Search Results

Search found 21524 results on 861 pages for 'multiple matches'.

Page 249/861 | < Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >

  • how to combine multiple setup files into one big setup file?

    - by Black
    I am looking for a FREEWARE which combine multiple setup to one setup file so that when i install one setup file. it'll install all the setup file one by one. && no need to watch over it, till it install each & every programs inside it. Basically the purpose is whenever the OS is reinstalled, every time have to install each programs one by one & have to sit there until all are finished installed. There are some online programs which i do not want. Anybody has idea?? I am using windows 7 ultimate.

    Read the article

  • Easy way to reload multiple applications under a single IIS Website after AppPool Recycle?

    - by MadBurn
    I'm not sure where to begin or even if my thinking is in the right direction. Hopefully someone here can tell me what to do or at least give me a direction to start travelling. I work on a Intranet Website, that contains multiple MVC3 and Coldfusion Applications. I have set the AppPool to Recycle every morning at 2:00 AM. Now, I would like to create a Scheduled Task to reload every application contained under that IIS Website so that when the first user comes in in the morning, they don't have to wait 30 seconds to 2minutes for their application to be reloaded into the IIS AppPool. Is there an easy to to do this? As I see it my only options are: Writing a bash script, inserting each website manually to load Writing a program that would try to find every application and load them Now, if there those are my only options, is there possibly a .NET Library I can tap into that would allow me to easily find the MVC3 Applications under IIS?

    Read the article

  • When USB keyboard is plugged in on computer start-up, search results window is being opened multiple times

    - by Dvir Azulay
    As the title says - when my Alienware keyboard is plugged into my laptop during Windows 7 resume from sleep/hibernation, the windows search results and help window (F3, F1 on Windows 7) is being opened multiple times. This behavior won't stop until I pull out one of the two USB connectors this keyboard has. When I plug it back, everything is normal. Also, if I only connect one of the two during Windows resume, it won't happen. Do you have any idea what could cause this weird issue? Edit: Following the feedback on comments suggesting to log my keypress'es during the weird behavior, I've noticed it's actually F1, F2, F3 being spammed in an ordered sequence. Clicking on them manually didn't stop them from repeating.

    Read the article

  • How to rename multiple files by replacing word in file name geting from the shell script variables?

    - by fy6877
    This question like this thread. How to rename multiple files by replacing word in file name? My example is more complex than the above topic. The two variables are $name and $ newname getting from the shell script other location. $name and $ newname may have the unicode words or special symbles like []<?...etc,so could anyone help me to provide a method to add a part of script in shell scrit to solve file name replacing question. BTW,I try to type two kind of commands to change the part of file name, but it can't work. rename.ul '$name' '$newname' /home/fy6877/test/final/* ls /home/fy6877/test/final/|xargs -I$ rename.ul '$name' '$newname' $

    Read the article

  • What methods are there to configure puppet to serve resources for multiple environments?

    - by cclark
    I seem to come across two ways for using puppet in multiple environments: 1) Install a puppetmaster in each environment and only update the recipes from source control for that environment when ready to deploy the recipes in that environment. 2) Use one puppetmaster and use a variable in the puppet.conf of each client to specify the environment and then in the puppetmaster specify a different modulepath for each environment and each of those paths is updated to the branch of the recipe repository intended for that environment (e.g. dev, staging, production). Only running one puppetmaster seems like it is one less piece of infrastructure to keep running but there is some additional complexity in the configuration. Are there additional pros or cons to one of these methods or something which I'm missing entirely?

    Read the article

  • How do I populate multiple records of data into a PDF form like a mail-merge?

    - by user38801
    I have Acrobat Pro, and I have a PDF with a form on it. Assuming the fields in the form correspond to a data source (like rows in an RDBMS table or xml file), I want to then print multiple copies of the PDF file, with each copy having the values of a different row in the data source. It is preferable to directly interface with an actual database, rather than having to save an XML file every time I do this. If this involves programming that's cool too, I only posted here because the question didn't seem appropriate for StackOverflow. Thanks!

    Read the article

  • Copy/Pasting data from SQL Server to Excel splits up text into multiple columns?

    - by Paul
    I've got a problem pasting data from the result grid of SQL Server 2005 to an excel 2007 spreadsheet. I have a query in SQL Server that returns 2 columns (a number column and a text column) On one computer here i can happily copy (right-click copy) and then just right-click and paste into an excel spreadsheet. no problem. On another computer here when i try and paste into excel it splits the text column up and pastes the text into multiple columns based on spaces between words. For example if one of the rows has... Paste me please ...in it then when pasting into excel it splits the text and pastes each work into a seperate column within excel. We've tried comparing options in both SQL Server & excel with the computer it works fine on but can see no differences. Any ideas welcome Thanks

    Read the article

  • An international mobile app - Should I set up EC2 instances in multiple regions?

    - by ashiina
    I am currently trying to launch an mobile app for users around the world. It is not a spectacular launch which will get millions of users in weeks - just another individual developer releasing an app. I know enough about the techniques of managing timezones, internationalizing string, and what not ( the application layer ). But I cannot find any information on how I should manage my EC2 instances... Should I be setting up EC2 instances in different regions around the world? Is that a must-do, or is it an overkill? I'm aware that it's the ideal solution in terms of performance, but it becomes very tough managing servers in multiple regions. DB issues, AMI management, etc... I'd much rather NOT do so. So I would like to know the general best practice when launching an international app/website. Note: For static contents, I know it's better to use a CDN, so I'm planning on doing so.

    Read the article

  • How should a small team using multiple OS's deploy over github?

    - by Toby
    We have a small development team that have recently moved to using github to host our projects. The team consists of three developers, 2 on Windows and 1 on Mac. I am currently researching the best way to deploy applications to our Linux servers (dev and production). Capistrano running locally would be ideal but from what I read this won't work for Windows machines. It looks like the best way is to use a post-receive hook in github, I can see how this would work for auto deploying to dev, but I don't see how we could then deploy to live. I have found paid projects like http://www.deployhq.com/ but it feels like something that a quick bit of code should be able to do for free, I just can't seem to get myself pointed in the right direction! I was wondering what would be considered best practice for small team deployment involving multiple local OS's and github.

    Read the article

  • How can I modify the BAT file in this post so it will randomly select 1 background contained in a folder containing multiple backgrounds?

    - by Radical924
    Is there a way to modify the bat file from this post here: How do I set the desktop background on Windows from a script? so that it will randomly select 1 background image from a folder containing multiple images??? AND I would also like the background to randomly change to one of the backgrounds randomly contained in the same folder. If this is possible how would I modify the bat file below??? @echo off reg add "hkcu\control panel\desktop" /v wallpaper /t REG_SZ /d "" /f reg add "hkcu\control panel\desktop" /v wallpaper /t REG_SZ /d "C:\[LOCATION OF WALLPAPER HERE]" /f reg delete "hkcu\Software\Microsoft\Internet Explorer\Desktop\General" /v WallpaperStyle /f reg add "hkcu\control panel\desktop" /v WallpaperStyle /t REG_SZ /d 2 /f RUNDLL32.EXE user32.dll,UpdatePerUserSystemParameters exit Also I noticed that this bat file won't work usually (9 times out of 10)... I receive an "ERROR: The system was unable to find the specified registry key or value." I have Windows 7 64-BIT Home Premium Service Pack 1

    Read the article

  • In Sublime Text 2, how can I indent out to a straight column with multiple cursors on a ragged edge?

    - by mtoast
    Suppose I've got multiple cursors along several lines, like this: foo| barr| foobar| baz| How can I automatically push the whitespace at the end of each line out to a flat edge, like this?: foo | barr | foobar | baz | (In these examples, | is supposed to be my cursor.) EDIT #1 When you just Tab or Space from the initial arrangement, you get this: # Useful, but not what I'm looking for foo | barr | foobar | baz | That's useful, but not what I'm looking for. I'm looking for some kind of keyboard shortcut that will let me indent from a ragged multi-cursor insert out to a straight column.

    Read the article

  • How to clean a computer with multiple accounts infected with spyware, viruses? [closed]

    - by DjKilla
    Possible Duplicate: What to do if my computer is infected by a virus or a malware? What's the best way to clean a computer with multiple accounts infected with spyware, viruses and malware? Should you install and run software to remove the infections on each account? If you install the software on one account, will it clean the entire computer including each account? For example, some programs like CCleaner will install only on one account and not offer the option for all users (accounts). Does this mean the program will clean the entire computer including other accounts or do I have to install CCleaner on each account to clean up each user's account?

    Read the article

  • CSS file not served by IIS 7.5 after multiple clear cache refreshes in a row in browser

    - by KenB
    We are experiencing an interesting issue with IIS 7.5 static caching and a css file. When we use IE to hit the page in question everything works fine - 200 OK on css file. When we refresh the page it works fine - 304 Not Modified on css file. When I refresh again with control key it reloads fine - 200 OK on css file. Now if I do a control key + refresh multiple times in a row really fast the css fails to load and in the developer tools network it says "Loading..." for the css file and it hangs never coming back. Any ideas?

    Read the article

  • IIS7 - multiple ports for websites, some working, some not.

    - by glasnt
    I have multiple IIS7 websites hanging off 1 IP, using different ports. All three sites use Z.A.B.C:XX, where XX is {100, 200, 300} * There's no web.config settings not making :300 not work, the bindings are set ok. I can even change the ports so 200 becomes 300, but the original 300 still doesn't work. They are all shown by IP, so it's not DNS. There's no SSL setting differences between them. I can't see anything in metabase.xml that would make one behave differently to another. Are there any other settings in IIS7 that I might not be finding, that would fix the issue? * not the real values.

    Read the article

  • How do I define multiple urls for svn project?

    - by yarun can
    I am working on a project in mixed environment (win, cygwin, linux) which is on a "shared ntfs drive". I am the sole user there for this project is not really duplicated for multiple users. The main issue I am facing is that the original svn project import was done with a cygwin path like "/cygdrive/z/path to svn project". Now when I am on win svn or linux svn this does not work with svn since such paths do not exists for those versions. Is there a way to define more than one path for the svn import, like maybe some kind of configuration that i can use to fire on the command line? thanks

    Read the article

  • one email have multiple open id , unable to retrive specific open id password?

    - by superUser
    I have multiple OPENID accouts refrencing same email address, now i forget one of my accout's password. and when i tried to recover my password then only one openid accout link sent to my mail address whereas i need another openid password reset link what i have to do?? although i m able to login through gmail, but i want to login through openid. i have mailed already? but no satisfactory answer?? how do i collect all open ID password reset link referencing same email address??

    Read the article

  • What function should I use in Excel for searching a (multiple) text string?

    - by Alenanno
    The title is a bit unclear, but I'll be explaining it now for better clarity. I have this: When I type in the Input field, I'd like Excel to show me the result in the Output field. For example, if I write Four, I'd like it to output 20, or if I write one of the other three words, then 12. The problem is that... I can't make it to work. The formula I tried is "=CERCA(C2;G:G;H:H)" (cerca means search), so I'm saying "Take what I write in the cell C2, search through the column G and give me what you find from the column H", but the result is always N.D. (Not available). I've tried other combinations and: Text strings, does not work; Single numbers, works (if I search 1, it says 2, which is what I expect); multiple numbers, does not work (if I search 4, nothing happens). What function should I use?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • How come the ls command prints in multiple columns on tty but only one column everywhere else?

    - by David Lou
    Even after using Unix-like OSes for a couple years, this behaviour still baffles me. When I use the ls command in a directory that has lots of files, the output is usually nicely formatted into multiple columns. Here's an example: $ ls a.txt C.txt f.txt H.txt k.txt M.txt p.txt R.txt u.txt W.txt z.txt A.txt d.txt F.txt i.txt K.txt n.txt P.txt s.txt U.txt x.txt Z.txt b.txt D.txt g.txt I.txt l.txt N.txt q.txt S.txt v.txt X.txt B.txt e.txt G.txt j.txt L.txt o.txt Q.txt t.txt V.txt y.txt c.txt E.txt h.txt J.txt m.txt O.txt r.txt T.txt w.txt Y.txt However, if I try to redirect the output to a file, or pipe it to another command, only a single column appears in the output. Using the same example directory as above, here's what I get when I pipe ls to wc: $ ls | wc 52 52 312 In other words, wc thinks there are 52 lines, even though the output to the terminal has only 5. I haven't observed this behaviour in any other command. Would you like to explain this to me?

    Read the article

  • How do I use .htaccess conditional redirects for multiple domains?

    - by John
    I'm managing about 15 or so domains for a particular promotion. Each domain has specific redirects in place, as shown below. Rather than make 15 different .htaccess files that I would later have to manage separately, I'd like to use a single .htaccess file and use a symbolic link into each website's directory. The trouble is that, I can't figure out how to make the rules apply only for a specific domain. Every time I visit www.redirectsite2.com, it sends me to www.targetsite.com/search.html?state=PA&id=75, when it should instead be sending me to www.targetsite.com/search.html?state=NJ&id=68. How exactly do I make multiple RewriteRules apply for a given domain and only that domain? Is this even possible to do within a single .htaccess file? Options +FollowSymlinks # redirectsite1.com RewriteEngine On RewriteBase / # start processing rules for www.redirectsite1.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite1\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,L] RewriteRule ^PGN$ http://targetsite.com/search.html?state=PA&id=26 [QSA,R,NC,L] RewriteRule ^NS$ http://targetsite.com/search.html?state=PA&id=27 [QSA,R,NC,L] RewriteRule ^INQ$ http://targetsite.com/search.html?state=PA&id=28 [QSA,R,NC,L] RewriteRule ^AA$ http://targetsite.com/search.html?state=PA&id=29 [QSA,R,NC,L] RewriteRule ^PI$ http://targetsite.com/search.html?state=PA&id=30 [QSA,R,NC,L] RewriteRule ^GV$ http://targetsite.com/search.html?state=PA&id=31 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,NC,L] # end processing rules for www.redirectsite1.com # begin rules for redirectsite2.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite2\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,L] RewriteRule ^SL$ http://targetsite.com/search.html?state=NJ&id=6 [QSA,R,NC,L] RewriteRule ^APP$ http://targetsite.com/search.html?state=NJ&id=8 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,NC,L] Thanks for any help you may be able to provide!

    Read the article

  • What is the correct iptables rule when NATing multiple private subnets?

    - by Jose Mendez
    I have a Centos minimal 6.5 acting as a router. eth0 is connected to a Cisco switch trunk port, allowing VLANs 200-213. I have several VLAN interfaces just as this link suggests: https://access.redhat.com/documentation/en-US/Red_Hat_Enterprise_Linux/6/html/Deployment_Guide/s2-networkscripts-interfaces_802.1q-vlan-tagging.html And have IPv4 forwarding, so all my network devices from any of the networks 200-213 can communicate with each other using this linux box as their router. Problem is, I need them to access the Internet, so I added the following rule: iptables -t nat -A POSTROUTING -s 192.168.0.0/16 -j SNAT --to 1.1.1.56 1.1.1.56 is the "outside" address. This works fine, devices connected to the internal networks can ping Intertnet addresses BUT, they stop being able to talk to each other across subnets, so 192.168.211.55 can ping 8.8.8.8, but can't talk to 192.168.213.5. As soon as I do a service iptables restart to remove the rule, I can start talking across internal subnets again. What would be the correct way to set up NAT for multiple private subnets? Or maybe the correct way to set up forwarding?

    Read the article

  • How do I apply multiple subnets to a server with one NIC?

    - by Cosban
    I am trying to route multiple IPs through one physical NIC on my dedicated server for use with Proxmox KVM VMs. I have a dedicated server which is currently running Debian 4.4.5-8 with 3 available ip addresses for use, which will be displayed as 176.xxx.xxx.196 (main), 176.xxx.xxx.198 (on same subnet as main) and 5.xxx.xxx.166 (different subnet). I am currently trying to route the third IP address with the dedi for use with a vps that I have set up using proxmox v2.x but am having a really, really hard time doing so. Virtual interfaces binding the additional IP addresses work as expected, ruling out external routing problems. The provider has given the following information for the IP addresses on the main subnet: gateway: 176.xxx.xxx.193 netmask: 255.255.255.224 broadcast: 176.xxx.xxx.223 As well as the following information for the IP address on the second subnet: gateway: 5.xxx.xxx.161 netmask: 255.255.255.248 broadcast: 5.xxx.xxx.167 Everything I've tried with /etc/network/interfaces has either not worked, or has rendered the network completely useless. This is the current state of the file, which has the secondary IP address working on the same subnet as well as IPv6 working, but not the second subnet. # Nativen IPv6 Schnittstelle iface eth0 inet6 manual # Bridge IPv4 Schnittstelle (176.xxx.xxx.193/27) auto vmbr0 iface vmbr0 inet static address 176.xxx.xxx.196 netmask 255.255.255.224 gateway 176.xxx.xxx.193 broadcast 176.xxx.xxx.223 bridge_ports eth0 bridge_stp off bridge_fd 0 bridge_maxwait 0 post-up ip addr add 176.xxx.xxx.198/27 dev vmbr0 auto vmbr1 iface vmbr1 inet static address 5.xxx.xxx.166 netmask 255.255.255.248 gateway 5.xxx.xxx.161 broadcast 5.xxx.xxx.167 bridge_ports eth0 bridge_stp off bridge_fd 0 bridge_maxwait 0 post-up ip addr add 5.xxx.xxx.166/27 dev vmbr1 # Bridge IPv6 Schnittstelle (Reichweite: xxxx:xxxx:xxxx:xxxx:xxxx:xxxx::/64) iface vmbr0 inet6 static address xxxx:xxxx:xxxx:xxxx:xxxx:xxxx netmask 64 up ip -6 route add xxxx:xxxx:xxxx:xxxx:xxxx:xxxx dev vmbr0 down ip -6 route del xxxx:xxxx:xxxx:xxxx:xxxx:xxxx dev vmbr0 up ip -6 route add default via xxxx:xxxx:xxxx:xxxx:xxxx:xxxx dev vmbr0 down ip -6 route del default via xxxx:xxxx:xxxx:xxxx:xxxx:xxxx dev vmbr0

    Read the article

  • How can I "share" a network share over the internet to multiple operating systems?

    - by Minsc
    Hello all, We have a network share accessible through our intranet that is widely used. This share has it's own set of fine tuned permissions. I have been tasked with allowing A.D. authenticated access to this share over the internet without the use of VPN. The internet access has to mimic the NTSF permissions in place on the share. Another piece of the puzzle is that the access over the internet has to allow perusal of the share from Windows and Mac OS systems. I had envisioned a web front end that would facilitate downloading to and uploading from the share via a web browser. I'm trying to ask for some suggestions about what type of setup is necessary to achieve this. I've done loads of testing and searching for solutions but I can't seem to get anything to work as I hope. The web server that will be handing all of this is a Windows 2K8 box with IIS 7. How can I allow the users to authenticate against Active Directory when coming from the internet even when coming from a Mac system? I hope my question is not too broad, I'm sorry if I should have broken it up into multiple questions. It all is just tied together in my head. Thank you all for your time and aid.

    Read the article

  • Prevent zsh from trying to expand everything

    - by Attila O.
    Recently switched from bash, I noticed that zsh will try to expand every command or argument that looks like it has wildcards in it. So the following lines won't work any more: git diff master{,^^} zsh: no matches found: master^^ scp remote:~/*.txt . zsh: no matches found: remote:~/*.txt The only way to make the above commands work is to quote the arguments, which is quite annoying. Q: How do I configure zsh to still try to expand wildcards, but if there are no matches, just pass on the argument as-is? EDIT: Possibly related: scp with zsh : no matches found

    Read the article

< Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >