Search Results

Search found 48797 results on 1952 pages for 'read write'.

Page 27/1952 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • www-data is unable to write to an NFS share

    - by Bastian
    On Debian Squeeze, I created an NFS share with these options rw,sync,no_root_squash,no_subtree_check,insecure and on the other Debian Squeeze I can successfully mount it and read write with root, but this share is intended to be used by Apache. I changed the permission to 777 just to make sure. And still, the www-data user can read, create files but not write to them! It does not sound to me like the typical permissions problem, maybe something related to NFS, a lock problem that I am not aware of. Any idea is welcome.

    Read the article

  • How to write to Samba folder?

    - by Darren
    I created a Samba share on my CentOS machine and I can connect to the share and read the contents but I cannot write files to it or delete them. In Samba I have set readable to yes and writeable to yes, as well as made the folder I want to access apart of the wheel group of which I added the user that is accessing it from Samba. The folder in quesiton is /var/www/. I have set that folder and all folders under it to the wheel group which can read and write to it. What am I doing wrong here?

    Read the article

  • How to configure Notepad++ (Scintilla) to write below EOF after EOL [on hold]

    - by Piotr Piaseczny
    Is it possible to configure scintilla to "brake" EOL/EOF while writing ? Now, if I want to begin writing in a column after EOL, I use ALT+left mouse button and start typing after click. No idea how to begin writing below EOF. Pressing Enter key many times is the only method now. Other explanation: If You open a new document, doesnt matter what kind of (php/txt etc) all You have is just one line. If You want to write in line 5 - must press Enter 5 times. Every other editor I know (IDE in Builder C++/MultiEdit) "ignore" eof and you can write anywhere in document. Because of php/html I've found notepad++ as a best editor but I'd like to "brake" limitations of (probably) scintilla

    Read the article

  • How to write to Samba folder?

    - by Darren
    Hi all, I created a Samba share on my CentOS machine and I can connect to the share and read the contents but I cannot write files to it or delete them. In Samba I have set readable to yes and writeable to yes, as well as made the folder I want to access apart of the wheel group of which I added the user that is accessing it from Samba. The folder in quesiton is /var/www/. I have set that folder and all folders under it to the wheel group which can read and write to it. What am I doing wrong here?

    Read the article

  • USB Permission - Write protection

    - by dekhadmai
    I have an external harddisk and my friends asked for it. The point is I don't trust in his anti-virus software. Is there anyway to allow some folders (I prepare hdd space for him) to write-able and all others is read-only ? or is there a software that can do like this ? And it would be great if I can have full access on my computer ONLY (may be with some specific software on my PC) and without having to modify anything. I don't ask for hdd-encryption since I only want to limit the area of write-able folder (and allow my friend to read through all my data), later I can scan for virus myself only in that area ... scanning entire hdd with 500gb/friend is not fun at all ! Sorry if this doesn't seems like the programming questions. Any help would be appreciate, Thank you.

    Read the article

  • write c++ in latex, noob latex question

    - by voodoomsr
    maybe is a noob question but i can't find the solution in the web, i need to write C++ in Latex. I write C$++$ but the result is like crap, the signs are too big and there is too much space between C and the first plus sign. Previously i needed to write the sharp symbol for C#....c$\sharp$ it also looks like crap but with a escape character it looks nice, for the plus sign i can't do the same.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • c# write big files to blob sqlite

    - by brizjin-gmail-com
    I have c# application which write files to sqlite database. It uses entity fraemwork for modeling data. Write file to blob (entity byte[] varible) with this line: row.file = System.IO.File.ReadAllBytes(file_to_load.FileName); //row.file is type byte[] //row is entity class table All work correctly when files size is less. When size more 300Mb app throw exception: Exception of type 'System.OutOfMemoryException' was thrown. How I can write to blob direct, without memory varibles?

    Read the article

  • How does DataContractSerializer write to private fields?

    - by Eric
    I understand how XMLSerializer could work by using reflection to figure out what public read/write fields or properties it should be using to serialize or de-serialize XML. Yet XMLSerializer requires that the fields be public and read/write. However, DataContractSerializer is able to read or write to or from completely private fields in a class. So I'm wondering how this is even possible with out explicitly giving DataContractSerializer additional access rights to my class(es).

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • How do i write this jpql query?

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Formula to calculate probability of unrecoverable read error during RAID rebuild

    - by OlafM
    I need to compare the reliability of different RAID systems with either consumer or enterprise drives. The formula to have the probability of success of a rebuild, ignoring mechanical problems, is simple: error_probability = 1 - (1-per_bit_error_rate)^bit_read and with 3 TB drives I get 38% probability to experience an URE (unrecoverable read error) for a 2+1 disks RAID5 (4.7% for enterprise drives) 21% for a RAID1 (2.4% for enterprise drives) 51% probability of error during recovery for the 3+1 RAID5 often used by users of SOHO products like Synologys. Most people don't know about this. Calculating the error for single disk tolerance is easy, my question concerns systems tolerant to multiple disks failures (RAID6/Z2, RAIDZ3 and RAID1 with multiple disks). If only the first disk is used for rebuild and the second one is read again from the beginning in case or an URE, then the error probability is the one calculated above squared (14.5% for consumer RAID5 2+1, 4.5% for consumer RAID1 1+2). However, I suppose (at least in ZFS that has full checksums!) that the second parity/available disk is read only where needed, meaning that only few sectors are needed: how many UREs can possibly happen in the first disk? not many, otherwise the error probability for single-disk tolerance systems would skyrocket even more than I calculated. If I'm correct, a second parity disk would practically lower the risk to extremely low values. Am I correct?

    Read the article

  • how to read a User uploaded file, without saving it to the database

    - by GoodGets
    I'd like to be able to read an XML file uploaded by the user (less than 100kb), but not have to first save that file to the database. I don't need that file past the current action (its contents get parsed and added to the database; however, parsing the file is not the problem). Since local files can be read with: File.read("export.opml") I thought about just creating a file_field for :uploaded_file, then trying to read it with File.read(params[:uploaded_file]) but all that does is throw a TypeError (can't convert HashWithIndifferentAccess into String). I really have tried a lot of various things (including reading from the /tmp directory as well), but could get none of them to work. I hope the brevity of my question doesn't mask the effort I've given to try to solve this on my own, but I didn't want to pollute this question with a hundred ways of how NOT to get it done. Big thanks to anyone who chimes in.

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • Squid SSL transparent proxy - SSL_connect:error in SSLv2/v3 read server hello A

    - by larryzhao
    I am trying to setup a SSL proxy for one of my internal servers to visit https://www.googleapis.com using Squid, to make my Rails application on that server to reach googleapis.com via the proxy. I am new to this, so my approach is to setup a SSL transparent proxy with Squid. I build Squid 3.3 on Ubuntu 12.04, generated a pair of ssl key and crt, and configure squid like this: http_port 443 transparent cert=/home/larry/ssl/server.csr key=/home/larry/ssl/server.key And leaves almost all other configurations default. The authorization of the dir that holds key/crt is drwxrwxr-x 2 proxy proxy 4096 Oct 17 15:45 ssl Back on my dev laptop, I put <proxy-server-ip> www.googleapis.com in my /etc/hosts to make the call goes to my proxy server. But when I try it in my rails application, I got: SSL_connect returned=1 errno=0 state=SSLv2/v3 read server hello A: unknown protocol And I also tried with openssl in cli: openssl s_client -state -nbio -connect www.googleapis.com:443 2>&1 | grep "^SSL" SSL_connect:before/connect initialization SSL_connect:SSLv2/v3 write client hello A SSL_connect:error in SSLv2/v3 read server hello A SSL_connect:error in SSLv2/v3 read server hello A Where did I do wrong?

    Read the article

  • Have only read access to Samba

    - by Tahir Malik
    Hi I've been struggling a lot with Samba on Centos 5.5 lately. I develop in Windows 7 and send files through scp (ant task), but it's to slow and wanted to setup thoroughly samba. After installing and following some guides I've done the following: Disable firewall (iptables) Disable SelLinux (didn't do that at the start, but didn't help either) setup my smbusers file to map my windows user to root (root = "Tahir Malik" -- works) added a current user mitco to the sambapassdb with the command smbpasswd -a mitco , because the windows user had only read access So both the users have read access to my share. Here is my smb.conf snippit: [global] workgroup = MITCO server string = Samba Server Version %v netbios name = centos ; interfaces = lo eth0 192.168.12.2/24 192.168.13.2/24 ; hosts allow = 127. 192.168.12. 192.168.13. [alf4] comment = Alfresco 4 path = /opt read only = no valid users = mitco, mitco force user = root force group = root admin users = mitco , mitco writeable = yes ; browseable = yes What also maybe important is that the /opt is only writable by root, but that shouldn't matter because I use the force user and group or admin users. The log file : [2012/09/29 07:43:44, 0] smbd/server.c:main(958) smbd version 3.0.33-3.39.el5_8 started. Copyright Andrew Tridgell and the Samba Team 1992-2008 [2012/09/29 07:43:59, 1] smbd/service.c:make_connection_snum(1085) mitco-tahir (192.168.13.1) connect to service alf4 initially as user root (uid=0, gid=0) (pid 5228)

    Read the article

  • Need some help understanding IO Statistics

    - by Abe Miessler
    I have a query that has a very costly INDEX SEEK operation in the execution plan. In order to track down the cause i set IO STATISTICS on and ran it. In the problem section it gave the following statistics: Table '#TempStudents_Enrollment2_____________________________________000000004D5F'. Scan count 0, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'Worktable'. Scan count 0, logical reads 0, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#TempRace2______________________________________________000000004D58'. Scan count 1, logical reads 1, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'Worktable'. Scan count 0, logical reads 0, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'RefRace'. Scan count 120, logical reads 240, physical reads 1, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'RefFedEnctyRaceCatg'. Scan count 18, logical reads 36, physical reads 2, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#43B0BA0F'. Scan count 1, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#42BC95D6'. Scan count 1, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#41C8719D'. Scan count 1, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#40D44D64'. Scan count 1, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#LEA2_________________________________________________000000004D56'. Scan count 1, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#39332B9C'. Scan count 1, logical reads 60, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#School2________________________________________________000000004D57'. Scan count 1, logical reads 29164, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#GenderKey______________________________________________000000004D5A'. Scan count 1, logical reads 29164, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#LangAcqKey_____________________________________________000000004D5B'. Scan count 1, logical reads 29164, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#TransferCatKey___________________________________________000000004D5C'. Scan count 1, logical reads 29164, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#ResCatKey______________________________________________000000004D5D'. Scan count 1, logical reads 29164, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'RPT_SnapShot_1_4_StuPgm_Denorm'. Scan count 2344954, logical reads 4992518, physical reads 16, read-ahead reads 8, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#3FE0292B'. Scan count 1, logical reads 2344954, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table 'RPT_SnapShot_1_4_StuEnrlmt_Denorm'. Scan count 20, logical reads 87679, physical reads 0, read-ahead reads 87425, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. Table '#GradeKey_______________________________________________000000004D59'. Scan count 1, logical reads 1, physical reads 0, read-ahead reads 0, lob logical reads 0, lob physical reads 0, lob read-ahead reads 0. What should I look for in here when i'm looking to improve the performance? The line with over 2 million for the Scan count looked suspicious to me but I really don't know. Does anyone see anything here that i should look into in more detail?

    Read the article

  • PList Chicken/Egg Scenario

    - by David van Dugteren
    Hi, I want to read/write to cache.plist If I want to read an existing premade plist file stored in the resources folder I can go: path = [[NSBundle mainBundle] bundlePath]; NSString *finalPath = [path stringByAppendingPathWithComponent@"cache.plist"]; NSMutableDictionary *root = ... But then I wish to read it from the iPhone. Can't, the Resources folder is only readable. So I need to use: NSDocumentDirectory, NSUserDomain,YES So how can I have my plist file preinstalled to the Document Directory location? Thus meaning I don't have to mess around with untidy code copying the plist file over at startup. (Unless that's the only way).

    Read the article

  • Cannot properly read files on the local server

    - by Andrew Bestic
    I'm running a RedHat 6.2 Amazon EC2 instance using stock Apache and IUS PHP53u+MySQL (+mbstring, +mysqli, +mcrypt), and phpMyAdmin from git. All configuration is near-vanilla, assuming the described installation procedure. I've been trying to import SQL files into the database using phpMyAdmin to read them from a directory on my server. phpMyAdmin lists the files fine in the drop down, but returns a "File could not be read" error when actually trying to import. Furthermore, when trying to execute file_get_contents(); on the file, it also returns a "failed to open stream: Permission denied" error. In fact, when my brother was attempting to import the SQL files using MySQL "SOURCE" as an authenticated MySQL user with ALL PRIVILEGES, he was getting an error reading the file. It seems that we are unable to read/import these files with ANY method other than root under SSH (although I can't say I've tried every possible method). I have never had this issue under regular CentOS (5, 6, 6.2) installations with the same LAMP stack configuration. Some things I've tried after searching Google and StackExchange: CHMOD 0777 both directory and files, CHOWN root, apache (only two users I can think of that PHP would use), Importing SQL files with total size under both upload_max_filesize and post_max_size, PHP open_basedir commented out, or = "/var/www" (my sites are using Apache VirtualHosts within that directory, and all the SQL files are deep within that directory), PHP safe mode is OFF (it was never ON) At the moment I have solved this issue with the smaller files by using the FILE UPLOAD method directly to phpMyAdmin, but this will not be suitable for uploading my 200+ MiB SQL files as I don't have a stable Internet connection. Any light you could shed on this situation would be greatly appreciated. I'm fair with Linux, and for the things that do stump me, Google usually has an answer. Not this time, though!

    Read the article

  • Write simple data to iphone sandbox?

    - by fuzzygoat
    I want to write a small bit of data from my app to the iphone so I can load it when the app next starts. I am going to write the data using NSCoding, but I don't know what I should be specifying as a path. I understand I would write the data to the application sandbox, just not sure how to specify that. gary

    Read the article

  • How do i write this jpql query? java

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Parse and read data frame in C?

    - by user253656
    I am writing a program that reads the data from the serial port on Linux. The data are sent by another device with the following frame format: |start | Command | Data | CRC | End | |0x02 | 0x41 | (0-127 octets) | | 0x03| ---------------------------------------------------- The Data field contains 127 octets as shown and octet 1,2 contains one type of data; octet 3,4 contains another data. I need to get these data I know how to write and read data to and from a serial port in Linux, but it is just to write and read a simple string (like "ABD") My issue is that I do not know how to parse the data frame formatted as above so that I can: get the data in octet 1,2 in the Data field get the data in octet 3,4 in the Data field get the value in CRC field to check the consistency of the data Here the sample snip code that read and write a simple string from and to a serial port in Linux: int writeport(int fd, char *chars) { int len = strlen(chars); chars[len] = 0x0d; // stick a <CR> after the command chars[len+1] = 0x00; // terminate the string properly int n = write(fd, chars, strlen(chars)); if (n < 0) { fputs("write failed!\n", stderr); return 0; } return 1; } int readport(int fd, char *result) { int iIn = read(fd, result, 254); result[iIn-1] = 0x00; if (iIn < 0) { if (errno == EAGAIN) { printf("SERIAL EAGAIN ERROR\n"); return 0; } else { printf("SERIAL read error %d %s\n", errno, strerror(errno)); return 0; } } return 1; } Does anyone please have some ideas? Thanks all.

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >