Search Results

Search found 16192 results on 648 pages for 'character reference'.

Page 28/648 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Dynamic URL for Service Reference in visual Studio 2010

    - by Zee99
    I am writing a Silverlight 3 application, this app uses a service reference to connect to a SharePoint site by using Sharepoint Lists.asmx web service Now i want to install my app on different servers, and i want my app to use the weBservice of the server on which it is installed (without me specifying it). In Vs2005, we used to specify "dynamic" for the webservice. How can i do this in Visual Studio 2010 (service reference)? there is no "dynamic" property for a service reference. Thanks,

    Read the article

  • Could not load file or assembly error even when reference has been removed

    - by twal
    Could not load file or assembly 'Payflow_dotNET_2.0' or one of its dependencies. The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040) I tried to reference the payflow SDK and got this error.But I am no longer trying to reference it. I have removed all references to this dll. and Now I am just trying to get the project to start in VS but I still get this error. I am not trying to add the dll anymore.If i have removed the reference to this, why am I still getting this error? How can I remove anything else that may still be causing my program to look for this file? Thanks!

    Read the article

  • Reference manager for Ubuntu

    - by user36511
    I'm in dire need of a reference/citation manager in Ubuntu. The features I need the most are: 1) Metadata extraction/editing of pdf 2) Fetch metadata from online databases such as Google Scholar 3) Attach pdf or other file to reference 4) Tag references and recall those with a given tag or set of tags 5) Provide APA style citation for references (in integration with OOffice and/or Latex) Optional: Would be great if it can annotate/highlight pdfs. Mendeley probably does all of these, but it's behavior has driven me insane, especially when the number of references it's trying to handle is large. It constantly tries to sync with the web and creates duplicate references. I've tried JabRef, and while it looks like a decent piece of freeware, it doesn't do some of the above. I found others like Bibus, Referencer, etc. to be lacking or buggy or inactive development. Is there another option, or should I give up the search.

    Read the article

  • how to add a reference to assembly

    - by Gold
    hi i try to run pdf to text C# code, i have reference to 2 dll and i get this error when i try to run the program: how to add a reference to assembly ? the type 'java.io.File' is defined in an assembly that is not referenced. You must add a reference to assembly 'IKVM.GNU.Classpath, Version=0.20.0.0, Culture=neutral, PublicKeyToken=13235d27fcbfff58'. thank's in advance

    Read the article

  • Restoring web reference in Visual Studio 2008

    - by Mark Cheeseborough
    I had a web reference set in my VS2008 ASP.NET project, but due to some source control weirdness it is no longer listed in the project. I have the set of files in the Web References folder under my project. There's a .wsdl, .disco and several .datasource files. Is there any way to re-add this web reference through the existing files rather than using the "Add Web Reference" dialog?

    Read the article

  • How do C++ compilers actually pass reference parameters?

    - by T.E.D.
    This question came about as a result of some mixed-langauge programming. I had a Fortran routine I wanted to call from C++ code. Fortran passes all its parameters by reference (unless you tell it otherwise). So I thought I'd be clever (bad start right there) in my C++ code and define the Fortran routine something like this: extern "C" void FORTRAN_ROUTINE (unsigned & flag); This code worked for a while but (of course right when I needed to leave) suddenly started blowing up on a return call. Clear indication of a munged call stack. Another engineer came behind me and fixed the problem, declaring that the routine had to be deinfed in C++ as extern "C" void FORTRAN_ROUTINE (unsigned * flag); I'd accept that except for two things. One is that it seems rather counter-intuitive for the compiler to not pass reference parameters by reference, and I can find no documentation anywhere that says that. The other is that he changed a whole raft of other code in there at the same time, so it theoretically could have been another change that fixed whatever the issue was. So the question is, how does C++ actually pass reference parameters? Is it perhaps free to do copy-in, copy-out for small values or something? In other words, are reference parameters utterly useless in mixed-language programming? I'd like to know so I don't make this same code-killing mistake ever again.

    Read the article

  • Why is the 'this' keyword not a reference type in C++ [closed]

    - by Dave Tapley
    Possible Duplicates: Why ‘this’ is a pointer and not a reference? SAFE Pointer to a pointer (well reference to a reference) in C# The this keyword in C++ gets a pointer to the object I currently am. My question is why is the type of this a pointer type and not a reference type. Are there any conditions under which the this keyword would be NULL? My immediate thought would be in a static function, but Visual C++ at least is smart enough to spot this and report static member functions do not have 'this' pointers. Is this in the standard?

    Read the article

  • When is it okay to reference WindowsBase.dll?

    - by Tyler
    I've heard/read about people not wanting to reference the assembly because of the Windows component (e.g. "I don't want to reference Windows for my Web App). I'd like to hear what a large community feels about this. For which project types (business, data access, etc.) is it considered acceptable to reference WindowsBase.dll.

    Read the article

  • How to add a web service reference in a DLL

    - by dan
    I'm creating a DLL with a reference to web services (I don't have the choice to do so) but I have to add web service references to the project that uses the DLL for it to work. Example, I have the DLL called API.DLL that calls a web service called WebService.svc that I want to use in a project called WinForm. First, I have to add a "Service Reference" to WebService.svc in API.DLL. Then, I add a reference API.DLL to WinForm but it doesn't work unless I also add a service reference to WebService.svc in WinForm. What can I do to avoid that last step?

    Read the article

  • object reference set in java

    - by landon9720
    I need to create a Set of objects. The concern is I do not want to base the hashing or the equality on the objects' hashCode and equals implementation. Instead, I want the hash code and equality to be based only on each object's reference identity (i.e.: the value of the reference pointer). I'm not sure how to do this in Java. The reasoning behind this is my objects do not reliably implement equals or hashCode, and in this case reference identity is good enough.

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • AIA und die "IT Strategies from Oracle"

    - by Hans Viehmann
    Die Oracle Application Integration Architecture lässt sich gut nutzen, um eine SOA Initiative zügig zu starten. Naturgemäß berücksichtigt sie aber nicht alle Aspekte einer IT Strategie. Zu diesem Thema gibt es nun seit einigen Wochen eine umfassende Bibliothek von Handbüchern ("Practitioner's Guides") und Referenz-Architekturen, in denen die Erfahrung aus zahlreichen Projekten zusammengefasst ist.Hier ist beispielsweise ein IT Governance Framework beschrieben, das auch die wesentlichen Aspekte der SOA GovernanceSOA Portfolio GovernanceService Lifecycle GovernanceSOA Solution Lifecycle GovernanceSOA Vitality GovernanceSOA Organization Governancenäher beschreibt.In den Handbüchern sind zahlreiche wertvolle Hinweise und best practices enthalten; ich denke, es lohnt sich, einen Blick hinein zu werfen.Die gesamte Bibliothek findet sich unter http://www.oracle.com/goto/itstrategies; eine Übersicht über die verschiedenen Aspekte ist in dem Bild unten zusammengefasst.View image

    Read the article

  • Problem with MVC3 application

    - by Pravin Patil
    I am working on MVC3 application. I use entity framework, NInject, Fluent Validation and some more Nuget packages. I am using Tortoise SVN for versioning. Recently I changed the structure of my SVN repository, so my working copy of MVC3 app was moved to some different folder in the repository. Now when I checked out the copy from SVN, all the references that I had added through Nuget were lost(EF, NInject and rest nuget packages were showing yellow missing icon in references). This had happened to me prior to this also, when I tried to check out the app from svn to some other folder. I had to manually add all the references again through Nuget again. Am I doing anything wrong? Please guide. I hope I could explain my problem properly.

    Read the article

  • As a programmer, what would you use a personal Wiki for?

    - by Adam Harte
    Do any programmers out there keep a personal wiki? Either locally or online. What do you use your wiki for? or what might you use one for? I was thinking of starting a personal wiki as a place to record documentation and and other documents for my personal projects, and various notes etc, but how else is a personal (maybe private) Wiki useful to a programmer/developer? What type of things would you put in a personal Wiki?

    Read the article

  • Scrum got specific ways for testing software?

    - by joker13
    When reading Scrum Guide, as the official text for scrum, I find out there is no specific solution to provide software testing in scrum. (the only hint is on page15) I'm a little vague on whether scrum is considered a software development methodology or not? If it is not, then how come some of its practices opposes Extreme Programming? (I know that in scrum guide, the author notes that scrum is a framework not a methodology, but still I'm not pretty clear on that) And what's more, I'm not sure if there are any other important textbook that I'm missing so far about scrum. I need them to be official or of great deal of public acceptance.

    Read the article

  • Do objects maintain identity under all non-cloning conditions in PHP?

    - by Buttle Butkus
    PHP 5.5 I'm doing a bunch of passing around of objects with the assumption that they will all maintain their identities - that any changes made to their states from inside other objects' methods will continue to hold true afterwards. Am I assuming correctly? I will give my basic structure here. class builder { protected $foo_ids = array(); // set in construct protected $foo_collection; protected $bar_ids = array(); // set in construct protected $bar_collection; protected function initFoos() { $this->foo_collection = new FooCollection(); foreach($this->food_ids as $id) { $this->foo_collection->addFoo(new foo($id)); } } protected function initBars() { // same idea as initFoos } protected function wireFoosAndBars(fooCollection $foos, barCollection $bars) { // arguments are passed in using $this->foo_collection and $this->bar_collection foreach($foos as $foo_obj) { // (foo_collection implements IteratorAggregate) $bar_ids = $foo_obj->getAssociatedBarIds(); if(!empty($bar_ids) ) { $bar_collection = new barCollection(); // sub-collection to be a component of each foo foreach($bar_ids as $bar_id) { $bar_collection->addBar(new bar($bar_id)); } $foo_obj->addBarCollection($bar_collection); // now each foo_obj has a collection of bar objects, each of which is also in the main collection. Are they the same objects? } } } } What has me worried is that foreach supposedly works on a copy of its arrays. I want all the $foo and $bar objects to maintain their identities no matter which $collection object they become of a part of. Does that make sense?

    Read the article

  • How common are circular references? Would reference-counting GC work just fine?

    - by user9521
    How common are circular references? The less common they are, the fewer hard cases you have if you are writing in a language with only reference counting-GC. Are there any cases where it wouldn't work well to make one of the references a "weak" reference so that reference counting still works? It seems like you should be able to have a language only use reference counting and weak references and have things work just fine most of the time, with the goal of efficiency. You could also have tools to help you detect memory leaks caused by circular references. Thoughts, anyone? It seems that Python uses references counting (I don't know if it uses a tracing collector occasionally or not for sure) and I know that Vala uses reference counting with weak references; I know that it's been done before, but how well would it work?

    Read the article

  • What happens if we serialize and deserialize two objects which references to each other?

    - by Seregwethrin
    To make it more clear, this is a quick example: class A implements Serializable { public B b; } class B implements Serializable { public A a; } A a = new A(); B b = new B(); a.b = b; b.a = a; So what happens if we serialize a and b objects into a file and deserialize from that file? I thought we get 4 objects, 2 of each. Identical objects but different instances. But I'm not sure if there's anything else or is it right or wrong. If any technology needed to answer, please think based on Java. Thank you.

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >