Search Results

Search found 19953 results on 799 pages for 'post meridiem'.

Page 244/799 | < Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >

• Website (jQuery) consistently crashes Internet Explorer (REALLY STUCK!)

  - by Bradley Bell

  Hey Guys. I posted this question yesterday, but haven't had a response. Basically, I'm totally stuck and clueless over crashing in Internet Explorer. The website now works fine in all browsers except internet explorer. The website is heavily reliant on jQuery and as far as I'm aware, I cant spot anything wrong with the script. Internet Explorer displays no errors and I don't know what I can possibly change. It displays fine, which would suggest that its nothing up with the CSS or HTML? I'm fairly sure it has to be the script, because it only crashes when you hover over one of the mouseover links. I'm already over the deadline and time is ticking! Its driving me crazy. I've uploaded it onto a test directory here: www.openyourheart.org.uk/test/index.html (I'll add the script/css links below as a comment, It wont let me post more than one here!) I would reaaly, really appreciate any help on this. I can also send the website compressed and post scripts here if required/preferred. Thanks in advance, Bradley

  Read the article

• Non RBAC User Roles and Permissions System: checking the user's City

  - by micha12

  We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

  Read the article

• Why won't .attr('checked','checked') set?

  - by Jason

  I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Using embedded standard HTML forms with ASP.NET

  - by RM

  I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

  Read the article

• jQuery - Not sure which method to use, closest() and parent() don't work.

  - by Nike

  Hello, again. :) God i feel like i'm spamming stackoverflow, this is my 3rd post for today. Sorry, heh. I even posted a question regarding this before, kind of, but i've changed the code a bit since so i thought it was better to post a new question. $('.pmlist ul li h4 .toggle').click(function() { $(this).closest('.meddel').toggle(250); }); That's what i've got now. The reason why the closest() method isn't working is because the div .meddel is just next to the h4 element. And closest() only crawls right up the DOM tree, ignoring other child elements. Right? parent() works almost the same and doesn't work either. And as i only want to toggle the closest .meddel div in the element, i need something that, yeah justs grabs the nearest one, and not all of them. To clear it up a bit, here's the HTML for one list item: <li class="item"> <h4><a class="toggle">ämne</a><small>2010-04-17 kl 12:54 by <u>nike1</u></small></h4> <div class="meddel"> <span> <img style="max-width: 70%; min-height: 70%;" src="profile-images/nike1.jpg" alt="" /> <a href="account.php?usr=47">nike1</a> </span> <p>text</p> </div> </li> I have several items like that, and if i click one toggle link, i just want the nearest .meddel to be toggled, as mentioned before. Thanks. -Nike

  Read the article

• JsonParseException on Valid JSON

  - by user2909602

  I am having an issue calling a RESTful service from my client code. I have written the RESTful service using CXF/Jackson, deployed to localhost, and tested using RESTClient successfully. Below is a snippet of the service code: @POST @Produces("application/json") @Consumes("application/json") @Path("/set/mood") public Response setMood(MoodMeter mm) { this.getMmDAO().insert(mm); return Response.ok().entity(mm).build(); } The model class and dao work successfully and the service itself works fine using RESTClient. However, when I attempt to call this service from Java Script, I get the error below on the server side: Caused by: org.codehaus.jackson.JsonParseException: Unexpected character ('m' (code 109)): expected a valid value (number, String, array, object, 'true', 'false' or 'null') I have copied the client side code below. To make sure it has nothing to do with the JSON data itself, I used a valid JSON string (which works using RESTClient, JSON.parse() method, and JSONLint) in the vars 'json' (string) and 'jsonData' (JSON). Below is the Java Script code: var json = '{"mood_value":8,"mood_comments":"new comments","user_id":5,"point":{"latitude":37.292929,"longitude":38.0323323},"created_dtm":1381546869260}'; var jsonData = JSON.parse(json); $.ajax({ url: 'http://localhost:8080/moodmeter/app/service/set/mood', dataType: 'json', data: jsonData, type: "POST", contentType: "application/json" }); I've seen the JsonParseException a number of times on other threads, but in this case the JSON itself appears to be valid (and tested). Any thoughts are appreciated.

  Read the article

• Cannot get a session with Facebook app? (using its Graph API)

  - by Jian Lin

  I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

  Read the article

• How do I debug a HTTP 502 error?

  - by Bialecki

  I have a Python Tornado server sitting behind a nginx frontend. Every now and then, but not every time, I get a 502 error. I look in the nginx access log and I see this: 127.0.0.1 - - [02/Jun/2010:18:04:02 -0400] "POST /a/question/updates HTTP/1.1" 502 173 "http://localhost/tagged/python" "Mozilla/5.0 (X11; U; Linux i686; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3" and in the error log: 2010/06/02 18:04:02 [error] 14033#0: *1700 connect() failed (111: Connection refused) while connecting to upstream, client: 127.0.0.1, server: _, request: "POST /a/question/updates HTTP/1.1", upstream: "http://127.0.0.1:8888/a/question/updates", host: "localhost", referrer: "http://localhost/tagged/python" I don't think any errors show up in the Tornado log. How would you go about debugging this? Is there something I can put in the Tornado or nginx configuration to help debug this? EDIT: In addition, I get a fair number of 504, gateway timeout errors. Is it possible that the Tornado instance is just busy or something?

  Read the article

• ASP.net AppendHeader not working in ASP MVC

  - by Chao

  I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

  Read the article

• How does overlayViewTouched notification work in the MoviePlayer sample code

  - by Jonathan

  Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

  Read the article

• Fork or copy a users browser session in IE

  - by jmoeller

  Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

  Read the article

• Possible bug in ASP.net UpdatePanel control?

  - by Ben Robinson

  I have come across what seems to be an annoying bug with asp.net UpdatePanels in 2 seperate projects. If you have some kind of autopostback enabled control that can cause all of the controls in the update panel to have visible=false set, resulting in an empty update panel. When you change the autopostback control back to the postion that would re enable all of the controls in the update panel, it simply does not make a call back to the server and the update panel does not update. If you do anything else that makes a call back on the same page, then the update panel contents magically appear. It is as if asp.net has decided the update panel is empty so there is no point maikng a callback, even though making the call back would fill the updatepanel with content. The only way round this is to add a style of display:none to the controls instead of setting visible=false property. Then it works fine. Has anyone else encountered this problem? Is it a bug as i suspect or is it likely i am doing soemthing wrong? I haven't got time to post example code at the moment as the code i am using is too wrapped up in other unrealted things, if people think it would help i will create a simple example and post it when I get time.

  Read the article

• Use localeURL middleware with apache prefix

  - by Olivier R.

  Good morning everyone, I Got a question about localeURL usage. Everything works great for me with url like this : www.mysite.com/ If I type www.mysite.com/ in adress bar, it turns correctly in www.mysite.com/en/ for example. If I use the view change_locale, it's also all right (ie change www.mysite.com/en/ in www.mysite.com/fr/). But my application use apache as server, and use a prefix for the site, that gives url like this : www.mysite.com/prefix/ If I type www.mysite.com/prefix/ in the adress bar, the adress turns into www.mysite.com/en/ without prefix (so 404) I change code of view to manage our settings.SERVER_PREFIX value : def change_locale(request) : """ Redirect to a given url while changing the locale in the path The url and the locale code need to be specified in the request parameters. O. Rochaix; Taken from localeURL view, and tuned to manage : - SERVER_PREFIX from settings.py """ next = request.REQUEST.get('next', None) if not next: next = request.META.get('HTTP_REFERER', None) if not next: next = settings.SERVER_PREFIX + '/' next = urlsplit(next).path prefix = False if settings.SERVER_PREFIX!="" and next.startswith(settings.SERVER_PREFIX) : prefix = True next = "/" + next.lstrip(settings.SERVER_PREFIX) _, path = utils.strip_path (next) if request.method == 'POST': locale = request.POST.get('locale', None) if locale and check_for_language(locale): path = utils.locale_path(path, locale) if prefix : path = settings.SERVER_PREFIX + path response = http.HttpResponseRedirect(path) return response with this customized view, i'm able to correctly change language, but i'm not sure that's the right way of doing stuff. Is there any option on localeURL to manage prefix of apache ?

  Read the article

• How can I attach a file using Wordpress custom fields / meta boxes?

