Search Results

Search found 6630 results on 266 pages for 'everyone'.

Page 246/266 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

  • PHP: Condense array of similar strings into one merged array

    - by Matt Andrews
    Hi everyone. Working with an array of dates (opening times for a business). I want to condense them to their briefest possible form. So far, I started out with this structure Array ( [Mon] => 12noon-2:45pm, 5:30pm-10:30pm [Tue] => 12noon-2:45pm, 5:30pm-10:30pm [Wed] => 12noon-2:45pm, 5:30pm-10:30pm [Thu] => 12noon-2:45pm, 5:30pm-10:30pm [Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) What I want to achieve is this: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) I've tried writing a recursive function and have managed to output this so far: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Tue-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Wed-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Thu-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) Can anybody see a simple way of comparing the values and combining the keys where they're similar? My recursive function is basically two nested foreach() loops - not very elegant. Thanks, Matt EDIT: Here's my code so far, which produces the 3rd array above (from the first one as input): $last_time = array('t' => '', 'd' => ''); // blank array for looping $i = 0; foreach($final_times as $day=>$time) { if($last_time['t'] != $time ) { // it's a new time if($i != 0) { $print_times[] = $day . ' ' . $time; } // only print if it's not the first, otherwise we get two mondays } else { // this day has the same time as last time $end_day = $day; foreach($final_times as $day2=>$time2) { if($time == $time2) { $end_day = $day2; } } $print_times[] = $last_time['d'] . '-' . $end_day . ' ' . $time; } $last_time = array('t' => $time, 'd' => $day); $i++; }

    Read the article

  • How to fine tune FluentNHibernate's auto mapper?

    - by Venemo
    Okay, so yesterday I managed to get the latest trunk builds of NHibernate and FluentNHibernate to work with my latest little project. (I'm working on a bug tracking application.) I created a nice data access layer using the Repository pattern. I decided that my entities are nothing special, and also that with the current maturity of ORMs, I don't want to hand-craft the database. So, I chose to use FluentNHibernate's auto mapping feature with NHibernate's "hbm2ddl.auto" property set to "create". It really works like a charm. I put the NHibernate configuration in my app domain's config file, set it up, and started playing with it. (For the time being, I created some unit tests only.) It created all tables in the database, and everything I need for it. It even mapped my many-to-many relationships correctly. However, there are a few small glitches: All of the columns created in the DB allow null. I understand that it can't predict which properties should allow null and which shouldn't, but at least I'd like to tell it that it should allow null only for those types for which null makes sense in .NET (eg. non-nullable value types shouldn't allow null). All of the nvarchar and varbinary columns it created, have a default length of 255. I would prefer to have them on max instead of that. Is there a way to tell the auto mapper about the two simple rules above? If the answer is no, will it work correctly if I modify the tables it created? (So, if I set some columns not to allow null, and change the allowed length for some other, will it correctly work with them?) EDIT: I managed to achieve the above by using Fluent NHibernate's convention API. Thanks to everyone who helped! However, there is one more thing: after checking out the convention API, I really would like my IDs to be calld "ID", not "Id", but it seems to me that the PrimaryKey.Name.Is(x => "ID") is not working at all. If I add it to the conventions collection and rewrite my entities' properties to "ID" instead of "Id", it throws an exception that there is no primary key mapped. Any thoughts on this?

    Read the article

  • Looping through all attributes of a XML element in XSLT

    - by TheGNUGuy
    Hey everyone, I am trying to use <xsl:for-each select="@*"> to grab all the attributes of a given element but when i do that my <xsl:choose> statement doesn't execute. Here is the element that I'm working with: <textBox id="Airfare" value="" label="text 1"/> Here is the XSLT template I'm using: <xsl:template match="textBox"> <div> <xsl:choose> <xsl:when test="@label"> <xsl:value-of select="@label"/> </xsl:when> <xsl:otherwise> <xsl:text>No Label Defined</xsl:text> </xsl:otherwise> </xsl:choose> <xsl:element name="input"> <xsl:attribute name="type">text</xsl:attribute> <xsl:for-each select="@*"> <xsl:choose> <xsl:when test="@id"> <xsl:attribute name="name">form_<xsl:value-of select="@id"/></xsl:attribute> <xsl:attribute name="id">form_<xsl:value-of select="@id"/></xsl:attribute> </xsl:when> <xsl:when test="@label"> </xsl:when> <xsl:otherwise> <xsl:copy-of select="current()"/> </xsl:otherwise> </xsl:choose> </xsl:for-each> </xsl:element> </div> And when I generate the HTML using PHP I get this: <div>text 1<input type="text" id="Airfare" value="" label="text 1"></div> As you can see it didn't add form_ to the id attribute it didn't generate a name attribute and it didn't skip over the label attribute. Thanks for your help!

    Read the article

  • Implementing a logging library in .NET with a database as the storage medium

    - by Dave
    I'm just starting to work on a logging library that everyone can use to keep track of any sort of system information while the user is running our application. The simplest example so far is to track Info, Warnings, and Errors. I want all plugins to be able to use this feature, but since each developer might have a different idea of what's important to report, I want to keep this as generic as possible. In the C++ world, I would normally use something like a stl::pair<string,string> to act as a key value pair structure, and have a stl::list of these to act as a "row" in the log. The log cache would then be a list<list<pair<string,string>>> (ugh!). This way, the developers can use a const string key like INFO, WARNING, ERROR to have a consistent naming for a column in the database (for SELECTing specific types of information). I'd like the database to be able to deal with any number of distinct column names. For example, John might have an INFO row with a column called USER, and Bill might have an INFO row with a column called FILENAME. I want the log viewer to be able to display all information, and if one report doesn't have a value for INFO / FILENAME, those fields should just appear blank. So one option is to use List<List<KeyValuePair<String,String>>, and the another is to have the log library consumer somehow "register" its schema, and then have the database do an ALTER TABLE to handle this situation. Yet another idea is to have a table that's just for key value pairs, with a foreign key that maps the key value pairs back to the original log entry. I obviously don't want logging to bog down the system, so I only lock the log cache to make a copy of the data (and remove the already-copied data), then a background thread will dump the information to the database. My specific questions regarding this are: Do you see any performance issues? In other words, have you ever tried something like this and found that certain things just don't work well in practice? Is there a more .NETish way to implement the key value pairs, other than List<List<KeyValuePair<String,String>>>? Even if there is a way to do #2 better, is the ALTER TABLE idea I proposed above a Bad Thing? Would you recommend multiple databases over a single one? I don't yet have an idea of how frequently the log would get written to, but we ideally would like to have lots of low level information. Perhaps there should be a DB with a fixed schema only for the low level stuff, and then another DB that's more flexible for reporting information back to users.

    Read the article

  • Estimating the boundary of arbitrarily distributed data

    - by Dave
    I have two dimensional discrete spatial data. I would like to make an approximation of the spatial boundaries of this data so that I can produce a plot with another dataset on top of it. Ideally, this would be an ordered set of (x,y) points that matplotlib can plot with the plt.Polygon() patch. My initial attempt is very inelegant: I place a fine grid over the data, and where data is found in a cell, a square matplotlib patch is created of that cell. The resolution of the boundary thus depends on the sampling frequency of the grid. Here is an example, where the grey region are the cells containing data, black where no data exists. OK, problem solved - why am I still here? Well.... I'd like a more "elegant" solution, or at least one that is faster (ie. I don't want to get on with "real" work, I'd like to have some fun with this!). The best way I can think of is a ray-tracing approach - eg: from xmin to xmax, at y=ymin, check if data boundary crossed in intervals dx y=ymin+dy, do 1 do 1-2, but now sample in y An alternative is defining a centre, and sampling in r-theta space - ie radial spokes in dtheta increments. Both would produce a set of (x,y) points, but then how do I order/link neighbouring points them to create the boundary? A nearest neighbour approach is not appropriate as, for example (to borrow from Geography), an isthmus (think of Panama connecting N&S America) could then close off and isolate regions. This also might not deal very well with the holes seen in the data, which I would like to represent as a different plt.Polygon. The solution perhaps comes from solving an area maximisation problem. For a set of points defining the data limits, what is the maximum contiguous area contained within those points To form the enclosed area, what are the neighbouring points for the nth point? How will the holes be treated in this scheme - is this erring into topology now? Apologies, much of this is me thinking out loud. I'd be grateful for some hints, suggestions or solutions. I suspect this is an oft-studied problem with many solution techniques, but I'm looking for something simple to code and quick to run... I guess everyone is, really! Cheers, David

    Read the article

  • How can I create the XML::Simple data structure using a Perl XML SAX parser?

    - by DVK
    Summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog—due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. I'm looking for an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been. I don't care much what the interface of the new module is; e.g whether I need to call next_record() or give it a callback coderef accepting a record.

    Read the article

  • ASP.NET MVC : Good Replacement for User Control?

    - by David Lively
    I found user controls to be incredibly useful when working with ASP.NET webforms. By encapsulating the code required for displaying a control with the markup, creation of reusable components was very straightforward and very, very useful. While MVC provides convenient separation of concerns, this seems to break encapsulation (ie, you can add a control without adding or using its supporting code, leading to runtime errors). Having to modify a controller every time I add a control to a view seems to me to integrate concerns, not separate them. I'd rather break the purist MVC ideology than give up the benefits of reusable, packaged controls. I need to be able to include components similar to webforms user controls throughout a site, but not for the entire site, and not at a level that belongs in a master page. These components should have their own code not just markup (to interact with the business layer), and it would be great if the page controller didn't need to know about the control. Since MVC user controls don't have codebehind, I can't see a good way to do this. Update FINALLY, a good (and, in retrospect, obvious) way to accomplish this. using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.Mvc; namespace K.ObjectModel.Controls { public class TestControl : ViewUserControl { protected override void Render(System.Web.UI.HtmlTextWriter writer) { writer.Write("Hello World"); base.Render(writer); } } } Create a new class which inherits ViewUserControl Override the .Render() method as shown above. Register the control via its associated ASCX as you would in a webForm: <%@ Register TagName="tn" TagPrefix="k" Src="~/Views/Navigation/LeftBar.ascx"%> Use the corresponding tag in whatever view or master page that you need: <k:tn runat="server"/> Make sure your .ascx inherits your new control: <%@ Control Language="C#" Inherits="K.ObjectModel.Controls.TestControl" %> Voila, you're up and running. This is tested with ASP.NET MVC 2, VS 2010 and .NET 4.0. Your custom tag references the ascx partial view, which inherits from the TestControl class. The control then overrides the Render() method, which is called to render the view, giving you complete control over the process from tag to output. Why does everyone try to make this so much harder than it has to be?

    Read the article

  • how to send put request with data as an xml element, from JavaScript ?

    - by Sarang
    Hi everyone, My data is an xml element & I want send PUT request with JavaScript. How do I do this ? For reference : Update Cell As per fredrik suggested, I did this : function submit(){ var xml = "<entry>" + "<id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id>" + "<link rel=\"edit\" type=\"application/atom+xml\"" + "href=\"https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/worksheetId/private/full/R2C1\"/>" + "<gs:cell row=\"2\" col=\"1\" inputValue=\"300\"/>" + "</entry>"; document.getElementById('submitForm').submit(xml); } </script> </head> <body> <form id="submitForm" method="put" action="https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1"> <input type="submit" value="submit" onclick="submit()"/> </form> However, it doesn't write back but positively it returns xml file like : <?xml version='1.0' encoding='UTF-8'?> <entry xmlns='http://www.w3.org/2005/Atom' xmlns:gs='http://schemas.google.com/spreadsheets/2006' xmlns:batch='http://schemas.google.com/gdata/batch'> <id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id> <updated>2011-01-11T07:35:09.767Z</updated> <category scheme='http://schemas.google.com/spreadsheets/2006' term='http://schemas.google.com/spreadsheets/2006#cell'/> <title type='text'>A2</title> <content type='text'></content> <link rel='self' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1'/> <link rel='edit' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1/1ekg'/> <gs:cell row='2' col='1' inputValue=''></gs:cell> </entry> Any further solution for the same ?

    Read the article

  • Floated DIVs not flowing properly

    - by NightMICU
    Hi everyone, I am working on a photo gallery, each thumbnail is in its own DIV and floated to the left in a containing DIV. It has been displaying properly up until vertical thumbnails entered the equation. Now, when the next row should start, the first item of the following row is to the left of the last vertical DIV (thumbnail), rather than flush to the left of the containing DIV. Here is the CSS: #galleryBox { width: 650px; background: #fff; margin: auto; padding: 10px; text-align: center; overflow: auto; } .item { display: block; margin: 10px; padding: 20px 5px 5px 5px; float: left; background: url('/images/content_bottom.png') repeat-x scroll bottom #828282; } and the HTML: <div id="galleryBox" class="ui-corner-all"> <div id="file" class="ui-corner-all"> <form name="uploadPhoto" id="uploadPhoto" method="post" action="" enctype="multipart/form-data"> <p><label for="photo">Photo:</label><input type="file" name="photo" id="photo"/></p> <p><label for="caption">Caption: <small>Optional</small></label><input type="text" id="caption" name="caption"/></p> <p align="center"><input type="submit" value="Upload" name="send" id="send" class="addButton ui-state-default ui-corner-all"/></p> </form> <a name="thumbs"></a> </div> <div class="item ui-corner-all"> <a href="http://tapp-essexvfd.org/gallery/photos/201004211802.jpg" class="lightbox" title="test1"> <img src="http://tapp-essexvfd.org/gallery/photos/thumbs/201004211802_thumb.jpg" alt="test1"/></a><br/> <p><span class="label">test1</span></p> </div> <div class="item ui-corner-all"> <a href="http://tapp-essexvfd.org/gallery/photos/201004211803.jpg" class="lightbox" title="test3"> <img src="http://tapp-essexvfd.org/gallery/photos/thumbs/201004211803_thumb.jpg" alt="test3"/></a><br/> <p><span class="label">test3</span></p> </div> </div>

    Read the article

  • How do you create a MANIFEST.MF that's available when you're testing and running from a jar in produ

    - by warvair
    I've spent far too much time trying to figure this out. This should be the simplest thing and everyone who distributes Java applications in jars must have to deal with it. I just want to know the proper way to add versioning to my Java app so that I can access the version information when I'm testing, e.g. debugging in Eclipse and running from a jar. Here's what I have in my build.xml: <target name="jar" depends = "compile"> <property name="version.num" value="1.0.0"/> <buildnumber file="build.num"/> <tstamp> <format property="TODAY" pattern="yyyy-MM-dd HH:mm:ss" /> </tstamp> <manifest file="${build}/META-INF/MANIFEST.MF"> <attribute name="Built-By" value="${user.name}" /> <attribute name="Built-Date" value="${TODAY}" /> <attribute name="Implementation-Title" value="MyApp" /> <attribute name="Implementation-Vendor" value="MyCompany" /> <attribute name="Implementation-Version" value="${version.num}-b${build.number}"/> </manifest> <jar destfile="${build}/myapp.jar" basedir="${build}" excludes="*.jar" /> </target> This creates /META-INF/MANIFEST.MF and I can read the values when I'm debugging in Eclipse thusly: public MyClass() { try { InputStream stream = getClass().getResourceAsStream("/META-INF/MANIFEST.MF"); Manifest manifest = new Manifest(stream); Attributes attributes = manifest.getMainAttributes(); String implementationTitle = attributes.getValue("Implementation-Title"); String implementationVersion = attributes.getValue("Implementation-Version"); String builtDate = attributes.getValue("Built-Date"); String builtBy = attributes.getValue("Built-By"); } catch (IOException e) { logger.error("Couldn't read manifest."); } } But, when I create the jar file, it loads the manifest of another jar (presumably the first jar loaded by the application - in my case, activation.jar). Also, the following code doesn't work either although all the proper values are in the manifest file. Package thisPackage = getClass().getPackage(); String implementationVersion = thisPackage.getImplementationVersion(); Any ideas?

    Read the article

  • button of MDImenu can't disenable in VS2008

    - by colorlee
    Hi everyone. i had just started to learn VB and VS2008 and im doing some system due to my homework. i made a WELCOME form with a timer, 5s to pass to the next form which called Select. After passed to next form, itll me.visible = false. Theres 3 buttons on the Select form which call Customer, Staff and Exit. As i had just start, the button Customer will pass to a MDI menu call Customer Menu with a menu strip button called Quotation. Same, Select will me.visible = false when done. Then a problem occured, i made a Quotation inside the Customer Menu, such as the mdiparent of Quotation is Customer. I expected that the Quotation button will disenable to press after i pressed that button. But i fail to do that. And the code below: This is the code of MDI menu Customer Menu: Public Class frmCustomer Private Sub ExitToolStripMenuItem_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles ExitToolStripMenuItem.Click End End Sub Private Sub AboutUsToolStripMenuItem_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles AboutUsToolStripMenuItem.Click Dim frm As New AboutMamatai AboutMamatai.ShowDialog() End Sub Private Sub frmCustomer_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load frmQuotation.MdiParent = Me frmQuotation.Show() frmQuotation.Dock = DockStyle.Fill Me.Location = New Point(220, 180) End Sub Private Sub QuotationToolStripMenuItem_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles QuotationToolStripMenuItem.Click frmQuotation.MdiParent = Me frmQuotation.Show() frmQuotation.Dock = DockStyle.Fill End Sub End Class This is the code of the form inside the Customer menu: Public Class frmQuotation Private Sub btnExit_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnExit.Click frmCustomer.QuotationToolStripMenuItem.Enabled = True Me.Close() End Sub Private Sub frmQuotation_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load frmCustomer.QuotationToolStripMenuItem.Enabled = False End Sub End Class When im tryin to solve this problem, i found that the problem may cause of the me.visible = false of the Select form and Welcome form. Becoz when i set the Customer Menu be the first form to run. The problem is not exist. Is there anyone can help me ? P.S. I guess if the other two forms code is needed so i post them also This is the code of WELCOME form : Public Class frmWELCOME Private Sub frmWELCOME_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load Me.Location = New Point(270, 210) Timer1.Enabled = True End Sub Private Sub Timer1_Tick(ByVal sender As Object, ByVal e As System.EventArgs) Handles Timer1.Tick Timer1.Enabled = False Dim frm As New frmSelect frm.Show() Me.Visible = False End Sub Private Sub btnSkip_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnSkip.Click Timer1.Enabled = False Dim frm As New frmSelect frm.Show() Me.Visible = False End Sub End Class This is the code of Select Form: Public Class frmSelect Private Sub btnCustomer_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnCustomer.Click Dim frm As New frmCustomer frm.Show() Me.Visible = False End Sub Private Sub btnStaff_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnStaff.Click Dim frm As New frmStaff frm.Show() Me.Visible = False End Sub Private Sub btnExit_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnExit.Click End End Sub Private Sub frmSelect_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load Me.Location = New Point(390, 250) End Sub End Class

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Rails send mail with GMail

    - by Danny McClelland
    Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Google Code + SVN or GitHub + Git

    - by Nazgulled
    Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

    Read the article

  • how to animate 2 surfaces in Matlab?

    - by Kate
    Hi everyone, I've written this code which makes an animation of 2 ellipsoids. Parameter k1 of these ellipsoids must depend on time (so they'd move asynchronously), but I need to animate them in one figure. Can I use loop for it or is it better to use timer & some kind of callback functions? The second problem - I need to move inner ellipsoid so they would have one common side. How can I do this? a=5; b=a; c=10; u = (0:0.05*pi:2*pi)'; v = [0:0.05*pi:2*pi]; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; % cut upper V1=4/3*pi*a*b*c; d=1/2; e=2^d; a2=a/e; b2=a/e; c2=c; V2=4/3*pi*a2*b2*c2; X2 = a2*sin(u)*cos(v);%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; % cut h=1/3; for j = 1:20 k1=(sin(pi*j/20)+0.5)^h; a=a*k1; c=c*k1; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; a2=a2*k1; b2=a2*k1; c2=c2*k1; X2 = a2*sin(u)*cos(v)+5;%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; hS1=surf(X,Y,Z); alpha(.11) hold on hS2=surf(X2,Y2,Z2); hold off axis([-20 20 -20 20 -20 20]); F(j) = getframe; end movie(F,4)

    Read the article

  • output with "Private`" Content in Mathematica Package

    - by madalina
    Hello everyone, I am trying to solve the following implementation problem in Mathematica 7.0 for some days now and I do not understand exactly what is happening so I hope someone can give me some hints. I have 3 functions that I implemented in Mathematica in a source file with extension *.nb. They are working okay to all the examples. Now I want to put these functions into 3 different packages. So I created three different packages with extension .*m in which I put all the desired Mathematica function. An example in the "stereographic.m" package which contain the code: BeginPackage["stereographic`"] stereographic::usage="The package stereographic...." formEqs::usage="The function formEqs[complexBivPolyEqn..." makePoly::usage="The function makePoly[algebraicEqn] ..." getFixPolys::usage="The function..." milnorFibration::usage="The function..." Begin["Private`"] Share[]; formEqs[complex_,{m_,n_}]:=Block[{complexnew,complexnew1, realeq, imageq, expreal, expimag, polyrealF, polyimagF,s,t,u,v,a,b,c,epsilon,x,y,z}, complexnew:=complex/.{m->s+I*t,n->u+I*v}; complexnew1:=complexnew/.{s->(2 a epsilon)/(1+a^2+b^2+c^2),t->(2 b epsilon)/(1+a^2+b^2+c^2),u->(2 c epsilon)/(1+a^2+b^2+c^2),v->(- epsilon+a^2 epsilon+b^2 epsilon+c^2 epsilon)/(1+a^2+b^2+c^2)}; realeq:=ComplexExpand[Re[complexnew1]]; imageq:=ComplexExpand[Im[complexnew1]]; expreal:=makePoly[realeq]; expimag:=makePoly[imageq]; polyrealF:=expreal/.{a->x,b->y,c->z}; polyimagF:=expimag/.{a->x,b->y,c->z}; {polyrealF,polyimagF} ] End[] EndPackage[] Now to test the function I load the package Needs["stereographic`"] everything is okay. But when I test the function for example with formEqs[x^2-y^2,{x,y}] I get the following ouput: {Private`epsilon^2 + 2 Private`x^2 Private`epsilon^2 + Private`x^4 Private`epsilon^2 - 6 Private`y^2 Private`epsilon^2 + 2 Private`x^2 Private`y^2 Private`epsilon^2 + Private`y^4 Private`epsilon^2 - 6 Private`z^2 Private`epsilon^2 + 2 Private`x^2 Private`z^2 Private`epsilon^2 + 2 Private`y^2 Private`z^2 Private`epsilon^2 + Private`z^4 Private`epsilon^2, 8 Private`x Private`y Private`epsilon^2 + 4 Private`z Private`epsilon^2 - 4 Private`x^2 Private`z Private`epsilon^2 - 4 Private`y^2 Private`z Private`epsilon^2 - 4 Private`z^3 Private`epsilon^2} Of course I do not understand why Private` appears in front of any local variable which I returned in the final result. I would want not to have this Private` in the computed output. Any idea or better explanations which could indicate me why this happens? Thank you very much for your help. Best wishes, madalina

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • PHP - error when insert date into MySQL

    - by Michael Mao
    Hello everyone: I've got a typical problem when trying to insert a date into MySQL. The column defined in MySQL is of type DATE. My PHP version is 5.3.0 Apart from this date-related issue, the rest of my code works just fine. And this is my PHP script to do this: $tablename = BOOKS_TABLE; $insert = mysql_query("INSERT INTO $tablename (barcode, book_name, volume_num,". " author, publisher, item_type, buy_price, buy_date) VALUES ". "(". "'" . $barcode . "', ". "'" . $bookname . "', ". "'" . $volumenum . "', ". "'" . $author . "', ". "'" . $publisher . "', ". "'" . $itemtype . "', ". "'" . $buyprice . "', ". "'" . getMySQLDateString($buydate). //"'STR_TO_DATE('".$buydate ."', '%d/%m/%Y'))'". //nothing changes in MySQL ")"); And this is the faulty function : function getMySQLDateString($buydate) //typical buydate : 04/21/2009 { $mysqlDateString = date('Y-m-d H:i:s', $strtotime($buydate)); return $mysqlDateString; } The first commented out line wouldn't do anything, the script is executed with no error, however, there is nothing changed in datebase after this. The current approach will cause a Fatal error saying function name must be a string in this line. Actually I followed this thread on SO, but just cannot pass the date into MySQL... Can anyone help me figure out which part is not right? How would you do it, in this case, to get it right? Sorry about such a journeyman-like question, thanks a lot in advance.

    Read the article

  • buttons inside scrollviewer problem

    - by Miroslav Valchev
    Hello, everyone. I couldn't find a solution to my problem eventhough I believe that others have come across this too. Basically, there are like twenty buttons in a wrap panel, which is inside a scrollviewer. The problem is that when I want to scroll the list, the click event fires the triggers. Really would appreciate help on this one. <ScrollViewer> <ScrollViewer.Content> <toolkit:WrapPanel Orientation="Horizontal" HorizontalAlignment="Left" VerticalAlignment="Top" Width="420"> <Button Style="{StaticResource imageButtonStyle}" > <i:Interaction.Triggers> <i:EventTrigger EventName="Click"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="1" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> <Button Style="{StaticResource imageButtonStyle}"> <i:Interaction.Triggers> <i:EventTrigger EventName="Click"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="2" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> <Button Style="{StaticResource imageButtonStyle}"> <i:Interaction.Triggers> <i:EventTrigger EventName="MouseEnter"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="3" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> <Button Style="{StaticResource imageButtonStyle}"> <i:Interaction.Triggers> <i:EventTrigger EventName="MouseEnter"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="4" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> </toolkit:WrapPanel> </ScrollViewer.Content>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • how to facebook shoutbox open , with clicked friendname

    - by Surendra Singh
    Hey everyone i need source code for shotbox open with clicked friend name like facebook i tried it but ... it is opening with only one friend name .... i want it will open with the name of friend whom name or image is clicked My code is something like this <tr data-name="<?php echo $online_user_name; ?>"> <td> <div <?php echo $online_user_id; ?>"> <img src="../../social_users/<?php echo $online_user_gender; ?>/<?php echo $online_user_Email; ?>/Profile/<?php echo $online_user_pic; ?>" height="30" width="30" style="border-radius: 20px; border: 2px solid #fff;" onclick="shoutbox_open();"> </div> </td> <td style="color:#ffffff;"> <div <?php echo $online_user_id; ?> style="text-transform:capitalize; text-decoration:none; color:#6A7480;" onclick="shoutbox_open();"> <?php echo $online_user_name; ?> </div> &nbsp; </td> <td> <img src="background_file/background_icons/online_symbol.png" /> </td> </tr> <div id="shout_box"> <div id="header" > <span> <?php echo $online_user_name; ?> </span> <div id="close_btn" onclick="shoutbox_close();"> &nbsp; </div> </div> <div id="toggle_chat"> <div id="message_box"> </div> <div id="user_info"> <input name="shout_username" id="shout_username" type="text" placeholder="Your Name" value="" maxlength="15" /> <input name="shout_message" id="shout_message" type="text" placeholder="Type Message Hit Enter" maxlength="100" /> </div> </div> </div>

    Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >