Search Results

Search found 6805 results on 273 pages for 'fast formula'.

Page 225/273 | < Previous Page | 221 222 223 224 225 226 227 228 229 230 231 232  | Next Page >

• PHP Frameworks: Codeigniter vs. Yii vs. Custom?

  - by Industrial

  Hi everybody, I have used codeigniter for a some years now. Why I chosed to work with codeigniter back then? Pretty much for the extensive documentation that were available and the big user community. It made me as a totally newbie to the MVC pattern able to get a site up and running really fast. I think what is priorited from my side is that the framework doesn't affect performance too much, which Codeigniter seems to be pretty good at (when compared to other frameworks out there) and Yii, an even better option. Since the time has gone from when I started out with codeigniter, the project sizes have also increased and thereby the demand of the framework and it's footprint on the code. I have thought a few times about writing a whole new MVC framework to do only the thing's I want it to do, but it feels like reinventing the wheel and I cannot yet justify it. I am not sure whether or not it's a good solution to build a site that have the potential to become really big on either Yii or Codeigniter. I have tried to find as much as possible documentation about this comparision/issue online before posting here, but have found very few real-life arguments and stories from people that have shifted between the two PHP frameworks or have been in the same situation as me. So - what's your thoughts about Codeigniter vs. Yii vs. going custom? References: http://daniel.carrera.bz/2009/01/comparison-of-php-frameworks-part-i/ http://www.beyondcoding.com/2009/03/02/choosing-a-php-framework-round-2-yii-vs-kohana-vs-codeigniter/

  Read the article

• Read large file into sqlite table in objective-C on iPhone

  - by James Testa

  I have a 2 MB file, not too large, that I'd like to put into an sqlite database so that I can search it. There are about 30K entries that are in CSV format, with six fields per line. My understanding is that sqlite on the iPhone can handle a database of this size. I have taken a few approaches but they have all been slow 30 s. I've tried: 1) Using C code to read the file and parse the fields into arrays. 2) Using the following Objective-C code to parse the file and put it into directly into the sqlite database: NSString *file_text = [NSString stringWithContentsOfFile: filePath usedEncoding: NULL error: NULL]; NSArray *lineArray = [file_text componentsSeparatedByString:@"\n"]; for(int k = 0; k < [lineArray count]; k++){ NSArray *parts = [[lineArray objectAtIndex:k] componentsSeparatedByString: @","]; NSString *field0 = [parts objectAtIndex:0]; NSString *field2 = [parts objectAtIndex:2]; NSString *field3 = [parts objectAtIndex:3]; NSString *loadSQLi = [[NSString alloc] initWithFormat: @"INSERT INTO TABLE (TABLE, FIELD0, FIELD2, FIELD3) VALUES ('%@', '%@', '%@');",field0, field2, field3]; if (sqlite3_exec (db_table, [loadSQLi UTF8String], NULL, NULL, &errorMsg) != SQLITE_OK) { sqlite3_close(db_table); NSAssert1(0, @"Error loading table: %s", errorMsg); } Am I missing something? Does anyone know of a fast way to get the file into a database? Or is it possible to translate the file into a sqlite format that can be read directly into sqlite? Or should I turn the file into a plist and load it into a Dictionary? Unfortunately I need to search on two of the fields, and I think a Dictionary can only have one key? Jim

  Read the article

• Perform case-insensitive lookup on an Array in MongoDB?

  - by Hal

  So, I've decided to get my feet wet with MongoDB and love it so far. It seems very fast and flexible which is great. But, I'm still going through the initial learning curve and as such, I'm spending hours digging for info on the most basic things. I've search throughout the MongoDB online documentation and have spent hours Googling through pages without any mention of this. I know Mongo is still quite new (v1.x) so it explains why there isn't much information yet. I've even trying looking for books on Mongo without much luck. So yes, I've tried to RTFM with no luck, so, now I turn to you. I have an Array of various Hashtags nested in each document (ie: #apples, #oranges, #Apples, #APPLES) and I would like to perform a case-insensitive find() to access all the documents containing apples in any case. It seems that find does support some regex with /i, but I can't seem to get this working either. Anyway, I hope this is a quick answer for someone. Here's my existing call in PHP which is case sensitive: $cursor = $collection->find(array( "hashtags" => array("#".$keyword)))->sort(array('$natural' => -1))->limit(10); Help?

  Read the article

• Is SQLDataReader slower than using the command line utility sqlcmd?

  - by Andrew

  I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

  Read the article

• Read line and change the line that not consist of certain words and not end with dot

  - by igo

  I wanna read some text files in a folder line by line. for example of 1 txt : Fast and Effective Text Mining Using Linear-time Document Clustering Bjornar Larsen WORD2 Chinatsu Aone SRA International AK, Inc. 4300 Fair Lakes Cow-l Fairfax, VA 22033 {bjornar-larsen, WORD1 I wanna remove line that does not contain of words = word, word2, word3, and does not end with dot . so. from the example, the result will be : Bjornar Larsen WORD2 Chinatsu Aone SRA International, Inc. {bjornar-larsen, WORD1 I am confused, hw to remove the line? it that possible? or can we replace them with a space? here's the code : $url = glob($savePath.'*.txt'); foreach ($url as $file => $files) { $handle = fopen($files, "r") or die ('can not open file'); $ori_content= file_get_contents($files); foreach(preg_split("/((\r?\n)|(\r\n?))/", $ori_content) as $buffer){ $pos1 = stripos($buffer, $word1); $pos2 = stripos($buffer, $word2); $pos3 = stripos($buffer, $word3); $last = $str[strlen($buffer)-1];//read the las character if (true !== $pos1 OR true !== $pos2 OR true !==$pos3 && $last != '.'){ //how to remove } } } please help me, thank you so much :)

  Read the article

• glitchy stuttery iphone game loop

  - by Adam

  This is a problem I've been trying to solve for a few days now, and I've looked at the various solutions on stackoverflow and nothing has really seemed to work for me. I'm making an iPhone game with OpenGLES graphics and accelerometer input, at this point it's very simple, but the rendering is already pretty bad... it stutters and seems to jump back or forward in time. It doesn't happen a lot, but it happens enough to be a problem. I mean, who wants to play a game where a bullet gets magically transported into the player, and then it's game over? No one. I've tried using NSTimer for the game loop, I've tried using a separate thread (with a frame rate and continuously) I've tried using different frame rates, from 30FPS to 60FPS (It seems to have a max frame rate around 45FPS, but no problems at 30FPS) I've tried using timeIntervalSince1970 and CFGetAbsoluteTime to measure loop time, with no noticeable diffence Anyone have any ideas on what is the best way to get this looking better? One of the posts I've read suggested running the simulation at a fixed frame rate and then just render as fast as possible, does that seem like a good idea?

  Read the article

• Can anyone tell me about a jQuery modal dialog box library that doesn't suck

  - by Ritesh M Nayak

  jQuery based modal dialog boxes are great as long as you do as much as the example tells you to. I need a jQuery based modal dialog box library that has to have the following characteristics: It should be fast, something like the add and link dialog on StackOverflow. Most libraries take an eternity to load the dialog with its fancy effects and stuff. I want to call it using a script. Show a hidden div or a span element inline. MOst of the libraries talk filling an anchor with rel, class and href=#hiddenDiv sort of things. I need to be able to what I want without adding unnecessary attributes to my anchor. Something like this function showDialog(values) { processToChangeDom(values); changeDivTobeDisplayed(); modalDialog.show(); } It should reflect changes I make to the DOM in the hidden Div. I used facebox and found out that it makes a copy of the hidden div and changes to the DOM doesn't reflect on the modal window. I need to be able call the close modal div using javascript and also attach beforeOpen and afterClose handlers to the action. Does anyone have any suggestions? I have already tried facebox, simplemodal and a whole range of libraries, most of them don't support one or the other of these functions I described above.

  Read the article

• Big-O of PHP functions?

  - by Kendall Hopkins

  After using PHP for a while now, I've noticed that not all PHP built in functions as fast as expected. Consider the below two possible implementations of a function that finds if a number is prime using a cached array of primes. //very slow for large $prime_array $prime_array = array( 2, 3, 5, 7, 11, 13, .... 104729, ... ); $result_array = array(); foreach( $array_of_number => $number ) { $result_array[$number] = in_array( $number, $large_prime_array ); } //still decent performance for large $prime_array $prime_array => array( 2 => NULL, 3 => NULL, 5 => NULL, 7 => NULL, 11 => NULL, 13 => NULL, .... 104729 => NULL, ... ); foreach( $array_of_number => $number ) { $result_array[$number] = array_key_exists( $number, $large_prime_array ); } This is because in_array is implemented with a linear search O(n) which will linearly slow down as $prime_array grows. Where the array_key_exists function is implemented with a hash lookup O(1) which will not slow down unless the hash table gets extremely populated (in which case it's only O(logn)). So far I've had to discover the big-O's via trial and error, and occasionally looking at the source code. Now for the question... I was wondering if there was a list of the theoretical (or practical) big O times for all* the PHP built in functions. *or at least the interesting ones For example find it very hard to predict what the big O of functions listed because the possible implementation depends on unknown core data structures of PHP: array_merge, array_merge_recursive, array_reverse, array_intersect, array_combine, str_replace (with array inputs), etc.

  Read the article

• An implementation of Sharir's or Aurenhammer's deterministic algorithm for calculating the intersect

  - by RGrey

  The problem of finding the intersection/union of 'N' discs/circles on a flat plane was first proposed by M. I. Shamos in his 1978 thesis: Shamos, M. I. “Computational Geometry” Ph.D. thesis, Yale Univ., New Haven, CT 1978. Since then, in 1985, Micha Sharir presented an O(n log2n) time and O(n) space deterministic algorithm for the disc intersection/union problem (based on modified Voronoi diagrams): Sharir, M. Intersection and closest-pair problems for a set of planar discs. SIAM .J Comput. 14 (1985), pp. 448-468. In 1988, Franz Aurenhammer presented a more efficient O(n log n) time and O(n) space algorithm for circle intersection/union using power diagrams (generalizations of Voronoi diagrams): Aurenhammer, F. Improved algorithms for discs and balls using power diagrams. Journal of Algorithms 9 (1985), pp. 151-161. Earlier in 1983, Paul G. Spirakis also presented an O(n^2) time deterministic algorithm, and an O(n) probabilistic algorithm: Spirakis, P.G. Very Fast Algorithms for the Area of the Union of Many Circles. Rep. 98, Dept. Comput. Sci., Courant Institute, New York University, 1983. I've been searching for any implementations of the algorithms above, focusing on computational geometry packages, and I haven't found anything yet. As neither appear trivial to put into practice, it would be really neat if someone could point me in the right direction!

  Read the article

• Optimal Serialization of Primitive Types

  - by Greg Dean

  We are beginning to roll out more and more WAN deployments of our product (.Net fat client w/ IIS hosted Remoting backend). Because of this we are trying to reduce the size of the data on the wire. We have overridden the default serialization by implementing ISerializable (similar to this), we are seeing anywhere from 12% to 50% gains. Most of our efforts focus on optimizing arrays of primitive types. I would like to know if anyone knows of any fancy way of serializing primitive types, beyond the obvious? For example today we serialize an array of ints as follows: [4-bytes (array length)][4-bytes][4-bytes] Can anyone do significantly better? The most obvious example of a significant improvement, for boolean arrays, is putting 8 bools in each byte, which we already do. Note: Saving 7 bits per bool may seem like a waste of time, but when you are dealing with large magnitudes of data (which we are), it adds up very fast. Note: We want to avoid general compression algorithms because of the latency associated with it. Remoting only supports buffered requests/responses(no chunked encoding). I realize there is a fine line between compression and optimal serialization, but our tests indicate we can afford very specific serialization optimizations at very little cost in latency. Whereas reprocessing the entire buffered response into new compressed buffer is too expensive.

  Read the article

• Rails: Ajax: Changes Onload

  - by Jay Godse

  Hi. I have a web layout of a for that looks something like this <html> <head> </head> <body> <div id="posts"> <div id="post1" class="post" > <!--stuff 1--> </div> <div id="post2" class="post" > <!--stuff 1--> </div> <!-- 96 more posts --> <div id="post99" class="post" > <!--stuff 1--> </div> </div> </body> </html> I would like to be able to load and render the page with a blank , and then have a function called when the page is loaded which goes in and load up the posts and updates the page dynamically. In Rails, I tried using "link_to_remote" to update with all of the elements. I also tweaked the posts controller to render the collection of posts if it was an ajax request (request.xhr?). It worked fine and very fast. However the update of the blank div is triggered by clicking the link. I would like the same action to happen when the page is loaded so that I don't have to put in a link. Is there a Rails Ajax helper or RJS function or something in Rails that I could use to trigger the loading of the "posts" after the page has loaded and rendered (without the posts)? (If putsch comes to shove, I will just copy the generated JS code from the link_to_remote call and have it called from the onload handler on the body).

  Read the article

• Linq to SQL with INSTEAD OF Trigger and an Identity Column

  - by Bob Horn

  I need to use the clock on my SQL Server to write a time to one of my tables, so I thought I'd just use GETDATE(). The problem is that I'm getting an error because of my INSTEAD OF trigger. Is there a way to set one column to GETDATE() when another column is an identity column? This is the Linq-to-SQL: internal void LogProcessPoint(WorkflowCreated workflowCreated, int processCode) { ProcessLoggingRecord processLoggingRecord = new ProcessLoggingRecord() { ProcessCode = processCode, SubId = workflowCreated.SubId, EventTime = DateTime.Now // I don't care what this is. SQL Server will use GETDATE() instead. }; this.Database.Add<ProcessLoggingRecord>(processLoggingRecord); } This is the table. EventTime is what I want to have as GETDATE(). I don't want the column to be null. And here is the trigger: ALTER TRIGGER [Master].[ProcessLoggingEventTimeTrigger] ON [Master].[ProcessLogging] INSTEAD OF INSERT AS BEGIN SET NOCOUNT ON; SET IDENTITY_INSERT [Master].[ProcessLogging] ON; INSERT INTO ProcessLogging (ProcessLoggingId, ProcessCode, SubId, EventTime, LastModifiedUser) SELECT ProcessLoggingId, ProcessCode, SubId, GETDATE(), LastModifiedUser FROM inserted SET IDENTITY_INSERT [Master].[ProcessLogging] OFF; END Without getting into all of the variations I've tried, this last attempt produces this error: InvalidOperationException Member AutoSync failure. For members to be AutoSynced after insert, the type must either have an auto-generated identity, or a key that is not modified by the database after insert. I could remove EventTime from my entity, but I don't want to do that. If it was gone though, then it would be NULL during the INSERT and GETDATE() would be used. Is there a way that I can simply use GETDATE() on the EventTime column for INSERTs? Note: I do not want to use C#'s DateTime.Now for two reasons: 1. One of these inserts is generated by SQL Server itself (from another stored procedure) 2. Times can be different on different machines, and I'd like to know exactly how fast my processes are happening.

  Read the article

• Why do people hate SQL cursors so much?

  - by Steven A. Lowe

  I can understand wanting to avoid having to use a cursor due to the overhead and inconvenience, but it looks like there's some serious cursor-phobia-mania going on where people are going to great lengths to avoid having to use one for example, one question asked how to do something obviously trivial with a cursor and the accepted answer proposed using a common table expression (CTE) recursive query with a recursive custom function, even though this limits the number of rows that could be processed to 32 (due to recursive call limit in sql server). This strikes me as a terrible solution for system longevity, not to mention a tremendous effort just to avoid using a simple cursor. what is the reason for this level of insane hatred? has some 'noted authority' issued a fatwa against cursors? does some unspeakable evil lurk in the heart of cursors that corrupts the morals of the children or something? wiki question, more interested in the answer than the rep thanks in advance! Related Info: http://stackoverflow.com/questions/37029/sql-server-fast-forward-cursors EDIT: let me be more precise: I understand that cursors should not be used instead of normal relational operations, that is a no-brainer. What I don't understand is people going waaaaay out of their way to avoid cursors like they have cooties or something, even when a cursor is a simpler and/or more efficient solution. It's the irrational hatred that baffles me, not the obvious technical efficiencies.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• jquery image hover popup cant detect browser edge and change its direction

  - by Salman

  hi guys i am trying to implement jquery image hover popup but facing a problem when the popup is closer to browser edge it goes beyond its edge i want it to change its direction when it finds that space is not enough to show that popup, i have see this effect in many plugins where popups, tooltips and drop down menus change their direction if they are close to browser window edge can any one guide me in right direction here is the screen shot for reference http://img512.imageshack.us/img512/4990/browseredge.png here is the jquery hover code function imagePreview(){ /* CONFIG */ xOffset = 10; yOffset = 30; // these 2 variable determine popup's distance from the cursor // you might want to adjust to get the right result /* END CONFIG */ $("a.preview").hover(function(e){ this.t = this.title; this.title = ""; var c = (this.t != "") ? "<br>" + this.t : ""; var newName = this.name; //console.log(this.name); newName=newName.replace("/l/","/o/"); //console.log(newName); $("body").append("<p id='preview'><img src='"+ this.name +"' alt='Image preview' style='margin-bottom:5px;'>"+ c +"</p>"); $("#preview img").error(function () { $("#preview img").attr("src" ,newName).css({'width': '400px', 'height': 'auto'}); }); $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px") .fadeIn("fast"); }, function(){ this.title = this.t; $("#preview").remove(); }); $("a.preview").mousemove(function(e){ $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px"); }); }; any help will be appriciated Thanks Salman

  Read the article

• Cross-platform game development: ease of development vs security

  - by alcuadrado

  Hi, I'm a member and contributor of the Argentum Online (AO) community, the first MMORPG from Argentina, which is Free Software; which, although it's not 3D, it's really addictive and has some dozens of thousands of users. Really unluckily AO was developed in Visual Basic (yes, you can laugh) but the former community, so imagine, the code not only sucks, it has zero portability. I'm planning, with some friends to rewrite the client, and as a GNU/Linux frantic, want to do it cross-platform. Some other people is doing the same with the server in Java. So my biggest problem is that we would like to use a rapid development language (like Java, Ruby or Python) but the client would be pretty insecure. Ruby/Python version would have all it's code available, and the Java one would be easily decompilable (yes, we have some crackers in the community) We have consider the option to implement the security module in C/C++ as a dynamic library, but it can be replaced with a custom one, so it's not really secure. We are also considering the option of doing the core application in C++ and the GUI in Ruby/Python. But haven't analysed all it's implications yet. But we really don't want to code the entire game in C/C++ as it doesn't need that much performance (the game is played at 18fps on average) and we want to develop it as fast as possible. So what would you choose in my case? Thank you!

  Read the article

• Looking for a .Net ORM

  - by SLaks

  I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

  Read the article

• Getting Google results in Java? Need help!

  - by Cris Carter

  Hello. Right now, I'm trying to get the results from Google in Java, by searching for a term. I'm using a desktop program, not an applet. That in itself isn't complicated. but then Google gave me a 403 error. Anyways, I added referrer and User Agent and then it worked. Now, my problem is that I don't get the results page from Google. Instead, I get their script which gets the results page. My code right now simply uses a GET request on "http://www.google.com/search?q=" + Dork; Then it outputs each line. Here is what I get when I run my program: <.!doctype html<.head<.titledork - Google Search<./title<.scriptwindow.google={kEI:"9myaS-Date).getTime()}}};try{}catch(u){}window.google.jsrt_kill=1; align:center}#logo{display:block;overflow:hidden;position:relative;width:103px;height:37px; <./ script<./div Lots of stuff like that. I shortened it (A LOT) and put in dots to fit it here. So my big question is: How do I turn this whole mess into the nice results page I get when searching Google with a browser? Any help would be seriously appreciated, and I really need the answer fast. Also, please keep in mind that I do NOT want to use Google's API for this. Thanks in advance!

  Read the article

• How can I build something like Amazon S3 in Perl?

  - by Joel G

  I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

  Read the article

• CSS Menu disappear

  - by WtFudgE

  Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

  Read the article

• Change NSTimer interval for repeating timer.

  - by user300713

  Hi, I am running a mainLoop in Cocoa using an NSTimer set up like this: mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/fps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; At Program startup I set the timeInterval to 0.0 so that the mainloop runs as fast as possible. Anyways, I would like to provide a function to set the framerate(and thus the time interval of the timer) to a specific value at runtime. Unfortunately as far as I know that means that I have to reinitialize the timer since Cocoa does not provide a function like "setTimerInterval" This is what I tried: - (void)setFrameRate:(float)aFps { NSLog(@"setFrameRate"); [mainLoopTimer invalidate]; mainLoopTimer = nil; mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/aFps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; } but this throws the following error and stops the mainloop: 2010-06-09 11:14:15.868 myTarget[7313:a0f] setFrameRate 2010-06-09 11:14:15.868 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40cd80 of class __NSCFDate autoreleased with no pool in place - just leaking 2010-06-09 11:14:15.869 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40e700 of class NSCFTimer autoreleased with no pool in place - just leaking 0.614628 I also tried to recreate the timer using the "retain" keyword, but that didn't change anything. Any ideas about how to dynamically change the interval of an NSTimer at runtime? Thanks!

  Read the article

• Cooperative/Non-preemptive threading avoiding threadlooks?

  - by Wayne

  Any creative ideas to avoid deadlocks on a yield or sleep with cooperative/non-preemptive multitasking without doing an O/S Thread.Sleep(10)? Typically the yield or sleep call will call back into the scheduler to run other tasks. But this can sometime produce deadlocks. Some background: This application has enormous need for speed and, so far, it's extremely fast as compared to other systems in the same industry. One of the speed techniques is cooperative/non-preemptive threading rather then the cost of a context switch from O/S threads. The high level design a priority manager which calls out to tasks depending on priority and processing time. Each task does one "iteration" of work and returns to wait its turn again in the priority queue. The tricky thing with non-preemptive threading is what to do when you want to a particular task to stop in the middle of work and wait for some other event from a different task before continuing. In this case, we have 3 tasks, A B and C where A is a controller that must synchronize the activity of B and C. First, A starts both B and C. Then B yields so C gets invoked. When C yields, A sees they are both inactive, decides it's time for B to run but not time for C yet. Well B is now stuck in a yield that has called C, so it can never run. Sincerely, Wayne

  Read the article

• Does Firefox on OS X Lion make use of Full Page Zoom for the touchpad? How to customize behavior?

  - by Steven Lu

  I really like the smooth pinch-zoom of Safari using the touchpad, but the two-finger scroll on Firefox is so much better than the scrolling performance in Safari. So I really like to use Firefox, but then I miss out on two-finger-double-tap to zoom to paragraph width, and the smooth pinch gesture zoom. What I'm wondering is if it is possible to write a Firefox Extension to improve the update rate of the full-page zoom in Firefox that is already functioning via the touchpad pinch gesture. I feel like it is specifically programmed to zoom at certain zoom levels: 100%, 120%, 150% (these are guesses of mine) but I think it would be great if I can get some more control there to make it work more like the zoom functionality in Safari. Also the two-finger-double-tap on a paragraph or element to zoom to it would be really awesome as well. https://developer.mozilla.org/en/Full_page_zoom This seems to indicate (if "full page zoom" is what I think it is) that an extension has the ability to zoom to an arbitrary scale factor, but what remains is to find out if it is possible to obtain or hook the touchpad pinch gesture. Update: I have updated the toolkit.zoomManager.zoomValues option in about:config to include more zoom levels: .3,.5,.67,.8,.9,1,1.01,1.02,1.03,1.04,1.05,1.06,1.07,1.08,1.09,1.1,1.2,1.33,1.5,1.7,2,2.4,3 Notice how I inserted a bunch of entries between 1 and 1.1. But it isn't switching between them any faster (why would it?) so it's less usable than before because of waiting for it to respond fast enough. It's clear that re-rendering the page at a different zoom level requires time and in order for the zoom to be dynamic, some kind of screen capture and scale effect must be performed (which is what Safari does). I guess such a thing is probably doable but I don't think I could pull it off. :-/

  Read the article

• Hidden controls, iframes or divs

  - by user287745

  What happens to the controls or the iframe or the div, which are hidden? Do they get transferred to the user side? Disabled: does it get transferred to the user side? What I want is, an aspx page will be having many iframes to display different pages. There will be many div tags to display CSS formatted information. To understand what I mean by many:- I have to transfer a complete website with 30 aspx pages into one single page! I have simply combined everything resulting in one extremely huge page. My concern is that on local host it loads fast, but when on online server accessed by numerous people for education purposes, the site (ONE PAGE) WILL SLOW DOWN terribly. To overcome this I thought of using hidden and disable options. What is an improved way of achieving the above? Yes, it sounds silly but this is the requirement. Edit: Yes, I know id and server tag must be set, but what I am asking will the div tag be sent to the user's browser? One answer is no. So can I enable them using JavaScript? Like document.getElementById(id).style.visibility="visible" What if I disable them, and from coding of JavaScript enable them? Will they be loaded at the time of enabling?

  Read the article

• What is the fastest, most efficient way to get up to speed on a new technology?

  - by SLC

  My current job involves working with a huge number of technologies, most of which are very niche and unheard of. In some cases I have to write something about the technology, or with the technology, such as some lessons, examples, or tutorials, on behalf of the developer of that technology or someone that is backing it. When I get told to learn about a new technology, my first port of call is to check our internal library, and then look on amazon for a book on the subject. Failing that, or if the project is too small to warrant a purchase, I hit up google and youtube. However the results of randomly googling what I want to learn are hit and miss. Some days, I can find everything I want to know in a series of lessons or videos, and it's no problem. Other times, I can find almost nothing, and I really have to piece together things from sites. The result is that there are various resources out there, videos, interactive lessons, tutorials, books etc. but when I need to learn something fast, I often don't know the best way to go about it. It's not about fun, because I don't always have the luxury of working my way through a 600 page textbook named "A Complete Guide To Technology X", I have to deliver results quickly. One of the examples I'd like to use is ASP.NET MVC 2 which is something I have been told to learn. I grabbed a book on MVC 1 to refresh my knowledge, but googling it does't produce much useful information. I've seen a ton of ScottGu's tutorials on it, but they are mostly feature presentations, and some date back almost a year. The same applies to channel 9 and there are no books out yet on amazon. My question therefore has two parts, the first asks, "Where are the best places to look to get the information needed to learn a new technology?" and the second asks "What is the most efficient way to use such resources to learn a new technology?"

  Read the article

< Previous Page | 221 222 223 224 225 226 227 228 229 230 231 232  | Next Page >