  - by shipshape

  I am using Wordpress's add_meta_box() function to add customized meta fields to the Add New Post page, like this. I want one of these fields to allow the user to upload a file, so that a single image, pdf, audio file, or video can be associated with the post. The closest example I've seen is this one. Unfortunately it does not suit my needs, as I want my file to be processed by Wordpress's Media Uploader - so it should appear in the Media Library afterwards, and thumbnails should be generated according to the Media settings. I think ideally there would be a way to tap into Wordpress's existing Add Media dialog, and simply output the URL of the uploaded file into a text box, but I don't see how to do that. This question is similar, but the answers are a little clunky - I would like to keep this super simple for my end users. How can I accomplish this? Please do not recommend plugins such as Flutter or Magic Fields - I have tried these and they do not suit my purposes (I want the images to be processed by Wordpress's Media Uploader). I am using Wordpress 3.0-alpha. Thanks!

  Read the article

• RedirectToAction and validate MVC 2

  - by Dan

  Hi, my problem is the View where the user typed, the validation. I have to take RedirectToAction on the site because on the site upload a file. Thats my code. My model class public class Person { [Required(ErrorMessage= "Please enter name")] public string name { get; set; } } My View <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage<MvcWebRole1.Models.Person>" %> Name <h2>Information Data</h2> <%= Html.ValidationSummary() %> <%using (Html.BeginForm ("upload","Home", FormMethod.Post, new{ enctype ="multipart/form-data" })) {%> <fieldset> <legend>Fields</legend> <p> <label for="name">name:</label> <%= Html.TextBox("name") %> <%= Html.ValidationMessage("name", "*") %> </p> </fieldset> <% } %> and the Controller [AcceptVerbs(HttpVerbs.Post)] public ActionResult upload(FormCollection form) { Person lastname = new Person(); lastname.name = form["name"]; return RedirectToAction("Index"); } Thx for answer my question In advance

  Read the article

• Cucumber Error: Socket Error for Test Environment Host in REST API

  - by tmo256

  I posted this to the Cucumber group with no replies, which makes me wonder if this is actually a cucumber issue or not. I'm pretty new to cucumber, and there are a number of things I really don't quite understand about how the cucumber environment is set up and executed within the test environment. I have a REST API rails app I'm testing with cucumber, using the RestClient gem to generate a post to controller create action. When I run the feature with a hard-coded URL pointing to a running localhost server (my local dev server environment; replacing tickets_url with "http:// localhost/tickets" in the snippet below), my cucumber steps execute as expected. However, when the resource URL resolves to the cucumber host I'm declaring, I get a socket error exception. getaddrinfo: nodename nor servname provided, or not known (SocketError) From the steps file: When /^POS Adapter sends JSON data to the Tickets resource$/ do ticket = { :ticket = { ... } } host! "test.host" puts tickets_url RestClient.post tickets_url, ticket.to_json, :content_type = :json, :accepts = :json end (the "puts" statement prints "http://test.host/tickets") Using the following gems: cucumber-0.6.1 webrat-0.6.0 rest-client-1.2.0 I should also say I have a similar set up in another rails app, using test.host as my host, and it seems to work fine. I'd appreciate any insight on what I might be missing in my configuration or what this could be related to.

  Read the article

• regular expression to remove original message from reply mail using in java ?

  - by ravi ravi

  In my forum, users can reply through email. I am handling mails from their reply. When they are replying the original message getting appended. I want to get only the reply message not the original message. I have to write regular expression for gmail & hotmail. I written regex for gmail as follows : \n.wrote:(?s).--End of Post-- It is removing the original message except date. I want to remove the date also. before removing the original message : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr wrote: The following update has been posted to this discussion: test as user 222 [$MESSAGE_SIGNATURE_HEADER$] --End of Post-- " When I use the above regex it is filtering as follows : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr " Here i want only the actual message 'hi 33' not that date. How can I filter the date using above regex? Also I need regex for Hotmail also. I appreciate for any reply. Thanks in advance.

  Read the article

• Prototype's Ajax.Updater not actually updating on IE7.

  - by Ben S

  I am trying to submit a form using Ajax.Updater and have the result of that update a div element in my page. Everything works great in IE6, FF3, Chrome and Opera. However, In IE7 it sporadically works, but more often than not, it just doesn't seem to do anything. Here's the javascript: function testcaseHistoryUpdate(testcase, form) { document.body.style.cursor = 'wait'; var param = Form.serialize(form); new Ajax.Updater("content", "results/testcaseHistory/" + testcase, { onComplete: function(transport) {document.body.style.cursor = 'auto'}, parameters: param, method: 'post' } ); } I've verified using alert() calls that param is set to what I expect. I've read in many places that IE7 caches aggressively and that it might be the root cause, however every after adding the following to my php response, it still doesn't work. header("Last-Modified: " . gmdate("D, d M Y H:i:s") . " GMT"); header("Cache-Control: no-store, no-cache, must-revalidate"); header("Cache-Control: post-check=0, pre-check=0", false); header("Pragma: no-cache"); To further try to fix a caching issue I've tried adding a bogus parameter which just gets filled with a random value to have different parameters for every call, but that didn't help. I've also found this, where UTF-8 seemed to be causing an issue with IE7, but my page is clearly marked: <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> Does anyone have any idea what could be wrong with IE7 as opposed to the other browsers I tested to cause this kind of issue?

  Read the article

• Posting XML form data to a RESTful Server with Javascript or PHP

  - by pjs-worker

  Hi folks, I've been given the task of posting to a RESTful server. I'm new to the official "REST" but I've played with the concept before. However, this time I have an XML Payload example file that I am supposed to post. I'm struggling to figure out how the two relate. Can you help? Right now I can post to a specific site, say www.pcpost.com/schema/Application I can generate the URL for the inital, ie: postApplication?userid=4&... Being relatively new to web programming, I find that don't know how to take the following and interface it with the server. I'm at least familiar with Javascript and PHP. If this is impossible with those two types, I can learn whatever would be best. Thanks for your help on this. C <?xml version=\"1.0\" ?> <Application xmlns="http://www.pcpost.com/schema/Application" SchemaVersion="1.0" ProgramId="8" ApplicationDate="2009-08-29"> <Vendors> <Vendor Role="Applicant" Company="Test Company" Contact="Smith, John"/> <Vendor Role="Seller" Company="Test Company" Contact="Doe, Jane"/> <Vendor Role="Installer" Company="Test Company" Contact="Funk, Carl"/> </Vendors> <Participants> <Participant TaxStatus="Individual" Sector="Commercial"> <Roles> <Role>Host Customer</Role> </Roles> </Participants> </Application>

  Read the article

• Django Cannot set values on a ManyToManyField which specifies an intermediary model

  - by dana

  i am using a m2m and a through table, and when i was trying to save, my error was: Cannot set values on a ManyToManyField which specifies an intermediary model so, i've modified my code, so that when i save the form, to insert data into the 'through' table too.But now, i'm having another error. (i've bolded the lines where i think i am wrong) i have in models.py: class Classroom(models.Model): user = models.ForeignKey(User, related_name = 'classroom_creator') classname = models.CharField(max_length=140, unique = True) date = models.DateTimeField(auto_now=True) open_class = models.BooleanField(default=True) members = models.ManyToManyField(User,related_name="list of invited members", through = 'Membership') class Membership(models.Model): accept = models.BooleanField(User) date = models.DateTimeField(auto_now = True) classroom = models.ForeignKey(Classroom, related_name = 'classroom_membership') member = models.ForeignKey(User, related_name = 'user_membership') and in def save_classroom(request): if request.method == 'POST': form = ClassroomForm(request.POST, request.FILES, user = request.user) **classroom_instance = Classroom member_instance = Membership** if form.is_valid(): new_obj = form.save(commit=False) new_obj.user = request.user r = Relations.objects.filter(initiated_by = request.user) membership = Membership.objects.create(**classroom = classroom_instance, member = member_instance,date=datetime.datetime.now())** new_obj.save() form.save_m2m() return HttpResponseRedirect('/classroom/classroom_view/{{user}}/') else: form = ClassroomForm(user = request.user) return render_to_response('classroom/classroom_form.html', { 'form': form, }, context_instance=RequestContext(request)) but i don't seem to initialise okay the classroom_instance and menber_instance.My error os: Cannot assign "": "Membership.classroom" must be a "Classroom" instance. Thanks!

  Read the article

• asynchronous pages

  - by lockedscope

  I have just read the multi-threading and custom threading in asp.net articles. http://www.williablog.net/williablog/post/2008/12/16/Custom-Threading-in-ASPNET.aspx http://www.williablog.net/williablog/post/2008/12/16/Multi-Threading-in-ASPNET.aspx I have couple of questions. What does he mean by returning a thread to the pool? Is that thread completely removed from memory or put in to a state that it does not scheduled to CPU(is it in sleep state or whatever)? If that thread is removed from memory how could it survive after async point? How this mechanism works? Are every objects(pages class, request,response etc.) are copied to somewhere else before they are disposed? (Or, is it just waiting in a sleep state and then its waked when async call ends?) He is saying that; "Having said that, making pages asynchronous is not really about improving performance, it is about improving scalability" then he is saying; "I'm sorry to say that it will do nothing for scalability or performance." So which one is true? or for which case(s) are they true?

  Read the article

• Exporting data from php page to word document

  - by udaya

  Hi I exported data from php page to word document but the problm is the header is not available in all pages I got the same problem while i am exporting the datas to pdf but i got the result for that one by using fpdf library In pdf i got the results like this ex page1 slno name 1 udaya 2 sankar In page 2 slno name 3 chendu 4 Akila I want the same kind of result in word how to get that This is the function i used function changeDetails() { $bType = $this-input-post('textvalue'); if($bType == "word") { $this-load-library('table'); $data['countrytoword'] = $this-AddEditmodel1-export(); $this-table-set_heading('Name','Country','State','Town'); $out = $this-table-generate($data['countrytoword']); header("Content-Type: application/vnd.ms-word"); header("Expires: 0"); header("Cache-Control: must-revalidate, post-check=0, pre-check=0"); header("Content-disposition: attachment; filename=$cur_date.doc"); echo ''; echo 'CountryList'; print_r($out); } } Name Country State Town

  Read the article

• How to log in to craigslist using c#

  - by kosikiza

  i m using the following code to log in to craigslist, but haven't succeeded yet. string formParams = string.Format("inputEmailHandle={0}&inputPassword={1}", "[email protected]", "removed"); //string postData = "[email protected]&inputPassword=removed"; string uri = "https://accounts.craigslist.org/"; HttpWebRequest request = (HttpWebRequest)WebRequest.Create(uri); request.KeepAlive = true; request.ProtocolVersion = HttpVersion.Version10; request.Method = "POST"; byte[] postBytes = Encoding.ASCII.GetBytes(formParams); request.ContentType = "application/x-www-form-urlencoded"; request.ContentLength = postBytes.Length; Stream requestStream = request.GetRequestStream(); requestStream.Write(postBytes, 0, postBytes.Length); requestStream.Close(); HttpWebResponse response = (HttpWebResponse)request.GetResponse(); cookyHeader = response.Headers["Set-cookie"]; string pageSource; string getUrl = "https://post.craigslist.org/del"; WebRequest getRequest = WebRequest.Create(getUrl); getRequest.Headers.Add("Cookie", cookyHeader); WebResponse getResponse = getRequest.GetResponse(); using (StreamReader sr = new StreamReader(getResponse.GetResponseStream())) { pageSource = sr.ReadToEnd(); }

  Read the article

• jquery control execution of the callback functions

  - by user253530

  Function socialbookmarksTableData(data) is called by another function to generate the content of a table -- data is a JSON object. Inside the function i call 2 other functions that use getJSON and POST (with json as a return object) to get some data. The problem is: though the functions execute correctly i get undefined value for the 2 variables (bookmarkingSites, bookmarkCategories). Help with a solution please. function socialbookmarksGetBookmarkCategories(bookmarkID) { var toReturn = ''; $.post("php/socialbookmark-get-bookmark-categories.php",{ bookmarkID: bookmarkID },function(data){ $.each(data,function(i,categID){ toReturn += '<option value ="' + data[i].categID + '">' + data[i].categName + '</option>'; }) return toReturn; },"JSON"); } function socialbookmarksGetBookmarkSites() { var bookmarkingSites = ''; $.getJSON("php/socialbookmark-get-bookmarking-sites.php",function(bookmarks){ for(var i = 0; i < bookmarks.length; i++){ //alert( bookmarks[i].id); bookmarkingSites += '<option value = "' + bookmarks[i].id + '">' + bookmarks[i].title + '</option>'; } return bookmarkingSites; }); } function socialbookmarksTableData(data) { var toAppend = ''; var bookmarkingSites = socialbookmarksGetBookmarkSites(); $.each(data.results, function(i, id){ var bookmarkCategories = socialbookmarksGetBookmarkCategories(data.results[i].bookmarkID); //rest of the code is not important }); $("#searchTable tbody").append(toAppend); }

  Read the article

< Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >