Search Results

Search found 81493 results on 3260 pages for 'file size'.

Page 244/3260 | < Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >

  • Unable to delete a file or take ownership on Win7x64

    - by Basic
    I'm a developer and as part of the build process, a Microsoft dll is copied to a certain folder. That file copy is now failing as the target can't be overwritten. I decided to delete it by hand (using an admin account but a non-elevated explorer) so browsed to the folder and attempted a delete. This failed (Require permission from the Administrator). The same applies when using an elevated explorer. So I tried Properties-Security-Advanced-Ownership The current owner is showing as Unable to display current owner. I can't take ownership (a simple Access Denied message with no elaboration). Elevated Command Prompt/PowerShell don't help either (both give an Access Denied in their own way). Process explorer shows no open handles on the file. Eventually, I booted to linux and deleted the file but what I'd like to know is what caused it? Security Essentials had no issues with the file. It's digitally signed by MS and the signatures match.

    Read the article

  • adjust selected File to FileFilter in a JFileChooser

    - by amarillion
    I'm writing a diagram editor in java. This app has the option to export to various standard image formats such as .jpg, .png etc. When the user clicks File-Export, you get a JFileChooser which has a number of FileFilters in it, for .jpg, .png etc. Now here is my question: Is there a way to have the extension of the default adjust to the selected file filter? E.g. if the document is named "lolcat" then the default option should be "lolcat.png" when the png filter is selected, and when the user selects the jpg file filter, the default should change to "lolcat.jpg" automatically. Is this possible? How can I do it? edit: Based on the answer below, I wrote some code. But it doesn't quite work yet. I've added a propertyChangeListener to the FILE_FILTER_CHANGED_PROPERTY, but it seems that within this method getSelectedFile() returns null. Here is the code. package nl.helixsoft; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.beans.PropertyChangeEvent; import java.beans.PropertyChangeListener; import java.io.File; import java.util.ArrayList; import java.util.List; import javax.swing.JButton; import javax.swing.JFileChooser; import javax.swing.JFrame; import javax.swing.filechooser.FileFilter; public class JFileChooserTest { public class SimpleFileFilter extends FileFilter { private String desc; private List<String> extensions; private boolean showDirectories; /** * @param name example: "Data files" * @param glob example: "*.txt|*.csv" */ public SimpleFileFilter (String name, String globs) { extensions = new ArrayList<String>(); for (String glob : globs.split("\\|")) { if (!glob.startsWith("*.")) throw new IllegalArgumentException("expected list of globs like \"*.txt|*.csv\""); // cut off "*" // store only lower case (make comparison case insensitive) extensions.add (glob.substring(1).toLowerCase()); } desc = name + " (" + globs + ")"; } public SimpleFileFilter(String name, String globs, boolean showDirectories) { this(name, globs); this.showDirectories = showDirectories; } @Override public boolean accept(File file) { if(showDirectories && file.isDirectory()) { return true; } String fileName = file.toString().toLowerCase(); for (String extension : extensions) { if (fileName.endsWith (extension)) { return true; } } return false; } @Override public String getDescription() { return desc; } /** * @return includes '.' */ public String getFirstExtension() { return extensions.get(0); } } void export() { String documentTitle = "lolcat"; final JFileChooser jfc = new JFileChooser(); jfc.setDialogTitle("Export"); jfc.setDialogType(JFileChooser.SAVE_DIALOG); jfc.setSelectedFile(new File (documentTitle)); jfc.addChoosableFileFilter(new SimpleFileFilter("JPEG", "*.jpg")); jfc.addChoosableFileFilter(new SimpleFileFilter("PNG", "*.png")); jfc.addPropertyChangeListener(JFileChooser.FILE_FILTER_CHANGED_PROPERTY, new PropertyChangeListener() { public void propertyChange(PropertyChangeEvent arg0) { System.out.println ("Property changed"); String extold = null; String extnew = null; if (arg0.getOldValue() == null || !(arg0.getOldValue() instanceof SimpleFileFilter)) return; if (arg0.getNewValue() == null || !(arg0.getNewValue() instanceof SimpleFileFilter)) return; SimpleFileFilter oldValue = ((SimpleFileFilter)arg0.getOldValue()); SimpleFileFilter newValue = ((SimpleFileFilter)arg0.getNewValue()); extold = oldValue.getFirstExtension(); extnew = newValue.getFirstExtension(); String filename = "" + jfc.getSelectedFile(); System.out.println ("file: " + filename + " old: " + extold + ", new: " + extnew); if (filename.endsWith(extold)) { filename.replace(extold, extnew); } else { filename += extnew; } jfc.setSelectedFile(new File (filename)); } }); jfc.showDialog(frame, "export"); } JFrame frame; void run() { frame = new JFrame(); JButton btn = new JButton ("export"); frame.add (btn); btn.addActionListener (new ActionListener() { public void actionPerformed(ActionEvent ae) { export(); } }); frame.setSize (300, 300); frame.pack(); frame.setVisible(true); } public static void main(String[] args) { javax.swing.SwingUtilities.invokeLater(new Runnable() { public void run() { JFileChooserTest x = new JFileChooserTest(); x.run(); } }); } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Best way to program a call to php

    - by hairdresser-101
    I've recently posted here http://stackoverflow.com/questions/2627645/accessing-session-when-using-file-get-contents-in-php about a problem I was having and the general consensus is that I'm not doing it right... while I generally think "as long as it works..." I thought I'd get some feedback on how I could do it better... I was to send the exact same email in the exact same format from multiple different areas. When a job is entered (automatically as a part of the POST) Manually when reviewing jobs to re-assign to another installer The original script is a php page which is called using AJAX to send the work order request - this worked by simply calling a standard php page, returning the success or error message and then displaying within the calling page. Now I have tried to use the same page within the automated job entry so it accepts the job via a form, logs it and mails it. My problem is (as you can see from the original post) the function file_get_contents() is not good for this cause in the automated script... My problem is that from an AJAX call I need to do things like include the database connection initialiser, start the session and do whatever else needs to be done in a standalone page... Some or all of these are not required if it is an include so it makes the file only good for one purpose... How do I make the file good for both purposes? I guess I'm looking for recommendations for the best file layout and structure to cater for both scenarios... The current file looks like: <?php session_start(); $order_id = $_GET['order_id']; include('include/database.php'); function getLineItems($order_id) { $query = mysql_query("SELECT ...lineItems..."); //Print rows with data while($row = mysql_fetch_object($query)) { $lineItems .= '...Build Line Item String...'; } return $lineItems; } function send_email($order_id) { //Get data for current job to display $query = mysql_query("SELECT ...Job Details..."); $row = mysql_fetch_object($query); $subject = 'Work Order Request'; $email_message = '...Build Email... ...Include Job Details... '.getLineItems($order_id).' ...Finish Email...'; $headers = '...Create Email Headers...'; if (mail($row->primary_email, $subject, $email_message, $headers)) { $query = mysql_query("...log successful send..."); if (mysql_error()!="") { $message .= '...display mysqlerror()..'; } $message .= '...create success message...'; } else { $query = mysql_query("...log failed send..."); if (mysql_error()!="") { $message .= '...display mysqlerror()..'; } $message .= '...create failed message...'; } return $message; } // END send_email() function //Check supplier info $query = mysql_query("...get suppliers info attached to order_id..."); if (mysql_num_rows($query) > 0) { while($row = mysql_fetch_object($query)) { if ($row->primary_email=="") { $message .= '...no email message...'; } else if ($row->notification_email=="") { $message .= '...no notifications message...'; } else { $message .= send_email($order_id); } } } else { $message .= '...no supplier matched message...'; } print $message; ?>

    Read the article

  • Lenovo X220 right click does not work with ubuntu 12.04

    - by fulop
    I am unable to right click with my new X220 Lenovo sub-notebook. I have read several workaround but even not know which one would help me. Can someone help me to find the solution or workaround? dpkg-buildpackage: export CFLAGS from dpkg-buildflags (origin: vendor): -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Wformat-security dpkg-buildpackage: export CPPFLAGS from dpkg-buildflags (origin: vendor): -D_FORTIFY_SOURCE=2 dpkg-buildpackage: export CXXFLAGS from dpkg-buildflags (origin: vendor): -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Wformat-security dpkg-buildpackage: export FFLAGS from dpkg-buildflags (origin: vendor): -g -O2 dpkg-buildpackage: export LDFLAGS from dpkg-buildflags (origin: vendor): -Wl,-Bsymbolic-functions -Wl,-z,relro dpkg-buildpackage: source package xserver-xorg-input-synaptics dpkg-buildpackage: source version 1.6.2-1ubuntu1~precise2 dpkg-buildpackage: source changed by Timo Aaltonen <[email protected]> dpkg-buildpackage: host architecture amd64 dpkg-source --before-build xserver-xorg-input-synaptics-1.6.2 fakeroot debian/rules clean dh clean --with quilt,autoreconf,xsf --builddirectory=build/ dh_testdir -O--builddirectory=build/ dh_auto_clean -O--builddirectory=build/ dh_quilt_unpatch -O--builddirectory=build/ Removing patch 131_reset-num_active_touches-on-deviceoff.patch Restoring src/synaptics.c Removing patch 130_dont_enable_rightbutton_area.patch Restoring conf/50-synaptics.conf Removing patch 129_disable_three_touch_tap.patch Restoring src/synaptics.c Removing patch 128_disable_three_click_action.patch Restoring src/synaptics.c Removing patch 126_ubuntu_xi22.patch Restoring configure.ac Removing patch 125_option_rec_revert.patch Restoring test/fake-symbols.h Restoring test/fake-symbols.c Removing patch 124_syndaemon_events.patch Restoring tools/syndaemon.c Removing patch 118_quell_error_msg.patch Restoring tools/synclient.c Restoring tools/syndaemon.c Removing patch 115_evdev_only.patch Restoring conf/50-synaptics.conf Removing patch 106_always_enable_vert_edge_scroll.patch Restoring src/synaptics.c Removing patch 104_always_enable_tapping.patch Restoring src/synaptics.c Removing patch 103_enable_cornertapping.patch Restoring src/synaptics.c Removing patch 101_resolution_detect_option.patch Restoring include/synaptics-properties.h Restoring man/synaptics.man Restoring src/synapticsstr.h Restoring src/properties.c Restoring src/synaptics.c Restoring tools/synclient.c Removing patch 02-do-not-use-synaptics-for-keyboards.patch Restoring conf/11-x11-synaptics.fdi No patches applied dh_autoreconf_clean -O--builddirectory=build/ dh_clean -O--builddirectory=build/ dpkg-source -b xserver-xorg-input-synaptics-1.6.2 dpkg-source: warning: no source format specified in debian/source/format, see dpkg-source(1) dpkg-source: info: using source format `1.0' dpkg-source: info: building xserver-xorg-input-synaptics using existing xserver-xorg-input-synaptics_1.6.2.orig.tar.gz dpkg-source: info: building xserver-xorg-input-synaptics in xserver-xorg-input-synaptics_1.6.2-1ubuntu1~precise2.diff.gz dpkg-source: warning: the diff modifies the following upstream files: autogen.sh docs/README.alps docs/tapndrag.dia docs/trouble-shooting.txt dpkg-source: info: use the '3.0 (quilt)' format to have separate and documented changes to upstream files, see dpkg-source(1) dpkg-source: info: building xserver-xorg-input-synaptics in xserver-xorg-input-synaptics_1.6.2-1ubuntu1~precise2.dsc debian/rules build dh build --with quilt,autoreconf,xsf --builddirectory=build/ dh_testdir -O--builddirectory=build/ dh_quilt_patch -O--builddirectory=build/ Applying patch 02-do-not-use-synaptics-for-keyboards.patch patching file conf/11-x11-synaptics.fdi Hunk #1 succeeded at 9 (offset 7 lines). Applying patch 101_resolution_detect_option.patch patching file include/synaptics-properties.h patching file man/synaptics.man patching file src/properties.c Hunk #3 succeeded at 787 (offset 6 lines). patching file src/synaptics.c Hunk #2 succeeded at 1403 (offset 3 lines). Hunk #3 succeeded at 1421 (offset 3 lines). patching file src/synapticsstr.h patching file tools/synclient.c Applying patch 103_enable_cornertapping.patch patching file src/synaptics.c Hunk #1 succeeded at 762 with fuzz 1 (offset 202 lines). Applying patch 104_always_enable_tapping.patch patching file src/synaptics.c Hunk #1 succeeded at 662 with fuzz 2 (offset 6 lines). Applying patch 106_always_enable_vert_edge_scroll.patch patching file src/synaptics.c Hunk #1 succeeded at 673 (offset 174 lines). Applying patch 115_evdev_only.patch patching file conf/50-synaptics.conf Hunk #1 succeeded at 14 with fuzz 2. Applying patch 118_quell_error_msg.patch patching file tools/synclient.c patching file tools/syndaemon.c Applying patch 124_syndaemon_events.patch patching file tools/syndaemon.c Applying patch 125_option_rec_revert.patch patching file test/fake-symbols.c patching file test/fake-symbols.h Applying patch 126_ubuntu_xi22.patch patching file configure.ac Applying patch 128_disable_three_click_action.patch patching file src/synaptics.c Hunk #1 succeeded at 671 (offset 174 lines). Applying patch 129_disable_three_touch_tap.patch patching file src/synaptics.c Hunk #1 succeeded at 665 (offset 32 lines). Applying patch 130_dont_enable_rightbutton_area.patch patching file conf/50-synaptics.conf Applying patch 131_reset-num_active_touches-on-deviceoff.patch patching file src/synaptics.c Applying patch 201-wait.patch patching file src/eventcomm.c Hunk #1 FAILED at 750. Hunk #2 FAILED at 775. Hunk #3 FAILED at 784. 3 out of 3 hunks FAILED -- rejects in file src/eventcomm.c Patch 201-wait.patch does not apply (enforce with -f) dh_quilt_patch: quilt --quiltrc /dev/null push -a || test $? = 2 returned exit code 1 make: *** [build] Error 25 dpkg-buildpackage: error: debian/rules build gave error exit status 2

    Read the article

  • Running Best Practice Analyzer on Windows 2012 yields error "Result file has not yet been generated"

    - by mhildreth
    Whenever I run the Best Practice Analyzer on a Windows 2012 server with IIS installed, I receive the error: "There has been a Best Practice Analyzer error for Model Id 'Microsoft/Windows/WebServer'. The Result file has not yet been generated. Please perform the scan first and try again." I'm doing this from the "Local Server" section of the Server Manager. I'm logged in as with a domain credential that has administrative rights on the server. I don't know how to generate the result file or where it would be located. I have 4 servers, all with IIS and this is happening on all of them. The servers are practically brand new so there isn't anything really exceptional about their setup. Any suggestions on how to generate the result file? Thanks in advance.

    Read the article

  • .htaccess Permission denied. Unable to check htaccess file

    - by Josh
    Hi, I have a strange problem when adding a sub-domain to our virtual server. I have done similar sub-domains before and they have worked fine. When I try to access the sub-domain I get an 403 Forbidden error. I checked the error logs and have the following error: pcfg_openfile: unable to check htaccess file, ensure it is readable I've searched Google and could only find solutions regarding file and folder permissions, that I have checked and the solution isn't solved. I also saw problems with Frontpage Extensions, but that's not installed on the server. Edit Forgot to say that there isn't a .htaccess file in the directory of the sub-domain

    Read the article

  • Decoding ima4 audio format

    - by MrDatabase
    To reduce the download size of an iPhone application I'm compressing some audio files. Specifically I'm using afconvert on the command line to change .wav format to .caf format w/ ima4 compression. I've read this (wooji-juice.com) awesome post about this exact topic. I'm having trouble w/ the "decoding ima4 packets" step. I've looked at their sample code and I'm stuck. Please help w/ some pseudo code or sample code that can guide me in the right direction. Thanks! Additional info: Here is what I've completed and where I'm having trouble... I can play .wav files in both the simulator and on the phone. I can compress .wav files to .caf w/ ima4 compression using afconvert on the command line. I'm using the SoundEngine that came w/ CrashLanding (I fixed one memory leak). I modified the SoundEngine code to look for the mFormatID 'ima4'. I don't understand the blog post linked above starting w/ "Calculating the size of the unpacked data". Why do I need to do this? Also, what does the term "packet" refer to? I'm very new to any sort of audio programming.

    Read the article

  • MSBuild: Add additional files to compile without altering the project file

    - by Craig Norton
    After looking around I can't find a simple answer to this problem. I am trying to create an MSBuild file to allow me to easily use SpecFlow and NUnit within Visual Studio 2010 express. The file below is not complete this is just a proof of concept and it needs to be made more generic. <Project DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <PropertyGroup> <BuildDependsOn> BuildSolution; SpecFlow; BuildProject; NUnit; </BuildDependsOn> </PropertyGroup> <PropertyGroup> <Solution>C:\Users\Craig\Documents\My Dropbox\Cells\Cells.sln</Solution> <CSProject>C:\Users\Craig\Documents\My Dropbox\Cells\Configuration\Configuration.csproj</CSProject> <DLL>C:\Users\Craig\Documents\My Dropbox\Cells\Configuration\bin\Debug\Configuration.dll</DLL> </PropertyGroup> <Target Name="Build" DependsOnTargets="$(BuildDependsOn)"> </Target> <Target Name="BuildSolution"> <MSBuild Projects="$(Solution)" Properties="Configuration=Debug" /> </Target> <Target Name="SpecFlow"> <Exec Command="SpecFlow generateall $(CSProject)" /> </Target> <Target Name="BuildProject"> <MSBuild Projects="$(CSProject)" Properties="Configuration=Debug" /> </Target> <Target Name="NUnit"> <Exec Command='NUnit /run "$(DLL)"' /> </Target> The SpecFlow Task looks in the .csproj file and creates a SpecFlowFeature1.feature.cs. I need to include this file when building the .csproj so that NUnit can use it. I know I could modify (either directly or on a copy) the .csproj file to include the generated file but I'd prefer to avoid this. My question is: Is there a way to use the MSBuild Task to build the project file and tell it to include an additional file to include in the build? Thank you.

    Read the article

  • how to access(read/write) local file system from webkit/javascript?

    - by ganapati hegde
    Hi, i am using Webkitgtk for rendering my HTML pages.Now,say i am browsing the page, i select some text while reading,i want to save/write down the selected text on my local file say /home/localfile.txt. Is any way to access(read/write) local file system using webkit? In case of firefox, i can do like below. try { netscape.security.PrivilegeManager.enablePrivilege("UniversalXPConnect"); } catch (e) { alert("Permission to save file was denied."); } var file = Components.classes["@mozilla.org/file/local;1"] .createInstance(Components.interfaces.nsILocalFile); file.initWithPath( "/home/localfile.txt" ); if ( file.exists() == false ) { alert( "Creating file... " ); file.create( Components.interfaces.nsIFile.NORMAL_FILE_TYPE, 420 ); } var outputStream = Components.classes["@mozilla.org/network/file-output-stream;1"] .createInstance( Components.interfaces.nsIFileOutputStream ); outputStream.init( file, 0x04 | 0x08 | 0x20, 420, 0 ); var output = "my data to be written to the local file"; var result = outputStream.write( output, output.length ); outputStream.close(); The above code is written in a javascript file and the js file is linked to the html file.When some text is selected,the js function will be called and action will be taken place.How can i achieve the same result using Webkit? Thanks...

    Read the article

  • VSS: Move file from one folder to another?

    - by shoosh
    Is there a way in Visual SourceSafe to move a file from one directory to another while retaining its history? Edit I actually found a round about way to do this. First I drag the file I want to move to the directory I want to move it to, this creates a "Link" to the file there and then I "permanently destroy" the file in its original location. Does this actually do what I thing it does?

    Read the article

  • Fatal error: Incompatible file format: The encoded file has format major ID 1, whereas the Loader expects 4 in ... on line 0

    - by Eugene
    I am using Ubuntu 10.04 and for some time I had to keep a downgraded PHP 5.2 package because I need to run Zend encrypted scripts. Recently I noticed that Zend released beta version of their loader (http://forums.zend.com/viewtopic.php?f=57&t=1365&start=80#p22073) so I updated to the native PHP 5.3 package, downloaded the .so file, added this to php.ini ;zend_extension=/etc/php5/ZendOptimizer.so zend_extension=/etc/php5/ZendGuardLoader.so zend_loader.enable=1 zend_loader.disable_licensing=0 zend_loader.obfuscation_level_support=3 and restarted the server. Now I am getting this error: Fatal error: Incompatible file format: The encoded file has format major ID 1, whereas the Loader expects 4 in ... on line 0 Do you by chance know an easy fix for this? Or should I downgrade back and wait till when they release something more stable?

    Read the article

  • Automatically extracting inline XSD from WSDL into XSD file(s)

    - by Steven Geens
    I am using a third party Web Service whose definition and implementation are beyond my control. This web service will change in the future. The Web Service should be used to generate an XML file which contains some of the same data (represented by the same XSD types) as the Web Service plus some extra information generated by the program. My approach: create my own XSD referring to the XSD definitions of the WSDL of the called web service (This XSD also includes XSD types for the extra information obviously.) use a Java XML databinding framework (like ADB or JiXB) to generate the databinding classes from my own XSD file from step 1 use a Java SOAP framework (like Axis2 or CXF) with the same databinding framework to generate the databinding classes from the WSDL (This would enable me to use the objects retrieved by the web service directly in the generation of the XML.) The XSD types I am going to use in my own XSD file, but are defined in the WSDL, are subject to change. Whenever they change, I would like to automatically process the XSD and WSDL databinding again. (If the change is significant enough, this might trigger some development effort.(But usually not.)) My problem: In step 1 I need an XSD referring to the same types as used by the Web Service. The WSDL is referring to another WSDL, which is referring to another WSDL etc. Eventually there is an WSDL with the needed inline XSD types. As far as I know there is no way to directly reference the inline XSD types of a WSDL from an XSD. The approach I would think most viable, is to include an extra step in the automatic processing (before the databinding) that extracts the inline XSD from the WSDL into other XSD file(s). These other XSD file(s) can then be referred to by my own XSD file. Things I'd like to avoid: Manually copy pasting the inline XSD into an XSD file (I am looking for an automatic process.) Any manual steps.(Like the determining the WSDL that contains the inline types manually.(The location of that WSDL does change as well.)) Using xsd:any in my own XSD. I would like my own XSD file to be correct. Using a non-Java technology(like .NET) Huge amounts of implementation (but hints on how you would implement such an extraction are welcome anyway) PS: I found some similar questions, but they all had responses like: WTH would you want to do that? That is the reason for my rather large background story.

    Read the article

  • Error: "failed to connect to wpa_supplicant - wpa_ctrl_open no such file or directory" using netcfg with wpa_supplicant

    - by user1576628
    I'm trying to set up netcfg so that I can finish installing Arch Linux (using the instructions from the Beginners' Guide and netcfg) and I passed over what was meant to be a short step. Open wifi-menu, select network, enter password. After multiple attempts, I decided to edit the profile manually, which yielded no improvement. Eventually I decided to use netfcg with the more familiar wpa_supplicant. My /etc/wpa_supplicant.conf file is as follows: network={ ssid="my_ssid" #psk="my_wireless_passcode" psk="my_wireless_passcode_hex" } (Replacing generic names with my actual ssid and psk.) And my /etc/network.d/wpa_suppl file reads: CONNECTION='wireless' DESCRIPTION='A wpa_supplicant configuration based wireless connection' INTERFACE='wlan0' SECURITY='wpa-config' WPA_CONF='/etc/wpa_supplicant.conf' IP='dhcp' My ssid is not hidden, wlan0 is the proper interface, and wpa_supplicant works fine on its own, but using netcfg wpa_suppl, it returns failed to connect to wpa_supplicant - wpa_ctrl_open no such file or directory about twelve times before finally telling me the authentication failed. What can I do to fix this?

    Read the article

  • Hot deploying with Tomcat Manager fails because file already exists

    - by Artem
    Tomcat beginner question that I hope will help many. Could someone explain how TomCat hot deploy is supposed to work. We have a currently deployed 'TomCatTest', and we want to fix a small bug in 'TomCatTest' with no downtime for users. We are using the Tomcat Manager console, and just trying to upload a file there. We must be making a stupid error, but we see: 'FAIL - War file "TomCatTest.war" already exists on server' There are many many posts suggesting this works somehow: http://serverfault.com/questions/120706/replace-single-file-on-tomcat-deployed-war http://tomcat.apache.org/tomcat-6.0-doc/config/host.html#Automatic%20Application%20Deployment For the life of me, I can't figure out this simple problem. Could you help, please?

    Read the article

  • Howto unzip ".xz" file with 7z and lzma

    - by neversaint
    I tried to uncompressed a "*.xz" file with both 7z and lzma. But they gave me such message: $ 7z x myfile.fq.xz 7-Zip 4.57 Copyright (c) 1999-2007 Igor Pavlov 2007-12-06 p7zip Version 4.57 (locale=C,Utf16=off,HugeFiles=on,4 CPUs) Processing archive: myfile.fq.xz Error: Can not open file as archive $ 7z x myfile.fq.xz 7-Zip 4.57 Copyright (c) 1999-2007 Igor Pavlov 2007-12-06 p7zip Version 4.57 (locale=C,Utf16=off,HugeFiles=on,4 CPUs) Processing archive: myfile.fq.xz Error: Can not open file as archive and with lzma $ lzma -d myfile.fq.xz J_12.fq.xz: unknown suffix -- unchanged with other option: $ lzma -S .xz -d myfile.fq.xz lzma: SetDecoderProperties() error

    Read the article

  • How to configure Apache so all requests go to single CGI file

    - by fastmonkeywheels
    I'm porting a CGI application from an embedded web server to run under Apache. In the effort of changing the least amount required I'm trying to figure out how to configure Apache so any requests coming in go to my CGI program, which then will use the QueryString environmental variable to determine which file needs to be created. I have Apache working now to where it will process my CGI file if it's requested directly i.e. localhost/cgi-bin/cgi_test.out but I need to figure out how to get my application to be called whenever any file is requested: localhost/ - call my application with QueryString set to "" or "/" localhost/thisFile - call my application with QueryString set to "/thisFile" etc. I have been doing all of my configuration testing under /etc/apache2/sites-available/mysite, which has been enabled and the default disabled. Thanks for any help. I've tried the recommendation from here: http://serverfault.com/questions/56082/configure-apache-to-handle-all-requests-via-single-index-php but I keep getting circular redirects.

    Read the article

  • mkisofs creating iso file with no error or warning but iso corrupted

    - by user1291203
    I'm trying to make a dvd from mpeg2 files. First of all i'm on windows 7. I'm using the following binaries: jpeg2yuv mpeg2enc mplex spumux dvdauthor Now everything is fine till this point absolutely no errors, but then i'm using mkisofs to make the iso file also no errors or warnings. It creates the iso file but i cannot burn it to dvd it said: The selected disk image file isn't valid. I tried it on a Mac osx as well and there the iso is worked fine. It is an NTSC iso. I'm totaly stuck with this problem any help is really appreciated.

    Read the article

  • JasperReport Issue using with struts2 - getting null in final PDF file

    - by Nirmal
    Hello, i am writing my jasper report problem with struts2. Following is the code that i am trying to execute : struts.xml contains : <action name="myJasperTest1" class="temp.JasperAction1"> <result name="success" type="jasper"> <param name="location">/jasper/our_compiled_template.jasper</param> <param name="dataSource">myList</param> <param name="format">PDF</param> </result> </action> My JasperAction1 contains : import java.util.ArrayList; import java.util.List; import com.sufalam.business.model.util.LegacyJasperInputStream; import net.sf.jasperreports.engine.JasperCompileManager; import com.opensymphony.xwork2.ActionSupport; import com.sufalam.business.finance.model.bean.Account; import java.io.FileInputStream; import net.sf.jasperreports.engine.design.JasperDesign; import net.sf.jasperreports.engine.xml.JRXmlLoader; public class JasperAction1 extends ActionSupport { /** List to use as our JasperReports dataSource. */ private List<Account> myList; public String execute() throws Exception { // Create some imaginary persons. Account a1 = new Account(); Account a2 = new Account(); a1.setId(77); a1.setName("aaa"); a2.setId(88); a2.setName("bbb"); // Store people in our dataSource list (normally would come from database). myList = new ArrayList<Account>(); myList.add(a1); myList.add(a2); // Normally we would provide a pre-compiled .jrxml file // or check to make sure we don't compile on every request. try { JasperDesign design = JRXmlLoader.load( new LegacyJasperInputStream(new FileInputStream("F://backup//backup 26-5(final acegi)//SufalamERP//build//web//jasper//report2.jrxml"))); JasperCompileManager.compileReportToFile(design,"F://backup//backup 26-5(final acegi)//SufalamERP//build//web//jasper//our_compiled_template1.jasper"); } catch (Exception e) { e.printStackTrace(); return ERROR; } return SUCCESS; } public List<Account> getMyList() { return myList; } } I am using ireport plugin of Netbeans for generation .jrxml file. After Designing my page using IReport wizard my our_jasper_template.jrxml file contains following code : <?xml version="1.0" encoding="UTF-8"?> <jasperReport xmlns="http://jasperreports.sourceforge.net/jasperreports" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://jasperreports.sourceforge.net/jasperreports http://jasperreports.sourceforge.net/xsd/jasperreport.xsd" name="null" pageWidth="595" pageHeight="842" columnWidth="535" leftMargin="20" rightMargin="20" topMargin="20" bottomMargin="20"> <queryString language="SQL"> <![CDATA[SELECT account_master."name" AS account_master_name, account_master."id" AS account_master_id FROM "public"."account_master" account_master]]> </queryString> <field name="account_master_name" class="java.lang.String"> <fieldDescription><![CDATA[]]></fieldDescription> </field> <field name="account_master_id" class="java.lang.Integer"> <fieldDescription><![CDATA[]]></fieldDescription> </field> <background> <band/> </background> <title> <band height="58"> <line> <reportElement x="0" y="8" width="555" height="1"/> </line> <line> <reportElement positionType="FixRelativeToBottom" x="0" y="51" width="555" height="1"/> </line> <staticText> <reportElement x="65" y="13" width="424" height="35"/> <textElement textAlignment="Center"> <font size="26" isBold="true"/> </textElement> <text><![CDATA[Classic template]]></text> </staticText> </band> </title> <pageHeader> <band/> </pageHeader> <columnHeader> <band/> </columnHeader> <detail> <band height="40"> <staticText> <reportElement x="0" y="0" width="139" height="20"/> <textElement> <font size="12"/> </textElement> <text><![CDATA[account_master_name]]></text> </staticText> <textField> <reportElement x="139" y="0" width="416" height="20"/> <textElement> <font size="12"/> </textElement> <textFieldExpression class="java.lang.String"><![CDATA[$F{account_master_name}]]></textFieldExpression> </textField> <staticText> <reportElement x="0" y="20" width="139" height="20"/> <textElement> <font size="12"/> </textElement> <text><![CDATA[account_master_id]]></text> </staticText> <textField> <reportElement x="139" y="20" width="416" height="20"/> <textElement> <font size="12"/> </textElement> <textFieldExpression class="java.lang.Integer"><![CDATA[$F{account_master_id}]]></textFieldExpression> </textField> </band> </detail> <columnFooter> <band/> </columnFooter> <pageFooter> <band height="26"> <textField evaluationTime="Report" pattern="" isBlankWhenNull="false"> <reportElement key="textField" x="516" y="6" width="36" height="19" forecolor="#000000" backcolor="#FFFFFF"/> <box> <topPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <leftPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <bottomPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <rightPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> </box> <textElement> <font size="10"/> </textElement> <textFieldExpression class="java.lang.String"><![CDATA["" + $V{PAGE_NUMBER}]]></textFieldExpression> </textField> <textField pattern="" isBlankWhenNull="false"> <reportElement key="textField" x="342" y="6" width="170" height="19" forecolor="#000000" backcolor="#FFFFFF"/> <box> <topPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <leftPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <bottomPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <rightPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> </box> <textElement textAlignment="Right"> <font size="10"/> </textElement> <textFieldExpression class="java.lang.String"><![CDATA["Page " + $V{PAGE_NUMBER} + " of "]]></textFieldExpression> </textField> <textField pattern="" isBlankWhenNull="false"> <reportElement key="textField" x="1" y="6" width="209" height="19" forecolor="#000000" backcolor="#FFFFFF"/> <box> <topPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <leftPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <bottomPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> <rightPen lineWidth="0.0" lineStyle="Solid" lineColor="#000000"/> </box> <textElement> <font size="10"/> </textElement> <textFieldExpression class="java.util.Date"><![CDATA[new Date()]]></textFieldExpression> </textField> </band> </pageFooter> <summary> <band/> </summary> </jasperReport> Now the problem i am facing is when i execute this action class it gives me following output as pdf format :

    Read the article

  • Getting extension of the file in FileUpload Control

    - by Mostafa
    Hi At the moment i get file extension of the file like : string fileExt = System.IO.Path.GetExtension(filUpload.FileName); But if the user change the file extension of the file ( for example user could rename "test.txt" to "text.jpg" ), I can't get the real extension . What's the solution ?

    Read the article

  • svn diff: file marked as binary type

    - by Charles Ma
    I'm doing an svn diff on one of my files and svn is detecting it as a binary type. The file is readable plain text and I would like to be able to get a diff of this file. How do I tell SVN that this is not a binary file? Cannot display: file marked as a binary type. svn:mime-type = application/octet-stream

    Read the article

  • rename file names from lower case to upper case

    - by Adnan
    Hello, I have about 2k of file that are currently in lower case like: file_one.cfr file_two.cfr .... I am searching for a fast way to rename them to upper case so they would be like; FILE_ONE.cfr FILE_TWO.cfr .... If I use from my shell; for i in *; do mv $i `echo $i | tr [:lower:] [:upper:]`; done I can get all file and the file extensions to upper case. But the extension should remain in lowercase, so my approach does not work. Any programming language is welcome.

    Read the article

  • pure-ftpd: one readonly/non-deletable file in home directory

    - by Bram Schoenmakers
    Is there a way to have a file in the user's FTP home directory without the ability to modify/remove it from that directory over FTP? So the user has write permissions on his own home folder, thus the ability to remove files. An exception should be made for a single file, which has the same filename and contents for each account. The solution I'm thinking of right now to run a periodic script to check the presence of that file, and if not, put it back. But I wonder whether there's a better solution than this.

    Read the article

< Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >