Search Results

Search found 4616 results on 185 pages for 'strings'.

Page 28/185 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Error in merging two sequences of timestamps to yield strings

    - by AruniRC
    The code sorts two input sequences - seq01 and seq02 - on the basis of their timestamp values and returns a sequence that denotes which sequence is to be read for the values to be in order. For cases where seq02's timestamp value is lesser than seq01's timestamp value we yield a "2" to the sequence being returned, else a "1". These denote whether at that point seq01 is to be taken or seq02 is to be taken for the data to be in order (by timestamp value). let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let _,_,time01 = iter01.Current let _,_,time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } To test it in the FSI created two sequences a and b, a={1;3;5;...} and b={0;2;4;...}. So the expected values for let c = mergeSeq a b would have been {"2","1","2","1"...}. However I am getting this error: error FS0001: The type ''a * 'b * 'c' does not match the type 'int' EDIT After correcting: let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let time01 = iter01.Current let time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } After running this, there's another error: call MoveNext. Somehow the iteration is not being performed.

    Read the article

  • PHP: Condense array of similar strings into one merged array

    - by Matt Andrews
    Hi everyone. Working with an array of dates (opening times for a business). I want to condense them to their briefest possible form. So far, I started out with this structure Array ( [Mon] => 12noon-2:45pm, 5:30pm-10:30pm [Tue] => 12noon-2:45pm, 5:30pm-10:30pm [Wed] => 12noon-2:45pm, 5:30pm-10:30pm [Thu] => 12noon-2:45pm, 5:30pm-10:30pm [Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) What I want to achieve is this: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) I've tried writing a recursive function and have managed to output this so far: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Tue-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Wed-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Thu-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) Can anybody see a simple way of comparing the values and combining the keys where they're similar? My recursive function is basically two nested foreach() loops - not very elegant. Thanks, Matt EDIT: Here's my code so far, which produces the 3rd array above (from the first one as input): $last_time = array('t' => '', 'd' => ''); // blank array for looping $i = 0; foreach($final_times as $day=>$time) { if($last_time['t'] != $time ) { // it's a new time if($i != 0) { $print_times[] = $day . ' ' . $time; } // only print if it's not the first, otherwise we get two mondays } else { // this day has the same time as last time $end_day = $day; foreach($final_times as $day2=>$time2) { if($time == $time2) { $end_day = $day2; } } $print_times[] = $last_time['d'] . '-' . $end_day . ' ' . $time; } $last_time = array('t' => $time, 'd' => $day); $i++; }

    Read the article

  • Strings exported from a module have extra line breaks

    - by Jesse Millikan
    In a DrScheme project, I'm using a MrEd editor-canvas% with text% and inserting a string from a literal in a Scheme file. This results in an extra blank line in the editor for each line of text I'm trying to insert. I've tracked this down to the apparent fact that string literals from outside modules are getting extra line breaks. Here's a full example. The editor is irrelevant at this point, but it displays the result. ; test-literals.ss (module test-literals scheme (provide (all-defined-out)) (define exported-string "From another module with some more line breaks. ")) ; editor-test.ss (module editor-test scheme (require mred "test-literals.ss") (define w (instantiate frame% ("Editor Test" #f) )) (define c (instantiate editor-canvas% (w) (line-count 12) (min-width 400))) (define editor (instantiate text% ())) (send c set-editor editor) (send w show #t) (send editor erase) (send editor insert "Some text with some line breaks. ") (send editor insert exported-string)) And the result in the editor is Some text with some line breaks. From another module with some more line breaks.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • MS-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except and . Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fecth every row, process it and update the database but I'm guessing this is possible to do in SQL directly. Thanks, Stefan

    Read the article

  • Where can I learn about JNDI strings?

    - by ferrari fan
    How do you know how to form a JNDI string? I know there must be a format and that the divisions must mean something but I haven't been able to find a good resource that explains them. For example: java:comp/env/wm/default. This is supposed to connect to a WorkManager in Websphere with the name of default. But what does the "java", "comp", "env" mean? I know what the wm/default mean because that's the JNDI name put in the WorkManager, but what does the rest mean? Thanks

    Read the article

  • WatiN Testing and Connection Strings Fiasco

    - by azamsharp
    I have a separate project which performs watiN tests. The project is in the form of class library project. When I run test it launches the browser and then uses the Web.config of the Web Application Project which I am testing. The Web.config of web application project has the Dev connection string which should not be used for testing. What are different ways that I can take and tell my WatiN to use the App.config that is inside the WatiN project and not the Web application project? Here are couple of options that I have: 1) Replace the connection string at runtime. 2) Replace the connection string at pre-build event or something.

    Read the article

  • Interning strings in Java

    - by Tiny
    The following segment of code interns a string. String str1="my"; String str2="string"; String concat1=str1+str2; concat1.intern(); System.out.println(concat1=="mystring"); The expression concat1=="mystring" returns true because concat1 has been interned. If the given string mystring is changed to string as shown in the following snippet. String str11="str"; String str12="ing"; String concat11=str11+str12; concat11.intern(); System.out.println(concat11=="string"); The comparison expression concat11=="string" returns false. The string held by concat11 doesn't seem to be interned. What am I overlooking here? I have tested on Java 7, update 11.

    Read the article

  • Problem with parsing strings

    - by Peter Small
    I am trying to put a line of dialog on each of a series of images. To match the dialog line with the correct image, I end each line with a forward slash (/) followed by a number to identify the matching image. I then parse each line to get the dialog and then the reference number for the image. It all works fine except that when I put the dialog line into a textView I get the whole line in the textView instead of the dialog part. What is confusing is that the console seems to indicate that the parsing of the dialog line has been carried out correctly. Here are the details of my coding: @interface DialogSequence_1ViewController : UIViewController { IBOutlet UIImageView *theImage; IBOutlet UITextView *fullDialog; IBOutlet UITextView *selectedDialog; IBOutlet UIButton *test_1; IBOutlet UIButton *test_2; IBOutlet UIButton *test_3; NSArray *arrayLines; IBOutlet UISlider *readingSpeed; NSArray *cartoonViews; NSMutableString *dialog; NSMutableArray *dialogLineSections; int lNum; } @property (retain,nonatomic) UITextView *fullDialog; @property (retain,nonatomic) UITextView *selectedDialog; @property (retain,nonatomic) UIButton *test_1; @property (retain,nonatomic) UIButton *test_2; @property (retain,nonatomic) UIButton *test_3; @property (retain,nonatomic) NSArray *arrayLines; @property (retain,nonatomic) NSMutableString *dialog; @property (retain,nonatomic) NSMutableArray *dialogLineSections; @property (retain,nonatomic) UIImageView *theImage; @property (retain,nonatomic) UISlider *readingSpeed; -(IBAction)start:(id)sender; -(IBAction)counter:(id)sender; -(IBAction)runNextLine:(id)sender; @end @implementation DialogSequence_1ViewController @synthesize fullDialog; @synthesize selectedDialog; @synthesize test_1; @synthesize test_2; @synthesize test_3; @synthesize arrayLines; @synthesize dialog; @synthesize theImage; @synthesize readingSpeed; @synthesize dialogLineSections; -(IBAction)runNextLine:(id)sender{ //Get dialog line to display from the arrayLines array NSMutableString *dialogLineDetails; dialogLineDetails =[arrayLines objectAtIndex:lNum]; NSLog(@"dialogLineDetails = %@",dialogLineDetails); //Parse the dialog line dialogLineSections = [dialogLineDetails componentsSeparatedByString: @"/"]; selectedDialog.text =[dialogLineSections objectAtIndex: 0]; NSLog(@"Dialog part of line = %@",[dialogLineSections objectAtIndex: 0]); NSMutableString *imageBit; imageBit = [dialogLineSections objectAtIndex: 1]; NSLog(@"Image code = %@",imageBit); //Select right image int im = [imageBit intValue]; NSLog(@"imageChoiceInteger = %i",im); //------more code } I get a warning on the line: dialogLineSections = [dialogLineDetails componentsSeparatedByString: @"/"]; warning: incompatible Objective-C types assigning 'struct NSArray *', expected 'struct NSMutableArray *' I don't quite understand this and have tried to change the types but to no avail. Would be grateful for some advice here.

    Read the article

  • Scrubyt: Using big5 strings in query_field for fill_textfield

    - by kuribo
    Does anyone know of a way to get fill_textfield to accept a big5-encoded string in the query_field? I keep getting an "unterminated string meets end of file" error with this: require 'rubygems' require 'scrubyt' search_data = Scrubyt::Extractor.define do fetch 'http://www.google.com/ncr' fill_textfield 'q', '????' submit end

    Read the article

  • how do i read strings from text files?

    - by ratty
    I like to read string from text file the text file consists of information below con = new MySqlConnection("server=localhost;user id=root; password=""; database=workplantype; pooling=false;"); i like to read server name such as"localhost" here and user id such as"root" here,how can i read this.

    Read the article

  • Java if statement strings and more

    - by user1820578
    I have decided to try and learn a little in java tonight and i have just been trying some stuff with things i have learned. My question is in an if statement how to i make two stings to be true. Here is what i have so far. if ("male".equals(gender)) && ("brendan".equals(name)) the problem i am pretty sure is the && but i am not sure. also my other question is with gender it should either be male or female. I want to have if statement with male and another for female. For this do i just do another if. For eg if ("male".equals(gender)) && ("brendan".equals(name)) { System.out.println("blah blah"); } else { System.out.println(" wrong wrong"); } if ("female".equals(gender)) { System.out.println("blah blah2"); } else { System.out.println(" wrong wrong 2"); } hope that makes sense. Any help would be great.

    Read the article

  • Replace whitespaces using PHP preg_replace function ignoring quoted strings

    - by Saiful
    Look at the following string: SELECT column1 , column2, column3 FROM table1 WHERE column1 = 'text, "FROM" \'from\\\' x' AND column2 = "sample text 'where' \"where\\\" " AND ( column3 = 5 ) I need to escape unnecessary white space characters from the string like: removing white space from beginning and ending position of , ( ) etc removing newline (\r\n) and tabs (\t) But one thing. The remove process could not remove white spaces from the quoted string like: 'text, "FROM" \'from\\' x' "sample text 'where' \"where\\" " etc. i need to use the PHP function: preg_replace($pattern, $replacement, $string); So what will be the value of $pattern and $replacement where the value of $string is the given SQL.

    Read the article

  • Javascript: Passing large objects or strings between function considered a bad practice

    - by Mr. Smee
    Is it considered a bad practice to pass around a large string or object (lets say from an ajax response) between functions? Would it be beneficial in any way save the response in a variable and keep reusing that variable? So in the code it would be something like this: var response; $.post(url, function(resp){ response = resp; }) function doSomething() { // do something with the response here } vs $.post(url, function(resp){ doSomething(resp); }) function doSomething(resp) { // do something with the resp here } Assume resp is a large object or string and it can be passed around between multiple functions.

    Read the article

  • IComparer for integers with and empty strings at end

    - by paulio
    Hi, I've written the following IComparer but I need some help. I'm trying to sort a list of numbers but some of the numbers may not have been filled in. I want these numbers to be sent to the end of the list at all times.. for example... [EMPTY], 1, [EMPTY], 3, 2 would become... 1, 2, 3, [EMPTY], [EMPTY] and reversed this would become... 3, 2, 1, [EMPTY], [EMPTY] Any ideas? public int Compare(ListViewItem x, ListViewItem y) { int comparison = int.MinValue; ListViewItem.ListViewSubItem itemOne = x.SubItems[subItemIndex]; ListViewItem.ListViewSubItem itemTwo = y.SubItems[subItemIndex]; if (!string.IsNullOrEmpty(itemOne.Text) && !string.IsNullOrEmpty(itemTwo.Text)) { uint itemOneComparison = uint.Parse(itemOne.Text); uint itemTwoComparison = uint.Parse(itemTwo.Text); comparison = itemOneComparison.CompareTo(itemTwoComparison); } else { // ALWAYS SEND TO BOTTOM/END OF LIST. } // Calculate correct return value based on object comparison. if (OrderOfSort == SortOrder.Descending) { // Descending sort is selected, return negative result of compare operation. comparison = (-comparison); } else if (OrderOfSort == SortOrder.None) { // Return '0' to indicate they are equal. comparison = 0; } return comparison; } Cheers.

    Read the article

  • DateTime Format Strings?

    - by Phil
    I have the date format string dd-mm-yy. Please can you tell me how to add hours and minutes to the string (i.e 13-03-2010.21.03) .... DateTime.Today.ToString("dd-mm-yy") ?

    Read the article

  • Structure's with strings and input

    - by Beginnernato
    so i have the following structure and function that add's things to the function - struct scoreentry_node { struct scoreentry_node *next; int score; char* name; } ; typedef struct scoreentry_node *score_entry; score_entry add(int in, char* n, score_entry en) { score_entry r = malloc(sizeof(struct scoreentry_node)); r->score = in; r->name = n; r->next = en; return r; } i have input that take it in the following main file: int score; char name[]; int main(void) { score_entry readin = NULL; while(1) { scanf("%s%d", name, &score); readin = add(score, name, readin); // blah blah I dont know why but when input a name it gets added to readin, but when i input another name all the name's in readin have this new name for example: input: bob 10 readin = 10 bob NULL jill 20 readin = 20 jill 10 jill NULL I dont know why bob disappear's... any reason why it does that ?

    Read the article

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • NSStrings, C strings, pathnames and encodings in iPhone

    - by iter
    I am using libxml2 in my iPhone app. I have an NSString that holds the pathname to an XML file. The pathname may include non-ASCII characters. I want to get a C string representation of the NSString for to pass to xmlReadFile(). It appears that cStringUsingEncoding gives me the representation I seek. I am not clear on which encoding to use. I wonder if there is a "default" encoding in iPhone OS that I can use here and ensure that I can roundtrip non-ASCII pathnames.

    Read the article

  • Comparing two ISO8601 dates strings in PHP

    - by oompahloompah
    I need to compare (actually rank/sort) dates in a PHP script. The dates are ISO-8601 Date format i.e. YYYY-MM-DD I wrote a comparison function which splits the dates and compares by year/month/day. However, it seems this may be overkill and I could just as easily done a simple string comparison like: if ($date1 < $date2) // do something elseif( $date1 > $date2) //do something else else //do yet another thing Is my assumption about (ISO-8601) Date string comparison correct - i.e. can I get rid of my function (to save a few clock cycles on the server), or is it safer to explicity do the comparison in a custom function?

    Read the article

  • More elegant way to parse inline variables in strings

    - by Tom
    Currently I have this: function parse_string($string, $variables){ extract($variables); return eval('return "'. addcslashes($string, '"') .'";'); } So I can input this string: 'Hi {$name}, my name is {$own_name}' Together with this array: array('name' => 'John', 'own_name' => 'Tom') And get this back: 'Hi John, my name is Tom'   I've never liked this eval() approach but it works and it's fast (faster than regex at least). Question: Is there a more elegant way to do this (faster than using regex) in PHP5?

    Read the article

  • regex pattern to match only strings that don't contain spaces PHP

    - by Jamex
    Hi, I want to match the word/pattern that is contained in the variable, but only match against the words that don't have white spaces. Please give suggestions. $var = 'look'; $array = ('look', 'greatlook', 'lookgreat', 'look great', 'badlook', 'look bad', 'look ', ' look'); matches words: look, greatlook, lookgreat, badlook non matches: look great, bad look, look (trailing space(s)), (space(s)) look. The syntax of the below functions are OK, but it matches everything $match = preg_grep ("/$var/", $array); $match = preg_grep ("/^$var/", $array); (match words with 'look' at the start) but when I include the [^\s], it gives an error $match = preg_grep ("/$var[^\s]/", $array); Parse error: syntax error, unexpected '^', expecting T_STRING or T_VARIABLE TIA

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >