Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 28/63 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Finding the largest subtree in a BST

    - by rakeshr
    Given a binary tree, I want to find out the largest subtree which is a BST in it. Naive approach: I have a naive approach in mind where I visit every node of the tree and pass this node to a isBST function. I will also keep track of the number of nodes in a sub-tree if it is a BST. Is there a better approach than this ?

    Read the article

  • Java: How to check the random letters from a-z, out of 10 letters minimum 2 letter should be a vowel

    - by kalandar
    I am writing a program to validate the following scenarios: Scenario 1: I am using the Random class from java.util. The random class will generate 10 letters from a-z and within 10 letter, minimum 2 letters must be a vowels. Scenario 2: When the player 1 and player 2 form a word from A-Z, he will score some points. There will be a score for each letter. I have already assigned the values for A-Z. At the end of the game, the system should display a scores for player 1 and player 2. How do i do it? Please help. I will post my code here. Thanks a lot. =========================================== import java.util.Random; import java.util.Scanner; public class FindYourWords { public static void main(String[] args) { Random rand = new Random(); Scanner userInput = new Scanner(System.in); //==================Player object=============================================== Player playerOne = new Player(); playerOne.wordScore = 0; playerOne.choice = "blah"; playerOne.turn = true; Player playerTwo = new Player(); playerTwo.wordScore = 0; playerTwo.choice = "blah"; playerTwo.turn = false; //================== Alphabet ================================================== String[] newChars = { "a", "b", "c", "d", "e", "f", "g", "h", "i", "j", "k", "l", "m", "n", "o", "p", "q", "r", "s", "t", "u", "v", "w", "x", "y", "z" }; //values of the 26 alphabets to be used int [] letterScore = {1,3,3,2,1,4,2,4,1,8,5,1,3,1,1,3,10,1,1,1,1,4,4,8,4,10}; // to assign score to the player1 and player 2 String[] vowel = { "a", "e", "i", "o", "u" }; // values for vowels int vow=0; System.out.println("FINDYOURWORDS\n"); int[] arrayRandom = new int[10]; //int array for word limiter String[] randomLetter = new String[10]; //storing the letters in newChars into this array //=============================================================================== boolean cont = true; while (cont) { if (playerOne.turn) { System.out.print("Letters of Player 1: "); } else if (!playerOne.turn) { System.out.print("Letters of Player 2: "); } for (int i = 0; i < arrayRandom.length; i++) { //running through the array limiter int r = rand.nextInt(newChars.length); //assigning random nums to the array of letters randomLetter[i] = newChars[r]; System.out.print(randomLetter[i]+ " "); } //input section for player System.out.println(""); System.out.println("Enter your word (or '@' to pass or '!' to quit): "); if (playerOne.turn) { playerOne.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = false; } else if (!playerOne.turn){ playerTwo.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = true; } //System.out.println(choice); String[] wordList = FileUtil.readDictFromFile("words.txt"); //Still dunno what this is for if (playerOne.choice.equals("@")) { playerOne.turn = false; } else if (playerTwo.choice.equals("@")) { playerOne.turn = true; } else if (playerOne.choice.equals("!")) { cont = false; } for (int i = 0; i < wordList.length; i++) { //System.out.println(wordList[i]); if (playerOne.choice.equalsIgnoreCase(wordList[i]) || playerTwo.choice.equalsIgnoreCase(wordList[i])){ } } } }}

    Read the article

  • Write a C++ program to encrypt and decrypt certain codes.

    - by Amber
    Step 1: Write a function int GetText(char[],int); which fills a character array from a requested file. That is, the function should prompt the user to input the filename, and then read up to the number of characters given as the second argument, terminating when the number has been reached or when the end of file is encountered. The file should then be closed. The number of characters placed in the array is then returned as the value of the function. Every character in the file should be transferred to the array. Whitespace should not be removed. When testing, assume that no more than 5000 characters will be read. The function should be placed in a file called coding.cpp while the main will be in ass5.cpp. To enable the prototypes to be accessible, the file coding.h contains the prototypes for all the functions that are to be written in coding.cpp for this assignment. (You may write other functions. If they are called from any of the functions in coding.h, they must appear in coding.cpp where their prototypes should also appear. Do not alter coding.h. Any other functions written for this assignment should be placed, along with their prototypes, with the main function.) Step 2: Write a function int SimplifyText(char[],int); which simplifies the text in the first argument, an array containing the number of characters as given in the second argument, by converting all alphabetic characters to lower case, removing all non-alpha characters, and replacing multiple whitespace by one blank. Any leading whitespace at the beginning of the array should be removed completely. The resulting number of characters should be returned as the value of the function. Note that another array cannot appear in the function (as the file does not contain one). For example, if the array contained the 29 characters "The 39 Steps" by John Buchan (with the " appearing in the array), the simplified text would be the steps by john buchan of length 24. The array should not contain a null character at the end. Step 3: Using the file test.txt, test your program so far. You will need to write a function void PrintText(const char[],int,int); that prints out the contents of the array, whose length is the second argument, breaking the lines to exactly the number of characters in the third argument. Be warned that, if the array contains newlines (as it would when read from a file), lines will be broken earlier than the specified length. Step 4: Write a function void Caesar(const char[],int,char[],int); which takes the first argument array, with length given by the second argument and codes it into the third argument array, using the shift given in the fourth argument. The shift must be performed cyclicly and must also be able to handle negative shifts. Shifts exceeding 26 can be reduced by modulo arithmetic. (Is C++'s modulo operations on negative numbers a problem here?) Demonstrate that the test file, as simplified, can be coded and decoded using a given shift by listing the original input text, the simplified text (indicating the new length), the coded text and finally the decoded text. Step 5: The permutation cypher does not limit the character substitution to just a shift. In fact, each of the 26 characters is coded to one of the others in an arbitrary way. So, for example, a might become f, b become q, c become d, but a letter never remains the same. How the letters are rearranged can be specified using a seed to the random number generator. The code can then be decoded, if the decoder has the same random number generator and knows the seed. Write the function void Permute(const char[],int,char[],unsigned long); with the same first three arguments as Caesar above, with the fourth argument being the seed. The function will have to make up a permutation table as follows: To find what a is coded as, generate a random number from 1 to 25. Add that to a to get the coded letter. Mark that letter as used. For b, generate 1 to 24, then step that many letters after b, ignoring the used letter if encountered. For c, generate 1 to 23, ignoring a or b's codes if encountered. Wrap around at z. Here's an example, for only the 6 letters a, b, c, d, e, f. For the letter a, generate, from 1-5, a 2. Then a - c. c is marked as used. For the letter b, generate, from 1-4, a 3. So count 3 from b, skipping c (since it is marked as used) yielding the coding of b - f. Mark f as used. For c, generate, from 1-3, a 3. So count 3 from c, skipping f, giving a. Note the wrap at the last letter back to the first. And so on, yielding a - c b - f c - a d - b (it got a 2) e - d f - e Thus, for a given seed, a translation table is required. To decode a piece of text, we need the table generated to be re-arranged so that the right hand column is in order. In fact you can just store the table in the reverse way (e.g., if a gets encoded to c, put a opposite c is the table). Write a function called void DePermute(const char[],int,char[], unsigned long); to reverse the permutation cypher. Again, test your functions using the test file. At this point, any main program used to test these functions will not be required as part of the assignment. The remainder of the assignment uses some of these functions, and needs its own main function. When submitted, all the above functions will be tested by the marker's own main function. Step 6: If the seed number is unknown, decoding is difficult. Write a main program which: (i) reads in a piece of text using GetText; (ii) simplifies the text using SimplifyText; (iii) prints the text using PrintText; (iv) requests two letters to swap. If we think 'a' in the text should be 'q' we would type aq as input. The text would be modified by swapping the a's and q's, and the text reprinted. Repeat this last step until the user considers the text is decoded, when the input of the same letter twice (requesting a letter to be swapped with itself) terminates the program. Step 7: If we have a large enough sample of coded text, we can use knowledge of English to aid in finding the permutation. The first clue is in the frequency of occurrence of each letter. Write a function void LetterFreq(const char[],int,freq[]); which takes the piece of text given as the first two arguments (same as above) and returns in the 26 long array of structs (the third argument), the table of the frequency of the 26 letters. This frequency table should be in decreasing order of popularity. A simple Selection Sort will suffice. (This will be described in lectures.) When printed, this summary would look something like v x r s z j p t n c l h u o i b w d g e a q y k f m 168106 68 66 59 54 48 45 44 35 26 24 22 20 20 20 17 13 12 12 4 4 1 0 0 0 The formatting will require the use of input/output manipulators. See the header file for the definition of the struct called freq. Modify the program so that, before each swap is requested, the current frequency of the letters is printed. This does not require further calls to LetterFreq, however. You may use the traditional order of regular letter frequencies (E T A I O N S H R D L U) as a guide when deciding what characters to exchange. Step 8: The decoding process can be made more difficult if blank is also coded. That is, consider the alphabet to be 27 letters. Rewrite LetterFreq and your main program to handle blank as another character to code. In the above frequency order, space usually comes first.

    Read the article

  • Strange problem with simple multithreading program in Java

    - by Elizabeth
    Hello, I am just starting play with multithreading programming. I would like to my program show alternately character '-' and '+' but it doesn't. My task is to use synchronized keyword. As far I have: class FunnyStringGenerator{ private char c; public FunnyStringGenerator(){ c = '-'; } public synchronized char next(){ if(c == '-'){ c = '+'; } else{ c = '-'; } return c; } } class ThreadToGenerateStr implements Runnable{ FunnyStringGenerator gen; public ThreadToGenerateStr(FunnyStringGenerator fsg){ gen = fsg; } @Override public void run() { for(int i = 0; i < 10; i++){ System.out.print(gen.next()); } } } public class Main{ public static void main(String[] args) throws IOException { FunnyStringGenerator FSG = new FunnyStringGenerator(); ExecutorService exec = Executors.newCachedThreadPool(); for(int i = 0; i < 20; i++){ exec.execute(new ThreadToGenerateStr(FSG)); } } } EDIT: I also testing Thread.sleep in run method instead for loop.

    Read the article

  • BFS algorithm problem

    - by Gorkamorka
    The problem is as follows: A wanderer begins on the grid coordinates (x,y) and wants to reach the coordinates (0,0). From every gridpoint, the wanderer can go 8 steps north OR 3 steps south OR 5 steps east OR 6 steps west (8N/3S/5E/6W). How can I find the shortest route from (X,Y) to (0,0) using breadth-first search? Clarifications: Unlimited grid Negative coordinates are allowed A queue (linked list or array) must be used No obstacles present

    Read the article

  • Perl : how to interrupt/resume loop by user hitting a key?

    - by Michael Mao
    Hi all: This is for debugging purpose. I've got a for loop that generates some output to Cygwin bash's CLI. I know that I can redirect outputs to text files and use Perl or even just a normal text editor to inspect the values printed out for a particular iteration, just feel that a bit painful. What I am now thinking is, to place a special subroutine inside the for loop, so that it would be "interrupted" at the beginning of each iteration, and Perl script should only resume to run after user/programmer hits a key(the Enter Key from keyboard?) In this way I can directly inspect the values printed out during each iteration. Is there a simple way to do this, without using additional libraries/CPAN ? Many thanks to the hints/suggestions in advance.

    Read the article

  • calling a function from another function in python

    - by user1040503
    I have written this function that takes to strings in order to see if they are anagrams: def anagram_check(str_x, str_y): x = string1.replace(" ","") y = string2.replace(" ","") lower1 = x.lower() lower2 = y.lower() sorted1 = sorted(lower1) sorted2 = sorted(lower2) if sorted1 == sorted2: return True else: return False this function works fine, the problem is that now I need to use this function in another function in order to find anagrams in a text file. I want to print a list of tuples with all the anagrams in it. this is what i have done so far def anagrams_finder(words_num): anagrams = [] f = open("words.txt") a = list(f) list1 = ([s.replace('\n', '') for s in a]) list2 = ([i.lower() for i in list1]) list3 = list2[0:words_num] #number of words from text that need to be checked. for i in list3: .... I tried using for loops, while loops, appand.... but nothing seems to work. how can I use the first function in order to help me with the second? Please help...

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • asking the container to notify your application whenever a session is about to timeout in Java

    - by user136101
    Which method(s) can be used to ask the container to notify your application whenever a session is about to timeout?(choose all that apply) A. HttpSessionListener.sessionDestroyed -- correct B. HttpSessionBindingListener.valueBound C. HttpSessionBindingListener.valueUnbound -- correct this is kind of round-about but if you have an attribute class this is a way to be informed of a timeout D. HttpSessionBindingEvent.sessionDestroyed -- no such method E. HttpSessionAttributeListener.attributeRemoved -- removing an attribute isn’t tightly associated with a session timeout F. HttpSessionActivationListener.sessionWillPassivate -- session passivation is different than timeout I agree with option A. 1) But C is doubtful How can value unbound be tightly coupled with session timeout.It is just the callback method when an attribute gets removed. 2) and if C is correct, E should also be correct. HttpSessionAttributeListener is just a class that wants to know when any type of attribute has been added, removed, or replaced in a session. It is implemented by any class. HttpSessionBindingListener exists so that the attribute itself can find out when it has been added to or removed from a session and the attribute class must implement this interface to achieve it. Any ideas…

    Read the article

  • Find if there is an element repeating itself n/k times

    - by gleb-pendler
    You have an array size n and a constant k (whatever) You can assume the the array is of int type (although it could be of any type) Describe an algorithm that finds if there is an element(s) that repeats itself at least n/k times... if there is return one. Do so in linear time (O(n)) The catch: do this algorithm (or even pseudo-code) using constant memory and running over the array only twice

    Read the article

  • Calculate Age, Given Date of Birth

    - by bond
    Given a date of birth, how would I go about calculating an age in C? For example, if today's date is 20/04/2010 and the date of birth given is 12/08/86, then age will be 23 years, 8 months, and 8 days. Any suggestions would be appreciated. Thanks!

    Read the article

  • Recursive function for a binary search in C++

    - by boomsnack
    Create a recursive function for the binary search. This function accepts a sorted array and a give item being search for and returns the index of the item if this give item in the array or returns -1 if this give item is not in the array. Moreover, write a test program to test your function. Sorry for the bad english but my teacher can not write it or speak it very well. This is for a final project and determines whether I graduate or not I went to the tutor and he did not know how to do it either. Any help is greatly appreicated.

    Read the article

  • Why isn't this file reading/writing program working?

    - by user320950
    This program is supposed to read files and write them. I took the file open checks out because they kept causing errors. The problem is that the files open like they are supposed to and the names are correct but nothing is on any of the text screens. Do you know what is wrong? #include<iostream> #include<fstream> #include<cstdlib> #include<iomanip> using namespace std; int main() { ifstream in_stream; // reads itemlist.txt ofstream out_stream1; // writes in items.txt ifstream in_stream2; // reads pricelist.txt ofstream out_stream3;// writes in plist.txt ifstream in_stream4;// read recipt.txt ofstream out_stream5;// write display.txt float price=' ',curr_total=0.0; int wrong=0; int itemnum=' '; char next; in_stream.open("ITEMLIST.txt", ios::in); // list of avaliable items out_stream1.open("listWititems.txt", ios::out); // list of avaliable items in_stream2.open("PRICELIST.txt", ios::in); out_stream3.open("listWitdollars.txt", ios::out); in_stream4.open("display.txt", ios::in); out_stream5.open("showitems.txt", ios::out); in_stream.close(); // closing files. out_stream1.close(); in_stream2.close(); out_stream3.close(); in_stream4.close(); out_stream5.close(); system("pause"); in_stream.setf(ios::fixed); while(in_stream.eof()) { in_stream >> itemnum; cin.clear(); cin >> next; } out_stream1.setf(ios::fixed); while (out_stream1.eof()) { out_stream1 << itemnum; cin.clear(); cin >> next; } in_stream2.setf(ios::fixed); in_stream2.setf(ios::showpoint); in_stream2.precision(2); while((price== (price*1.00)) && (itemnum == (itemnum*1))) { while (in_stream2 >> itemnum >> price) // gets itemnum and price { while (in_stream2.eof()) // reads file to end of file { in_stream2 >> itemnum; in_stream2 >> price; price++; curr_total= price++; in_stream2 >> curr_total; cin.clear(); // allows more reading cin >> next; } } } out_stream3.setf(ios::fixed); out_stream3.setf(ios::showpoint); out_stream3.precision(2); while((price== (price*1.00)) && (itemnum == (itemnum*1))) { while (out_stream3 << itemnum << price) { while (out_stream3.eof()) // reads file to end of file { out_stream3 << itemnum; out_stream3 << price; price++; curr_total= price++; out_stream3 << curr_total; cin.clear(); // allows more reading cin >> next; } return itemnum, price; } } in_stream4.setf(ios::fixed); in_stream4.setf(ios::showpoint); in_stream4.precision(2); while ( in_stream4.eof()) { in_stream4 >> itemnum >> price >> curr_total; cin.clear(); cin >> next; } out_stream5.setf(ios::fixed); out_stream5.setf(ios::showpoint); out_stream5.precision(2); out_stream5 <<setw(5)<< " itemnum " <<setw(5)<<" price "<<setw(5)<<" curr_total " <<endl; // sends items and prices to receipt.txt out_stream5 << setw(5) << itemnum << setw(5) <<price << setw(5)<< curr_total; // sends items and prices to receipt.txt out_stream5 << " You have a total of " << wrong++ << " errors " << endl; }

    Read the article

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • how to demonstrate that a protocol is certain with those specifications.

    - by kawtousse
    Hi every one, we have 4 persons A, B, C and D witch want to know the averge of their salary SA SB SC SD but no one wants that the others know his salary. For that they use this protocol: A-B: [N+SA ]KB B-C:[N+SA+SB]KC C-D:[N+SA+SB+SC]KD D-A:[N+SA+SB+SC+SD]KA where the notation [m]KY represents the message x crypted xith the public key of y Is this protocol certain. can we trust it. want you please give me justification. thanks for help.

    Read the article

  • Help me find some good 'Reflection' reading materials??

    - by IbrarMumtaz
    If it wasn't you guys I would've never discovered Albahari.com's free threading ebook. My apologies if I come off as being extremely lazy but I need to make efficient use of my time and make sure am not just swallowing any garbage of the web. Therefore I am looking for the best and most informative and with a fair bit of detail for the Reflection chapter in .Net. Reflection is something that comes up time and time again and I want to extend my reading from what I know already from the official 70-536 book. I'm not a big fan of MSDN but at the moment that's al I'm using. Anyone got any other good published reading material off the inter web that can help revision for the entrance exam??? Would be greatly appreciated !!! Thanks in Advance, Ibrar

    Read the article

  • mv() while reading

    - by K'
    on Linux ext3 filesystem, what happens if mv() is called on the same file (file descriptor) while reading the file? It is actually an exam question and I can only say something like: CPU traps OS for interrupt handling etc, etc. I would appreciate if OS guys out there can help me out, please :D

    Read the article

  • Socket programming question

    - by dfddf
    I am given the following declaration: char inbuff[500], *ptr; int n, bufferlen; Write a program segement to receive a message having 500 bits from the TCP socket sock and store this message in inbuff. My answer is: n = recv( sock, inbuff, strlen( inbuff ), 0 ); However, I am not sure why *ptr is given in the declaration. So, I would like ask, what is the purpose of the pointer in this question?? Or my program segement is wrong? Thank you for all of yours help first!

    Read the article

  • Read from cin or a file

    - by m42a
    When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

    Read the article

  • JApplet behaving unexpectedly

    - by JohnW
    import java.awt.Graphics; import java.awt.Image; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import javax.swing.JApplet; import javax.swing.Timer; public class CountingSheep extends JApplet { private Image sheepImage; private Image backgroundImage; private GameBoard gameBoard; private scoreBoard scoreBoard; public void init() { loadImages(); gameBoard = new GameBoard(sheepImage, backgroundImage); scoreBoard = new scoreBoard(); getContentPane().add(gameBoard); getContentPane().add(scoreBoard); } public void loadImages() { sheepImage = getImage(getDocumentBase(), "sheep.png"); backgroundImage = getImage(getDocumentBase(), "bg.jpg"); } } Update guys: Alright, first of all, thank you very much for all the help you've given so far (specifically creemam and Hovercraft Full of Eels), and your persistence. You've helped me out a lot as this is incredibly important (i.e. me passing my degree). The problem now is: The program works correctly when nothing but the GameBoard class is added to the JApplet, however, when I try to add the ScoreBoard class, both Panel classes do not show on the Applet. I'm guessing this is now down to positioning? Any ideas? EDIT: Gone back to the previously asked question Hovercraft, and found it was due to the layout of the contentPane and the order at with the components were added. Thanks to all of you so much. People like you make the development community a bit of alright.

    Read the article

  • Passing an array of structs in C

    - by lelouch
    I'm having trouble passing an array of structs to a function in C. I've created the struct like this in main: int main() { struct Items { char code[10]; char description[30]; int stock; }; struct Items MyItems[10]; } I then access it like: MyItems[0].stock = 10; etc. I want to pass it to a function like so: ReadFile(MyItems); The function should read the array, and be able to edit it. Then I should be able to access the same array from other functions. I've tried heaps of declarations but none of them work. e.g. void ReadFile(struct Items[10]) I've had a look around for other questions, but the thing is they're all done different, with typedefs and asterisks. My teacher hasn't taught us pointers yet, so I'd like to do it with what I know. Any ideas? :S EDIT: Salvatore's answer is working after I fixed my prototype to: void ReadFile(struct Items[9]);

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • Recursive QuickSort suffering a StackOverflowException -- Need fresh eyes

    - by jon
    I am working on a Recursive QuickSort method implementation in a GenericList Class. I will have a second method that accepts a compareDelegate to compare different types, but for development purposes I'm sorting a GenericList<int I am recieving stackoverflow areas in different places depending on the list size. I've been staring at and tracing through this code for hours and probably just need a fresh pair of (more experienced)eyes. Definitely wanting to learn why it is broken, not just how to fix it. public void QuickSort() { int i, j, lowPos, highPos, pivot; GenericList<T> leftList = new GenericList<T>(); GenericList<T> rightList = new GenericList<T>(); GenericList<T> tempList = new GenericList<T>(); lowPos = 1; highPos = this.Count; if (lowPos < highPos) { pivot = (lowPos + highPos) / 2; for (i = 1; i <= highPos; i++) { if (this[i].CompareTo(this[pivot]) <= 0) leftList.Add(this[i]); else rightList.Add(this[i]); } leftList.QuickSort(); rightList.QuickSort(); for(i=1;i<=leftList.Count;i++) tempList.Add(leftList[i]); for(i=1;i<=rightList.Count;i++) tempList.Add(rightList[i]); this.items = tempList.items; this.count = tempList.count; } }

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >