = #ARGUMENTS.gameID#); </cfquery> <cfreturn qGameDetails> </cffunction> This function returns the following JSON: { "COLUMNS": [ "TNAME", "TBRIEF", "GAMEID", "TITLEID", "RDATE", "GNAME", "PABBR", "PNAME", "RSCORE", "RNAME" ], "DATA": [ [ "Dark Void", "Ancient gods known as 'The Watchers,' once banished from our world by superhuman Adepts, have returned with a vengeance.", 154, 54, "January, 19 2010 00:00:00", "Action & Adventure", "PS3", "Playstation 3", 3.3, "14 Anos" ] ] } The problem I'm having is every time I try to append the JSON to the layer #catalog, I get a syntax error that says "missing parenthetical." This is the JavaScript I'm using: $(document).ready(function() { $('#catalog a[href]').each(function() { $(this).qtip( { content: { url: '/gamezilla/resources/components/viewgames.cfc?method=fGameDetails', data: { gameID: $(this).attr('href').match(/gameID=([0-9]+)$/)[1] }, method: 'get' }, api: { beforeContentUpdate: function(content) { var json = eval('(' + content + ')'); content = $('<div />').append( $('<h1 />', { html: json.TNAME })); return content; } }, style: { width: 300, height: 300, padding: 0, name: 'light', tip: { corner: 'leftMiddle', size: { x: 40, y : 40 } } }, position: { corner: { target: 'rightMiddle', tooltip: 'leftMiddle' } } }); }); }); Any ideas where I'm going wrong? I tried many things for several days and I can't find the issue. Many thanks!

    Read the article

  • Can I have a workspace that is both a git workspace and a svn workspace?

    - by Troy
    I have checked out now a local working copy of a codebase that lives in an svn repo. It's a big Java project that I use Eclipse to develop in. Eclipse of course builds everything on the fly, in it's own way with all the binaries ending up in [project root]/bin. That's perfectly fine with me, for development, but when the build runs on the build server, it looks quite a lot different (maven build, binaries end up in a different directory structure, etc). Sometimes I need to recreate the build server environment on my local development system to debug the build or what have you, so I usually end up downloading an entirely new working copy into a new workspace and running the build from there (prevents cluttering my development workspace with all the build artifacts and dirtying up the working copy). Of course sometimes I'm interested in running the full build on code that I don't want to check in yet, so I will manually copy over the "development" workspace onto the "build" workspace. Besides taking a lot of extra time copying a lot of files that I don't actually need (just overlaying the new over the old), this also screws up my svn metadata, meaning that I can't check in changes from that "build workspace" working copy, and I often end up having to re-download the code to get it back into a known state. So I'm thinking I make my svn working copy a local git repo, then "check out" the in-development code from the svn working copy/git master, into the local build workspace. Then I can build, revert my changes, have all the advantages of a version controlled working copy in the build workspace. Then if I need to make changes to the build, push those back into the git master (which is also a svn working copy), then check them into the main svn repo. |-------------| |main svn repo| <------- |---------------------| |-------------| |svn working copy | <------- |--------------------| | (svn dev workspace/ | | non-svn-versioned | | git master) | | build workspace | |---------------------| | (git working copy) | |--------------------| Just switching everything to git would obviously be better, but, big company, too many people using svn, too costly to change everything, etc. We're stuck with svn as the main repo for now. BTW, I know there is a maven plugin for Eclipse and everything, I'm mainly interested to know if there is a way to maintain a workspace that is both a git working copy and an svn working copy. Actually any distributed version control system would probably work (hg possibly?). Advice? How does everybody else handle this situation of having a to manage both a "development" build process and a "production" build process?

    Read the article

  • Techniques for querying a set of object in-memory in a Java application

    - by Edd Grant
    Hi All, We have a system which performs a 'coarse search' by invoking an interface on another system which returns a set of Java objects. Once we have received the search results I need to be able to further filter the resulting Java objects based on certain criteria describing the state of the attributes (e.g. from the initial objects return all objects where x.y z && a.b == c). The criteria used to filter the set of objects each time is partially user configurable, by this I mean that users will be able to select the values and ranges to match on but the attributes they can pick from will be a fixed set. The data sets are likely to contain <= 10,000 objects for each search. The search will be executed manually by the application user base probably no more than 2000 times a day (approx). It's probably worth mentioning that all the objects in the result set are known domain object classes which have Hibernate and JPA annotations describing their structure and relationship. Off the top of my head I can think of 3 ways of doing this: For each search persist the initial result set objects in our database, then use Hibernate to re-query them using the finer grained criteria. Use an in-memory Database (such as hsqldb?) to query and refine the initial result set. Write some custom code which iterates the initial result set and pulls out the desired records. Option 1 seems to involve a lot of toing and froing across a network to a physical Database (Oracle 10g) which might result in a lot of network and disk activity. It would also require the results from each search to be isolated from other result sets to ensure that different searches don't interfere with each other. Option 2 seems like a good idea in principle as it would allow me to do the finer query in memory and would not require the persistence of result data which would only be discarded after the search was complete. Gut feeling is that this could be pretty performant too but might result in larger memory overheads (which is fine as we can be pretty flexible on the amount of memory our JVM gets). Option 3 could be very performant but is something I would like to avoid as any code we write would require such careful testing that the time taken to acheive something flexible and robust enough would probably be prohibitive. I don't have time to prototype all 3 ideas so I am looking for comments people may have on the 3 options above, plus any further ideas I have not considered, to help me decide which idea might be most suitable. I'm currently leaning toward option 2 (in memory database) so would be keen to hear from people with experience of querying POJOs in memory too. Hopefully I have described the situation in enough detail but don't hesitate to ask if any further information is required to better understand the scenario. Cheers, Edd

    Read the article

  • Where are the function literals c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Building a DataTable in C# with one column at a time

    - by Awaken
    I am trying to build a Retirement Calculator as a chance to make something useful and learn C# better. Currently, I am trying to build a DataTable with a dynamic amount of rows/columns. For context, I ask the user for some inputs regarding salary, % of salary being invested, and expected ROI. I have some other stuff too, but it isn't really part of the issue I am having. Because the number of columns I need for the DataTable is unknown until the formula is run (while+for loop completes), I am having trouble doing things as DataColumns. Hopefully the code below will help. I am really trying to build the table one column at a time. I realize I could reverse it to build it one row at a time because the Years before retirement (yearsRetire) is known, but I would prefer not to and I want to learn more. Sorry for the indentation and commenting. I tried to leave some of my commented coding attempts in there. Thanks for any help. public double calcROI() { double testROI = 0.00; double tempRetireAmount = 0; double adjustRetire = goalAmount * (1 + (Math.Pow(inflation,yearsRetire))); // Loop through ROI values until the calculated retire amount with the test ROI // is greater than the target amount adjusted for inflation while (tempRetireAmount < adjustRetire) { //Increment ROI by 1% per while iteration testROI += .01; //Make a new Column to hold the values for ROI for this while iteration //dtMain.Columns.Add(Convert.ToString(testROI)); //DataColumn tempdc = new DataColumn(Convert.ToString(testROI)); //Loop through the number of years entered by user and see the amount //at Retirement with current ROI for (int i = 0; i < yearsRetire; i++) { //Main formula to calculate amount after i years tempRetireAmount = (tempRetireAmount + salary*savingsPct) * (1 + testROI); // Add value for this year/ROI to table/column //DataRow dr = .NewRow(); //dr tempRetireAmount; //tempdc[i] = tempRetireAmount; } //Need to add column of data to my Main DataTable //dtMain.Rows.Add(dr); //dtMain.Columns.Add(tempdc); } return testROI; }

    Read the article

  • What is the most idiomatic way to emulating Perl's Test::More::done_testing?

    - by DVK
    I have to build unit tests for in environment with a very old version of Test::More (perl5.8 with $Test::More::VERSION being '0.80') which predates the addition of done_testing(). Upgrading to newer Test::More is out of the question for practical reasons. And I am trying to avoid using no_tests - it's generally a bad idea not catching when your unit test exits prematurely - say due to some logic not executing when you expected it to. What is the most idiomatic way of running a configurable amount of tests, assuming no no_tests or done_testing() is used? Details: My unit tests usually take the form of: use Test::More; my @test_set = ( [ "Test #1", $param1, $param2, ... ] ,[ "Test #1", $param1, $param2, ... ] # ,... ); foreach my $test (@test_set) { run_test($test); } sub run_test { # $expected_tests += count_tests($test); ok(test1($test)) || diag("Test1 failed"); # ... } The standard approach of use Test::More tests => 23; or BEGIN {plan tests => 23} does not work since both are obviously executed before @tests is known. My current approach involves making @tests global and defining it in the BEGIN {} block as follows: use Test::More; BEGIN { our @test_set = (); # Same set of tests as above my $expected_tests = 0; foreach my $test (@tests) { my $expected_tests += count_tests($test); } plan tests = $expected_tests; } our @test_set; # Must do!!! Since first "our" was in BEGIN's scope :( foreach my $test (@test_set) { run_test($test); } # Same sub run_test {} # Same I feel this can be done more idiomatically but not certain how to improve. Chief among the smells is the duplicate our @test_test declarations - in BEGIN{} and after it. Another approach is to emulate done_testing() by calling Test::More->builder->plan(tests=>$total_tests_calculated). I'm not sure if it's any better idiomatically-wise.

    Read the article

< Previous Page | 220 221 222 223 224 225 226 227 228 229 230 231  | Next Page >