Search Results

Search found 36658 results on 1467 pages for 'line length'.

Page 269/1467 | < Previous Page | 265 266 267 268 269 270 271 272 273 274 275 276  | Next Page >

  • WCF service errors after installing WindowsXP updates

    - by niao
    Greeting, today before I start working on my application I updated my WinXP. After all updates have been installed my WCF service stop working. There is a following error when I try to open service.svc file in the browser: Configuration Error Description: An error occurred during the processing of a configuration file required to service this request. Please review the specific error details below and modify your configuration file appropriately. Parser Error Message: An error occurred creating the configuration section handler for system.serviceModel/bindings: Could not load type 'System.Security.Authentication.ExtendedProtection.Configuration.ExtendedProtectionPolicyElement' from assembly 'System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. Source Error: Line 131: </behaviors> Line 132: Line 133: <bindings> Line 134: <wsHttpBinding> Line 135: <binding name="MyWSHttpBinding" maxReceivedMessageSize="2147483647"> The colleague of my tried to run the same service before update and it works fine. He has the same problem after installing updates. Can someone please help me?

    Read the article

  • WPF Dockable Windows Like iGoogle

    - by Anon
    I'm looking for a dockable windows/panel control in the style of iGoogle. All of the ones I have found so far all have a fixed length on the height of your window/panel but I want to be able to have windows of varying length like iGoogle. The best I have found so far has been a control libarary called BlackLight which does not have the feature explained above.

    Read the article

  • Lost connection to MySQL server during query

    - by Otavio
    I have a huge table and I need to process all rows in it. I'm always getting this Lost connection message and I'm not able to reconnect and restore the cursor to the last position it was. This is basically the code I have here: # import MySQLdb class DB: conn = None def connect(self): self.conn = MySQLdb.connect('hostname', 'user', '*****', 'some_table', cursorclass=MySQLdb.cursors.SSCursor) def query(self, sql): try: cursor = self.conn.cursor() cursor.execute(sql) except (AttributeError, MySQLdb.OperationalError): self.connect() cursor = self.conn.cursor() cursor.execute(sql) return cursor # # db = DB() sql = "SELECT bla FROM foo" data = db.query(sql) for row in data: do_something(row) # But I'm always getting this: # Traceback (most recent call last): File "teste.py", line 124, in <module> run() File "teste.py", line 109, in run for row in data: File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 417, in next row = self.fetchone() File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 388, in fetchone r = self._fetch_row(1) File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 285, in _fetch_row return self._result.fetch_row(size, self._fetch_type) _mysql_exceptions.OperationalError: (2013, 'Lost connection to MySQL server during query') Exception _mysql_exceptions.OperationalError: (2013, 'Lost connection to MySQL server during query') in <bound method SSCursor.__del__ of <MySQLdb.cursors.SSCursor object at 0x7f7e3c8da410>> ignored # Do you have any idea?

    Read the article

  • pyscripter Rpyc error

    - by jf328
    pyscripter 2.5.3.0 x64, python 2.7.7 anaconda 2.0.1, windows 7 I was using pyscripter and EPD python happily in 32 bit, no problem. Just changed to 64 bit anaconda version and re-installed everything but now pyscripter cannot import rpyc -- it runs with internal engine (no anaconda), but no such error in pure python. Thanks very much! btw, there is a similar SO post few years ago, but the answer there does not work. *** Python 2.7.3 (default, Apr 10 2012, 23:24:47) [MSC v.1500 64 bit (AMD64)] on win32. *** Internal Python engine is active *** *** Internal Python engine is active *** >>> import rpyc Traceback (most recent call last): File "<interactive input>", line 1, in <module> File "C:\Anaconda\lib\site-packages\rpyc\__init__.py", line 44, in <module> from rpyc.core import (SocketStream, TunneledSocketStream, PipeStream, Channel, File "C:\Anaconda\lib\site-packages\rpyc\core\__init__.py", line 1, in <module> from rpyc.core.stream import SocketStream, TunneledSocketStream, PipeStream File "C:\Anaconda\lib\site-packages\rpyc\core\stream.py", line 7, in <module> import socket File "C:\Anaconda\Lib\socket.py", line 47, in <module> import _socket ImportError: DLL load failed: The specified procedure could not be found. >>> C:\research>python Python 2.7.7 |Anaconda 2.0.1 (64-bit)| (default, Jun 11 2014, 10:40:02) [MSC v.1500 64bit (AMD64)] on win32 Type "help", "copyright", "credits" or "license" for more information. Anaconda is brought to you by Continuum Analytics. Please check out: http://continuum.io/thanks and https://binstar.org >>> import rpyc >>>

    Read the article

  • c# asp.net How to return a usercontrol from a handeler ashx?

    - by Justin808
    I want to return the HTML output of the control from a handler. My code looks like this: <%@ WebHandler Language="C#" Class="PopupCalendar" % using System; using System.IO; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; public class PopupCalendar : IHttpHandler { public void ProcessRequest (HttpContext context) { context.Response.ContentType = "text/plain"; System.Web.UI.Page page = new System.Web.UI.Page(); UserControl ctrl = (UserControl)page.LoadControl("~/Controls/CalendarMonthView.ascx"); page.Form.Controls.Add(ctrl); StringWriter stringWriter = new StringWriter(); HtmlTextWriter tw = new HtmlTextWriter(stringWriter); ctrl.RenderControl(tw); context.Response.Write(stringWriter.ToString()); } public bool IsReusable { get { return false; } } } I'm getting the error: Server Error in '/CMS' Application. Object reference not set to an instance of an object. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.NullReferenceException: Object reference not set to an instance of an object. Source Error: Line 14: System.Web.UI.Page page = new System.Web.UI.Page(); Line 15: UserControl ctrl = (UserControl)page.LoadControl("~/Controls/CalendarMonthView.ascx"); Line 16: page.Form.Controls.Add(ctrl); Line 17: Line 18: StringWriter stringWriter = new StringWriter(); How can I return the output of a Usercontrol via a handler?

    Read the article

  • Jython 2.5.1: "ImportError: No Module named os"

    - by Leonidas
    I looked through the other posts and bug reports and couldn't figure out what's causing this. I'm using Jython 2.5.1, in a Java project in Eclipse (Ubuntu 8.10). It has been added to the project as a standalone .jar file (I just replaced the old Jython 2.1 jar with this one). I'm running a script that uses the threading.py class. At some point the statement "import os" is evaluated from linecache.py and I get this error, which I can't seem to figure out how to fix: 'Execution failed. Traceback (most recent call last): File "<string>", line 1, in <module> File "../lib/python/threading.py", line 6, in <module> import traceback File "../lib/python/traceback.py", line 3, in <module> import linecache File "../lib/python/linecache.py", line 9, in <module> import os ImportError: No module named os'

    Read the article

  • Python Ctypes Read/WriteProcessMemory() - Error 5/998 Help!

    - by user299805
    Please don't get scared but the following code, if you are familiar with ctypes or C it should be easy to read. I have been trying to get my ReadProcessMemory() and WriteProcessMemory() functions to be working for so long and have tried almost every possibility but the right one. It launches the target program, returns its PID and handle just fine. But I always get a error code of 5 - ERROR_ACCESS_DENIED. When I run the read function(forget the write for now). I am launching this program as what I believe to be a CHILD process with PROCESS_ALL_ACCESS or CREATE_PRESERVE_CODE_AUTHZ_LEVEL. I have also tried PROCESS_ALL_ACCESS and PROCESS_VM_READ when I open the handle. I can also say that it is a valid memory location because I can find it on the running program with CheatEngine. As for VirtualQuery() I get an error code of 998 - ERROR_NOACCESS which further confirms my suspicion of it being some security/privilege problem. Any help or ideas would be very appreciated, again, it's my whole program so far, don't let it scare you =P. from ctypes import * from ctypes.wintypes import BOOL import binascii BYTE = c_ubyte WORD = c_ushort DWORD = c_ulong LPBYTE = POINTER(c_ubyte) LPTSTR = POINTER(c_char) HANDLE = c_void_p PVOID = c_void_p LPVOID = c_void_p UNIT_PTR = c_ulong SIZE_T = c_ulong class STARTUPINFO(Structure): _fields_ = [("cb", DWORD), ("lpReserved", LPTSTR), ("lpDesktop", LPTSTR), ("lpTitle", LPTSTR), ("dwX", DWORD), ("dwY", DWORD), ("dwXSize", DWORD), ("dwYSize", DWORD), ("dwXCountChars", DWORD), ("dwYCountChars", DWORD), ("dwFillAttribute",DWORD), ("dwFlags", DWORD), ("wShowWindow", WORD), ("cbReserved2", WORD), ("lpReserved2", LPBYTE), ("hStdInput", HANDLE), ("hStdOutput", HANDLE), ("hStdError", HANDLE),] class PROCESS_INFORMATION(Structure): _fields_ = [("hProcess", HANDLE), ("hThread", HANDLE), ("dwProcessId", DWORD), ("dwThreadId", DWORD),] class MEMORY_BASIC_INFORMATION(Structure): _fields_ = [("BaseAddress", PVOID), ("AllocationBase", PVOID), ("AllocationProtect", DWORD), ("RegionSize", SIZE_T), ("State", DWORD), ("Protect", DWORD), ("Type", DWORD),] class SECURITY_ATTRIBUTES(Structure): _fields_ = [("Length", DWORD), ("SecDescriptor", LPVOID), ("InheritHandle", BOOL)] class Main(): def __init__(self): self.h_process = None self.pid = None def launch(self, path_to_exe): CREATE_NEW_CONSOLE = 0x00000010 CREATE_PRESERVE_CODE_AUTHZ_LEVEL = 0x02000000 startupinfo = STARTUPINFO() process_information = PROCESS_INFORMATION() security_attributes = SECURITY_ATTRIBUTES() startupinfo.dwFlags = 0x1 startupinfo.wShowWindow = 0x0 startupinfo.cb = sizeof(startupinfo) security_attributes.Length = sizeof(security_attributes) security_attributes.SecDescriptior = None security_attributes.InheritHandle = True if windll.kernel32.CreateProcessA(path_to_exe, None, byref(security_attributes), byref(security_attributes), True, CREATE_PRESERVE_CODE_AUTHZ_LEVEL, None, None, byref(startupinfo), byref(process_information)): self.pid = process_information.dwProcessId print "Success: CreateProcess - ", path_to_exe else: print "Failed: Create Process - Error code: ", windll.kernel32.GetLastError() def get_handle(self, pid): PROCESS_ALL_ACCESS = 0x001F0FFF PROCESS_VM_READ = 0x0010 self.h_process = windll.kernel32.OpenProcess(PROCESS_VM_READ, False, pid) if self.h_process: print "Success: Got Handle - PID:", self.pid else: print "Failed: Get Handle - Error code: ", windll.kernel32.GetLastError() windll.kernel32.SetLastError(10000) def read_memory(self, address): buffer = c_char_p("The data goes here") bufferSize = len(buffer.value) bytesRead = c_ulong(0) if windll.kernel32.ReadProcessMemory(self.h_process, address, buffer, bufferSize, byref(bytesRead)): print "Success: Read Memory - ", buffer.value else: print "Failed: Read Memory - Error Code: ", windll.kernel32.GetLastError() windll.kernel32.CloseHandle(self.h_process) windll.kernel32.SetLastError(10000) def write_memory(self, address, data): count = c_ulong(0) length = len(data) c_data = c_char_p(data[count.value:]) null = c_int(0) if not windll.kernel32.WriteProcessMemory(self.h_process, address, c_data, length, byref(count)): print "Failed: Write Memory - Error Code: ", windll.kernel32.GetLastError() windll.kernel32.SetLastError(10000) else: return False def virtual_query(self, address): basic_memory_info = MEMORY_BASIC_INFORMATION() windll.kernel32.SetLastError(10000) result = windll.kernel32.VirtualQuery(address, byref(basic_memory_info), byref(basic_memory_info)) if result: return True else: print "Failed: Virtual Query - Error Code: ", windll.kernel32.GetLastError() main = Main() address = None main.launch("C:\Program Files\ProgramFolder\Program.exe") main.get_handle(main.pid) #main.write_memory(address, "\x61") while 1: print '1 to enter an address' print '2 to virtual query address' print '3 to read address' choice = raw_input('Choice: ') if choice == '1': address = raw_input('Enter and address: ') if choice == '2': main.virtual_query(address) if choice == '3': main.read_memory(address) Thanks!

    Read the article

  • Advanced Python list comprehension

    - by Yuval A
    Given two lists: chars = ['ab', 'bc', 'ca'] words = ['abc', 'bca', 'dac', 'dbc', 'cba'] how can you use list comprehensions to generate a filtered list of words by the following condition: given that each word is of length n and chars is of length n as well, the filtered list should include only words that each i-th character is in the i string in words. In this case, we should get ['abc', 'bca'] as a result. (If this looks familiar to anyone, this was one of the questions in the previous Google code jam)

    Read the article

  • Castle Windsor upgrade causes TypeLoadException for generic types

    - by Neil Barnwell
    I have the following mapping in my Castle Windsor xml file which has worked okay (unchanged) for some time: <component id="defaultBasicRepository" service="MyApp.Models.Repositories.IBasicRepository`1, MyApp.Models" type="MyApp.Models.Repositories.Linq.BasicRepository`1, MyApp.Models" lifestyle="perWebRequest"/> I got this from the Windsor documentation at http://www.castleproject.org/container/documentation/v1rc3/usersguide/genericssupport.html. Since I upgraded Windsor, I now get the following exception at runtime: Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.TypeLoadException: GenericArguments[0], 'T', on 'MyApp.Models.Repositories.Linq.BasicRepository`1[TEntity]' violates the constraint of type parameter 'TEntity'. Source Error: Line 44: public static void ConfigureIoC() Line 45: { Line 46: var windsor = new WindsorContainer("Windsor.xml"); Line 47: Line 48: ServiceLocator.SetLocatorProvider(() = new WindsorServiceLocator(windsor)); I'm using ASP.NET MVC 1.0, Visual Studio 2008 and Castle Windsor as downloaded from http://sourceforge.net/projects/castleproject/files/InversionOfControl/2.1/Castle-Windsor-2.1.1.zip/download Can anyone shed any light on this? I'm sure the upgrade of Castle Windsor is what caused it - it's been working well for ages.

    Read the article

  • Can you return an assignable lvalue in Scala?

    - by Alex R
    (note, lvalue is actually a term from the C grammar, I don't know what it's called in Scala!) Trying to learn Scala... this evening I'm working on an internal DSL for a dynamically scoped language that might resemble PHP syntax. My REPL is: Welcome to Scala version 2.7.6.final (Java HotSpot(TM) Client VM, Java 1.6.0). I have some made-up example code: class $(any: Any) { def update(sym: Symbol, any: Any) { println("line 2 executed");} def -(sym: Symbol) : $ = { println("line 1 executed"); return this } def update(any: Any) { println("line 3 executed");} } The following works as expected: scala var a = new $(0) a: $ = $@19238ad scala a('x) = "blah" line 2 executed On the other hand, why does the following not invoke the 1-parameter update method? scala a = 1 :6: error: type mismatch; found : Int(1) required: $ a = 1 ^ Ultimately, I would like this to work: a-'x = "blah" Thanks

    Read the article

  • AttributeError while adding colorbar in matplotlib

    - by bgbg
    The following code fails to run on Python 2.5.4: from matplotlib import pylab as pl import numpy as np data = np.random.rand(6,6) fig = pl.figure(1) fig.clf() ax = fig.add_subplot(1,1,1) ax.imshow(data, interpolation='nearest', vmin=0.5, vmax=0.99) pl.colorbar() pl.show() The error message is C:\temp>python z.py Traceback (most recent call last): File "z.py", line 10, in <module> pl.colorbar() File "C:\Python25\lib\site-packages\matplotlib\pyplot.py", line 1369, in colorbar ret = gcf().colorbar(mappable, cax = cax, ax=ax, **kw) File "C:\Python25\lib\site-packages\matplotlib\figure.py", line 1046, in colorbar cb = cbar.Colorbar(cax, mappable, **kw) File "C:\Python25\lib\site-packages\matplotlib\colorbar.py", line 622, in __init__ mappable.autoscale_None() # Ensure mappable.norm.vmin, vmax AttributeError: 'NoneType' object has no attribute 'autoscale_None' How can I add colorbar to this code? Following is the interpreter information: Python 2.5.4 (r254:67916, Dec 23 2008, 15:10:54) [MSC v.1310 32 bit (Intel)] on win32 Type "help", "copyright", "credits" or "license" for more information. >>>

    Read the article

  • importing pywiiuse to test out

    - by Patrick Burton
    This is probably a simple problem. But I downloaded the pywiiuse library from here and I also downloaded the examples. However when I try to run one of the examples I end up with import issues. I'm not certain I have everything configured properly to run. One error I receive when trying to run example.py: Press 1&2 Traceback (most recent call last): File "example.py", line 73, in <module> wiimotes = wiiuse.init(nmotes) File "/home/thed0ctor/Descargas/wiiuse-0.12/wiiuse/__init__.py", line 309, in init dll = ctypes.cdll.LoadLibrary('libwiiuse.so') File "/usr/lib/python2.7/ctypes/__init__.py", line 431, in LoadLibrary return self._dlltype(name) File "/usr/lib/python2.7/ctypes/__init__.py", line 353, in __init__ self._handle = _dlopen(self._name, mode) OSError: libwiiuse.so: cannot open shared object file: No such file or directory I'm really just starting out with this library and don't really see any documentation on how to configure pywiiuse so any help is much appreciated.

    Read the article

  • Send ESC commands to a printer in C#

    - by Ewerton
    My application needs to print invoices, then a get the invoice from database, insert informations os the invoice in a big string (tellling the line, column, etc). after this a have the string ready to be sent to a printer. My problem is: I need to put some ESC/P commands/characters in my big string i try to do something like this: char formFeed = (char)12; Convert.ToChar(12); MyBigString.Insert(10, formFeed); whit this, the line 10 will do a FormFeed, but this not work NOTE: i send the MybigString all at once to printer. to make my code works i need to send the data line by line to a printer ? Thanks for the helps. PS: Sorry my English, i'am a Brazilian developer which dont speak English (yet).

    Read the article

  • Installing psycopg2 (postgresql) in virtualenv on windows

    - by StackUnderflow
    I installed psycopg2 in virtualenv using easy_install psycopg2. I did not see any errors and looks like installation went fine.. there is an egg file created in the site-packages dir for psycopg2.. but when I run import psycopg2 in the interpreter, I am getting following error.. any clue? How can I fix it.. any other way to install psycopg2 in virtualenv.. Traceback (most recent call last): File "<stdin>", line 1, in <module> File "build\bdist.win32\egg\psycopg2\__init__.py", line 69, in <module> File "build\bdist.win32\egg\psycopg2\_psycopg.py", line 7, in <module> File "build\bdist.win32\egg\psycopg2\_psycopg.py", line 6, in __bootstrap__ Thanks.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • How to insert a word into a string in Perl

    - by Nano HE
    #!C:\Perl\bin\perl.exe use strict; use warnings; use Data::Dumper; my $fh = \*DATA; while(my $line = <$fh>) { $line =~ s/ ^/male /x ; print $line ; } __DATA__ 1 0104 Mike Lee 2:01:48 output male 1 0104 Mike Lee 2:01:48 Then I tried to insert male after the racenumber(0104), I replaced the code with style. $line =~ s/ ^\d+\s+\d+\s+ /male /x ; # but failed Acturally I want the output. thank you. 1 0104 male Mike Lee 2:01:48

    Read the article

  • Are there any working implementations of the rolling hash function used in the Rabin-Karp string sea

    - by c14ppy
    I'm looking to use a rolling hash function so I can take hashes of n-grams of a very large string. For example: "stackoverflow", broken up into 5 grams would be: "stack", "tacko", "ackov", "ckove", "kover", "overf", "verfl", "erflo", "rflow" This is ideal for a rolling hash function because after I calculate the first n-gram hash, the following ones are relatively cheap to calculate because I simply have to drop the first letter of the first hash and add the new last letter of the second hash. I know that in general this hash function is generated as: H = c1ak - 1 + c2ak - 2 + c3ak - 3 + ... + cka0 where a is a constant and c1,...,ck are the input characters. If you follow this link on the Rabin-Karp string search algorithm , it states that "a" is usually some large prime. I want my hashes to be stored in 32 bit integers, so how large of a prime should "a" be, such that I don't overflow my integer? Does there exist an existing implementation of this hash function somewhere that I could already use? Here is an implementation I created: public class hash2 { public int prime = 101; public int hash(String text) { int hash = 0; for(int i = 0; i < text.length(); i++) { char c = text.charAt(i); hash += c * (int) (Math.pow(prime, text.length() - 1 - i)); } return hash; } public int rollHash(int previousHash, String previousText, String currentText) { char firstChar = previousText.charAt(0); char lastChar = currentText.charAt(currentText.length() - 1); int firstCharHash = firstChar * (int) (Math.pow(prime, previousText.length() - 1)); int hash = (previousHash - firstCharHash) * prime + lastChar; return hash; } public static void main(String[] args) { hash2 hashify = new hash2(); int firstHash = hashify.hash("mydog"); System.out.println(firstHash); System.out.println(hashify.hash("ydogr")); System.out.println(hashify.rollHash(firstHash, "mydog", "ydogr")); } } I'm using 101 as my prime. Does it matter if my hashes will overflow? I think this is desirable but I'm not sure. Does this seem like the right way to go about this?

    Read the article

  • Is there a stylesheet or Windows commandline tool for controllable XML formatting, specifically putt

    - by Scott Stafford
    Hi - I am searching for an XSLT or command-line tool (or C# code that can be made into a command-line tool, etc) for Windows that will do XML pretty-printing. Specifically, I want one that has the ability to put attributes one-to-a-line, something like: <Node> <ChildNode value1='5' value2='6' value3='happy' /> </Node> It doesn't have to be EXACTLY like that, but I want to use it for an XML file that has nodes with dozens of attributes and spreading them across multiple lines makes them easier to read, edit, and text-diff. NOTE: I think my preferred solution is an XSLT sheet I can pass through a C# method, though a Windows command-line tool is good too.

    Read the article

  • horizontal scrolling only!

    - by Crippletoe
    Hi all i have a that contains a HORIZONTAL menu. the menu consists of an unordered list. i would like the div to get a horizontal scroller whenever the menu exceeds the width of the <div>. i tried using these CSS definitions for my <div>: position: absolute; width: 380px; overflow: auto; overflow-y: hidden; height: 30px; but than realized that since the menu is LIST, the different list items break the line whenever they reach the width of the <div> and move on to the next line, thus the browser doesnt see the need for a horizontal scroller (it doesnt display a vertical one as well because of the overflow-y: hidden; line) any ideas how i can create a 1 line horizontal menu which will scroll horizontally only? thank you all so much.

    Read the article

  • SyntaxError using gdata-python-client to access Google Book Search Data API

    - by isbadawi
    >>> import gdata.books.service >>> service = gdata.books.service.BookService() >>> results = service.search_by_keyword(isbn='0434003484') Traceback (most recent call last): File "<pyshell#4>", line 1, in <module> results = service.search_by_keyword(isbn='0434003484') ... snip ... File "C:\Python26\lib\site-packages\atom\__init__.py", line 127, in CreateClassFromXMLString tree = ElementTree.fromstring(xml_string) File "<string>", line 85, in XML SyntaxError: syntax error: line 1, column 0 This is a minimal example -- in particular, the book service unit tests included in the package also fail with the exact same error. I've looked at the wiki and open issue tickets on Google Code to no avail (and this seems to me more apt to be a silly error on my end rather than a problem with the library). I'm not sure how to interpret the error message. If it matters, I'm using python 2.6.5.

    Read the article

  • How do I insert a word into a string in Perl?

    - by Nano HE
    #!C:\Perl\bin\perl.exe use strict; use warnings; use Data::Dumper; my $fh = \*DATA; while(my $line = <$fh>) { $line =~ s/ ^/male /x ; print $line ; } __DATA__ 1 0104 Mike Lee 2:01:48 output male 1 0104 Mike Lee 2:01:48 Then I tried to insert male after the racenumber(0104), I replaced the code with style. $line =~ s/ ^\d+\s+\d+\s+ /male /x ; # but failed Acturally I want the output. thank you. 1 0104 male Mike Lee 2:01:48

    Read the article

  • Reconstructing Position in the Original Array from the Position in a Stripped Down Array

    - by aronchick
    I have a text file that contains a number of the following: <ID> <Time 1> --> <Time 2> <Quote (potentially multiple line> <New Line Separator> <ID> <Time 1> --> <Time 2> <Quote (potentially multiple line> <New Line Separator> <ID> <Time 1> --> <Time 2> <Quote (potentially multiple line> <New Line Separator> I have a very simple regex for stripping these out into a constant block so it's just: <Quote> <Quote> <Quote> What I'd like to do is present the quotes as a block to the user, and have them select it (using jQuery.fieldSelection) and then use the selected content to back out to the original array, so I can get timing and IDs. Because this has to go out to HTML, and the user has to be able to select the text on the screen, I can't do anything like hidden divs or hidden input fields. The only data I will have is the character range selected on screen. To be specific, this is what it looks like: 1 0:00 --> 0:05 He was bored. So bored. His great intellect, seemingly inexhaustible, was hungry for new challenges but he was the last of the great innovators 2 0:05 --> 0:10 - society's problems had all been solved. 3 0:11 --> 0:20 All seemingly unconnected disciplines had long since been found to be related in horrifically elusive and contrived ways and he had mastered them all. And this is what I'd like to present to the user for selection: He was bored. So bored. His great intellect, seemingly inexhaustible, was hungry for new challenges but he was the last of the great innovators - society's problems had all been solved. All seemingly unconnected disciplines had long since been found to be related in horrifically elusive and contrived ways and he had mastered them all. Has anyone com across something like this before? Any ideas how to take the selected text, or selection position, and go backwards to the original meta-data?

    Read the article

  • How to better create stacked bar graphs with multiple variables from ggplot2?

    - by deoksu
    I often have to make stacked barplots to compare variables, and because I do all my stats in R, I prefer to do all my graphics in R with ggplot2. I would like to learn how to do two things: First, I would like to be able to add proper percentage tick marks for each variable rather than tick marks by count. Counts would be confusing, which is why I take out the axis labels completely. Second, there must be a simpler way to reorganize my data to make this happen. It seems like the sort of thing I should be able to do natively in ggplot2 with plyR, but the documentation for plyR is not very clear (and I have read both the ggplot2 book and the online plyR documentation. My best graph looks like this, the code to create it follows: the R code I use to get it is the following: library(epicalc) ### recode the variables to factors ### recode(c(int_newcoun, int_newneigh, int_neweur, int_newusa, int_neweco, int_newit, int_newen, int_newsp, int_newhr, int_newlit, int_newent, int_newrel, int_newhth, int_bapo, int_wopo, int_eupo, int_educ), c(1,2,3,4,5,6,7,8,9, NA), c('Very Interested','Somewhat Interested','Not Very Interested','Not At All interested',NA,NA,NA,NA,NA,NA)) ### Combine recoded variables to a common vector Interest1<-c(int_newcoun, int_newneigh, int_neweur, int_newusa, int_neweco, int_newit, int_newen, int_newsp, int_newhr, int_newlit, int_newent, int_newrel, int_newhth, int_bapo, int_wopo, int_eupo, int_educ) ### Create a second vector to label the first vector by original variable ### a1<-rep("News about Bangladesh", length(int_newcoun)) a2<-rep("Neighboring Countries", length(int_newneigh)) [...] a17<-rep("Education", length(int_educ)) Interest2<-c(a1, a2, a3, a4, a5, a6, a7, a8, a9, a10, a11, a12, a13, a14, a15, a16, a17) ### Create a Weighting vector of the proper length ### Interest.weight<-rep(weight, 17) ### Make and save a new data frame from the three vectors ### Interest.df<-cbind(Interest1, Interest2, Interest.weight) Interest.df<-as.data.frame(Interest.df) write.csv(Interest.df, 'C:\\Documents and Settings\\[name]\\Desktop\\Sweave\\InterestBangladesh.csv') ### Sort the factor levels to display properly ### Interest.df$Interest1<-relevel(Interest$Interest1, ref='Not Very Interested') Interest.df$Interest1<-relevel(Interest$Interest1, ref='Somewhat Interested') Interest.df$Interest1<-relevel(Interest$Interest1, ref='Very Interested') Interest.df$Interest2<-relevel(Interest$Interest2, ref='News about Bangladesh') Interest.df$Interest2<-relevel(Interest$Interest2, ref='Education') [...] Interest.df$Interest2<-relevel(Interest$Interest2, ref='European Politics') detach(Interest) attach(Interest) ### Finally create the graph in ggplot2 ### library(ggplot2) p<-ggplot(Interest, aes(Interest2, ..count..)) p<-p+geom_bar((aes(weight=Interest.weight, fill=Interest1))) p<-p+coord_flip() p<-p+scale_y_continuous("", breaks=NA) p<-p+scale_fill_manual(value = rev(brewer.pal(5, "Purples"))) p update_labels(p, list(fill='', x='', y='')) I'd very much appreciate any tips, tricks or hints. Thanks.

    Read the article

  • Turning off auto indent when pasting text into vim

    - by Rimian
    Unfortunately, I am not an experienced vim user. But, I am making the effort to learn it. When I paste code into my document from the clipboard, I get extra spaces at the start of each new line: line line line I know you can turn off auto indent but mine doesn't seem to work because I have some other settings conflicting or something (which look pretty obvious in my .vimrc but don't seem to matter when I take them out). Can someone please show me the way to turn this off when I paste code but still have vim auto indent when I am writing code? Please see my .vimrc file: set expandtab set tabstop=2 set shiftwidth=2 set autoindent set smartindent set bg=dark set nowrap Many thanks

    Read the article

  • 'System.Web.UI.Control.Controls' is a 'property' but is used like a 'type'

    - by senzacionale
    What i am doing wrong? I extend LinkButton and i get this error Compilation Error Description: An error occurred during the compilation of a resource required to service this request. Please review the following specific error details and modify your source code appropriately. Compiler Error Message: CS0118: 'System.Web.UI.Control.Controls' is a 'property' but is used like a 'type' Source Error: Line 1084: Line 1085: public void @_DataBinding_control30(object sender, System.EventArgs e) { Line 1086: ConfirmButton.Controls.ConfirmLinkButton dataBindingExpressionBuilderTarget; Line 1087: System.Web.UI.IDataItemContainer Container; Line 1088: dataBindingExpressionBuilderTarget = ((ConfirmButton.Controls.ConfirmLinkButton)(sender)); This is C# code: [Localizable(true)] public string Message { get { return ViewState["Message"] as string; } set { ViewState["Message"] = value; } } #region Overriden protected override void OnPreRender(EventArgs e) { if (!String.IsNullOrEmpty(Message)) { WebControlUtils.SetConfirmationMessage(Page, typeof (Page), this, Message, Page.IsAsyncPostBack(), CausesValidation); } base.OnPreRender(e); } #endregion ASPX CODE: <asp:TemplateField> <ItemTemplate> <asp:ConfirmLinkButton ID="lnkBtnDelete" runat="server" Text="Odstrani" Message="Delete?" CommandName="DeleteAgencie" Width="50" CommandArgument='<%# Eval("idAgencies") %>' OnCommand="lnkBtnDelete_Command" CausesValidation="False"></asp:ConfirmLinkButton> </ItemTemplate> </asp:TemplateField> Regards

    Read the article

< Previous Page | 265 266 267 268 269 270 271 272 273 274 275 276  | Next Page >