Search Results

Search found 7418 results on 297 pages for 'argument passing'.

Page 281/297 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • Solr Facet Search spring-data-solr

    - by sv1
    I am new to Solr and we are using Spring-data for Solr I have a question may be its too simple but I am unable to comprehend. Basically I need to search on any field but I have a "zip" field as one of the facet fields. I have a Solr repository . (Am not sure if the annotations on the Repository are correct.) public interface MyRepository extends SolrCrudRepository<MyPOJO, String> { @Query(value = "*:*") @Facet(fields={"zip"}) public FacetPage<MyPOJO> findByQueryandAnno(String searchTerm,Pageable page); } In my Service class I am trying to call this methods by Injecting MyRepository like below public class MyService { @Inject MyRepository solrRepo; @Inject SolrTemplate solrTemplate; public FacetPage<MyPOJO> tryFacets(String searchString){ //Here is where I am struggling SimpleFacetQuery query = new SimpleQuery(new SimpleStringCriteria(searchString)); query.setFacetOptions(new FacetOptions("zip")); //Not sure how to get the Pageable object. //But the repository doesnt accept without it. return solrTemplate.queryForPage(query,{Pageable Instance to be passed here}) } From my jUnit I am loading context files needed for Solr and Spring //In jUnit the test method looks like this service.tryFacets("some value"); and it fails with - method not found in the service class at the call to the repository method. *********EDIT**************** As per ChristophStrobl's advice created a copyfield called multivaluedCopyField and the searchString argument works good. But the facet still isnt working...Now my code looks like this. I get the MyPOJO object as response but the facetcount and the faceted values are missing. public interface MyRepository extends SolrCrudRepository<MyPOJO, String> { @Query(value = "*:*") @Facet(fields={"zip"}) public FacetPage<MyPOJO> findByQueryandAnno(String searchTerm,Pageable page); } My service class looks like public class MyService { @Inject MyRepository solrRepo; public FacetPage<MyPOJO> tryFacets(String searchString){ //Here is where I am struggling SimpleFacetQuery query = new SimpleQuery(new SimpleStringCriteria(searchString)).setPageRequest new PageRequest(0,5)); query.setFacetOptions(new FacetOptions("zip")); FacetPage<MyPOJO> facetedPOJO= solrRepo.findByQueryandAnno(searchString,query.getPageRequest()); return facetedPOJO; } My jUnit method call is like service.tryFacets("some value");

    Read the article

  • Getting the DirectShow VideoRender filter to respond to MediaType changes on its Input Pin?

    - by Jonathan Websdale
    Below is the code extract from my decoder transform filter which takes in data from my source filter which is taking RTP network data from an IP camera. The source filter, decode filter can dynamically respond to changes in the camera image dimensions since I need to handle resolution changes in the decode library. I've used the 'ReceiveConnection' method as described in the DirectShow help, passing the new MediaType data in the next sample. However, I can't get the Video Mixing Renderer to accept the resolution changes dynamically even though the renderer will render the different resolution if the graph is stopped and restarted. Can anyone point out what I need to do to get the renderer to handle dynamic resolution changes? HRESULT CDecoder::Receive(IMediaSample* pIn) { //Input data does not necessarily correspond one-to-one //with output frames, so we must override Receive instead //of Transform. HRESULT hr = S_OK; //Deliver input to library long cBytes = pIn->GetActualDataLength(); BYTE* pSrc; pIn->GetPointer(&pSrc); try { hr = m_codec.Decode(pSrc, cBytes, (hr == S_OK)?&tStart : NULL); } catch (...) { hr = E_UNEXPECTED; } if (FAILED(hr)) { if (theLog.enabled()){theLog.strm() << "Decoder Error " << hex << hr << dec << " - resetting input"; theLog.write();} //Force reset of decoder m_bReset = true; m_codec.ResetInput(); //We have handled the error -- don't pass upstream or the source may stop. return S_OK; } //Extract and deliver any decoded frames hr = DeliverDecodedFrames(); return hr; } HRESULT CDecoder::DeliverDecodedFrames() { HRESULT hr = S_OK; for (;;) { DecodedFrame frame; bool bFrame = m_codec.GetDecodedFrame(frame); if (!bFrame) { break; } CMediaType mtIn; CMediaType mtOut; GetMediaType( PINDIR_INPUT, &mtIn); GetMediaType( PINDIR_OUTPUT, &mtOut); //Get the output pin's current image resolution VIDEOINFOHEADER* pvi = (VIDEOINFOHEADER*)mtOut.Format(); if( pvi->bmiHeader.biWidth != m_cxInput || pvi->bmiHeader.biHeight != m_cyInput) { HRESULT hr = GetPin(PINDIR_OUTPUT)->GetConnected()->ReceiveConnection(GetPin(PINDIR_OUTPUT), &mtIn); if(SUCCEEDED(hr)) { SetMediaType(PINDIR_OUTPUT, &mtIn); } } IMediaSamplePtr pOut; hr = m_pOutput->GetDeliveryBuffer(&pOut, 0, 0, NULL); if (FAILED(hr)) { break; } AM_MEDIA_TYPE* pmt; if (pOut->GetMediaType(&pmt) == S_OK) { CMediaType mt(*pmt); DeleteMediaType(pmt); SetMediaType(PINDIR_OUTPUT, &mt); pOut->SetMediaType(&mt); } // crop, tramslate and deliver BYTE* pDest; pOut->GetPointer(&pDest); m_pConverter->Convert(frame.Width(), frame.Height(), frame.GetY(), frame.GetU(), frame.GetV(), pDest); pOut->SetActualDataLength(m_pOutput->CurrentMediaType().GetSampleSize()); pOut->SetSyncPoint(true); if (frame.HasTimestamp()) { REFERENCE_TIME tStart = frame.Timestamp(); REFERENCE_TIME tStop = tStart+1; pOut->SetTime(&tStart, &tStop); } m_pOutput->Deliver(pOut); } return hr; }

    Read the article

  • Same data being returned by linq for 2 different executions of a stored procedure?

    - by Paul
    Hello I have a stored procedure that I am calling through Entity Framework. The stored procedure has 2 date parameters. I supply different argument in the 2 times I call the stored procedure. I have verified using SQL Profiler that the stored procedure is being called correctly and returning the correct results. When I call my method the second time with different arguments, even though the stored procedure is bringing back the correct results, the table created contains the same data as the first time I called it. dtStart = 01/08/2009 dtEnd = 31/08/2009 public List<dataRecord> GetData(DateTime dtStart, DateTime dtEnd) { var tbl = from t in db.SP(dtStart, dtEnd) select t; return tbl.ToList(); } GetData((new DateTime(2009, 8, 1), new DateTime(2009, 8, 31)) // tbl.field1 value = 45450 - CORRECT GetData(new DateTime(2009, 7, 1), new DateTime(2009, 7, 31)) // tbl.field1 value = 45450 - WRONG 27456 expected Is this a case of Entity Framework being clever and caching? I can't see why it would cache this though as it has executed the stored procedure twice. Do I have to do something to close tbl? using Visual Studio 2008 + Entity Framework. I also get the message "query cannot be enumerated more than once" a few times every now and then, am not sure if that is relevant? FULL CODE LISTING namespace ProfileDataService { public partial class DataService { public static List<MeterTotalConsumpRecord> GetTotalAllTimesConsumption(DateTime dtStart, DateTime dtEnd, EUtilityGroup ug, int nMeterSelectionType, int nCustomerID, int nUserID, string strSelection, bool bClosedLocations, bool bDisposedLocations) { dbChildDataContext db = DBManager.ChildDataConext(nCustomerID); var tbl = from t in db.GetTotalConsumptionByMeter(dtStart, dtEnd, (int) ug, nMeterSelectionType, nCustomerID, nUserID, strSelection, bClosedLocations, bDisposedLocations, 1) select t; return tbl.ToList(); } } } /// CALLER List<MeterTotalConsumpRecord> _P1Totals; List<MeterTotalConsumpRecord> _P2Totals; public void LoadData(int nUserID, int nCustomerID, ELocationSelectionMethod locationSelectionMethod, string strLocations, bool bIncludeClosedLocations, bool bIncludeDisposedLocations, DateTime dtStart, DateTime dtEnd, ReportsBusinessLogic.Lists.EPeriodType durMainPeriodType, ReportsBusinessLogic.Lists.EPeriodType durCompareToPeriodType, ReportsBusinessLogic.Lists.EIncreaseReportType rptType, bool bIncludeDecreases) { ///Code for setting properties using parameters.. _P2Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_P2StartDate, _P2EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); _P1Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_StartDate, _EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); PopulateLines() //This fills up a list of objects with information for my report ready for the totals to be added PopulateTotals(_P1Totals, 1); PopulateTotals(_P2Totals, 2); } void PopulateTotals(List<MeterTotalConsumpRecord> objTotals, int nPeriod) { MeterTotalConsumpRecord objMeterConsumption = null; foreach (IncreaseReportDataRecord objLine in _Lines) { objMeterConsumption = objTotals.Find(delegate(MeterTotalConsumpRecord t) { return t.MeterID == objLine.MeterID; }); if (objMeterConsumption != null) { if (nPeriod == 1) { objLine.P1Consumption = (double)objMeterConsumption.Consumption; } else { objLine.P2Consumption = (double)objMeterConsumption.Consumption; } objMeterConsumption = null; } } } }

    Read the article

  • Magento Onepage Success Conversion Tracking Design Pattern

    - by user1734954
    My intent is to track conversions through multiple channels by inserting third party javascript (for example google analytics, optimizely, pricegrabber etc.) into the footer of onepage success . I've accomplished this by adding a block to the footer reference inside of the checkout success node within local.xml and everything works appropriately. My questions are more about efficiency and extensibility. It occurred to me that it would be better to combine all of the blocks into a single block reference and then use a various methods acting on a single call to the various related models to provide the data needed for insertion into the javascript for each of the conversion tracking scripts. Some examples of the common data that conversion tracking may rely on(pseudo): Order ID , Order Total, Order.LineItem.Name(foreach) and so on Currently for each of the scripts I've made a call to the appropriate model passing the customers last order id as the load value and the calling a get() assigning the return value to a variable and then iterating through the data to match the values with the expectations of the given third party service. All of the data should be pulled once when checkout is complete each third party services may expect different data in different formats Here is an example of one of the conversion tracking template files which loads at the footer of checkout success. $order = Mage::getModel('sales/order')->loadByIncrementId(Mage::getSingleton('checkout/session')->getLastRealOrderId()); $amount = number_format($order->getGrandTotal(),2); $customer = Mage::helper('customer')->getCustomer()->getData(); ?> <script type="text/javascript"> popup_email = '<?php echo($customer['email']);?>'; popup_order_number = '<?php echo $this->getOrderId() ?>'; </script> <!-- PriceGrabber Merchant Evaluation Code --> <script type="text/javascript" charset="UTF-8" src="https://www.pricegrabber.com/rating_merchrevpopjs.php?retid=<something>"></script> <noscript><a href="http://www.pricegrabber.com/rating_merchrev.php?retid=<something>" target=_blank> <img src="https://images.pricegrabber.com/images/mr_noprize.jpg" border="0" width="272" height="238" alt="Merchant Evaluation"></a></noscript> <!-- End PriceGrabber Code --> Having just a single piece of code like this is not that big of a deal, but we are doing similar things with a number of different third party services. Pricegrabber is one of the simpler examples. A more sophisticated tracking service expects a comma separated list of all of the product names, ids, prices, categories , order id etc. I would like to make it all more manageable so my idea to do the following: combine all of the template files into a single file Develop a helper class or library to deliver the data to the conversion template Goals Include Extensibility Minimal Model Calls Minimal Method Calls The Questions 1. Is a Mage helper the best route to take? 2. Is there any design pattern you may recommend for the "helper" class? 3. Why would this the design pattern you've chosen be best for this instance?

    Read the article

  • trie reg exp parse step over char and continue

    - by forest.peterson
    Setup: 1) a string trie database formed from linked nodes and a vector array linking to the next node terminating in a leaf, 2) a recursive regular expression function that if A) char '*' continues down all paths until string length limit is reached, then continues down remaining string paths if valid, and B) char '?' continues down all paths for 1 char and then continues down remaining string paths if valid. 3) after reg expression the candidate strings are measured for edit distance against the 'try' string. Problem: the reg expression works fine for adding chars or swapping ? for a char but if the remaining string has an error then there is not a valid path to a terminating leaf; making the matching function redundant. I tried adding a 'step-over' ? char if the end of the node vector was reached and then followed every path of that node - allowing this step-over only once; resulted in a memory exception; I cannot find logically why it is accessing the vector out of range - bactracking? Questions: 1) how can the regular expression step over an invalid char and continue with the path? 2) why is swapping the 'sticking' char for '?' resulting in an overflow? Function: void Ontology::matchRegExpHelper(nodeT *w, string inWild, Set<string> &matchSet, string out, int level, int pos, int stepover) { if (inWild=="") { matchSet.add(out); } else { if (w->alpha.size() == pos) { int testLength = out.length() + inWild.length(); if (stepover == 0 && matchSet.size() == 0 && out.length() > 8 && testLength == tokenLength) {//candidate generator inWild[0] = '?'; matchRegExpHelper(w, inWild, matchSet, out, level, 0, stepover+1); } else return; //giveup on this path } if (inWild[0] == '?' || (inWild[0] == '*' && (out.length() + inWild.length() ) == level ) ) { //wild matchRegExpHelper(w->alpha[pos].next, inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover);//follow path -> if ontology is full, treat '*' like a '?' } else if (inWild[0] == '*') matchRegExpHelper(w->alpha[pos].next, '*'+inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover); //keep adding chars if (inWild[0] == w->alpha[pos].letter) //follow self matchRegExpHelper(w->alpha[pos].next, inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover); //follow char matchRegExpHelper(w, inWild, matchSet, out, level, pos+1, stepover);//check next path } } Error Message: +str "Attempt to access index 1 in a vector of size 1." std::basic_string<char,std::char_traits<char>,std::allocator<char> > +err {msg="Attempt to access index 1 in a vector of size 1." } ErrorException Note: this function works fine for hundreds of test strings with '*' wilds if the extra stepover gate is not used Semi-Solved: I place a pos < w->alpha.size() condition on each path that calls w->alpha[pos]... - this prevented the backtrack calls from attempting to access the vector with an out of bounds index value. Still have other issues to work out - it loops infinitely adding the ? and backtracking to remove it, then repeat. But, moving forward now. Revised question: why during backtracking is the position index accumulating and/or not deincrementing - so at somepoint it calls w->alpha[pos]... with an invalid position that is either remaining from the next node or somehow incremented pos+1 when passing upward?

    Read the article

  • Best practices regarding equals: to overload or not to overload?

    - by polygenelubricants
    Consider the following snippet: import java.util.*; public class EqualsOverload { public static void main(String[] args) { class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } } List<Thing> myThings = Arrays.asList(new Thing(42)); System.out.println(myThings.contains(new Thing(42))); // prints "false" } } Note that contains returns false!!! We seems to have lost our things!! The bug, of course, is the fact that we've accidentally overloaded, instead of overridden, Object.equals(Object). If we had written class Thing as follows instead, then contains returns true as expected. class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.x == ((Thing) o).x); } } Effective Java 2nd Edition, Item 36: Consistently use the Override annotation, uses essentially the same argument to recommend that @Override should be used consistently. This advice is good, of course, for if we had tried to declare @Override equals(Thing other) in the first snippet, our friendly little compiler would immediately point out our silly little mistake, since it's an overload, not an override. What the book doesn't specifically cover, however, is whether overloading equals is a good idea to begin with. Essentially, there are 3 situations: Overload only, no override -- ALMOST CERTAINLY WRONG! This is essentially the first snippet above Override only (no overload) -- one way to fix This is essentially the second snippet above Overload and override combo -- another way to fix The 3rd situation is illustrated by the following snippet: class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.equals((Thing) o)); } } Here, even though we now have 2 equals method, there is still one equality logic, and it's located in the overload. The @Override simply delegates to the overload. So the questions are: What are the pros and cons of "override only" vs "overload & override combo"? Is there a justification for overloading equals, or is this almost certainly a bad practice?

    Read the article

  • Error With Sending mail (kSKPSMTPPartMessageKey is nil)

    - by user1553381
    I'm trying to send mail in iPhone using "SKPSMTPMessage" and I added the libraries, In my class I added the following code: - (IBAction)sendMail:(id)sender { // if there are a connection if ([theConnection isEqualToString:@"true"]) { if ([fromEmail.text isEqualToString:@""] || [toEmail.text isEqualToString:@""]) { UIAlertView *warning = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ??? ????? ???? ????????" delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [warning show]; }else { SKPSMTPMessage *test_smtp_message = [[SKPSMTPMessage alloc] init]; test_smtp_message.fromEmail = fromEmail.text; test_smtp_message.toEmail = toEmail.text; test_smtp_message.relayHost = @"smtp.gmail.com"; test_smtp_message.requiresAuth = YES; test_smtp_message.login = @"[email protected]"; test_smtp_message.pass = @"myPass"; test_smtp_message.wantsSecure = YES; NSString *subject= @"Suggest a book for you"; test_smtp_message.subject = [NSString stringWithFormat:@"%@ < %@ > ",fromEmail.text, subject]; test_smtp_message.delegate = self; NSMutableArray *parts_to_send = [NSMutableArray array]; NSDictionary *plain_text_part = [NSDictionary dictionaryWithObjectsAndKeys: @"text/plain\r\n\tcharset=UTF-8;\r\n\tformat=flowed", kSKPSMTPPartContentTypeKey, [messageBody.text stringByAppendingString:@"\n"], kSKPSMTPPartMessageKey, @"quoted-printable", kSKPSMTPPartContentTransferEncodingKey, nil]; [parts_to_send addObject:plain_text_part]; // to send attachment NSString *image_path = [[NSBundle mainBundle] pathForResource:BookCover ofType:@"jpg"]; NSData *image_data = [NSData dataWithContentsOfFile:image_path]; NSDictionary *image_part = [NSDictionary dictionaryWithObjectsAndKeys: @"inline;\r\n\tfilename=\"image.png\"",kSKPSMTPPartContentDispositionKey, @"base64",kSKPSMTPPartContentTransferEncodingKey, @"image/png;\r\n\tname=Success.png;\r\n\tx-unix-mode=0666",kSKPSMTPPartContentTypeKey, [image_data encodeWrappedBase64ForData],kSKPSMTPPartMessageKey, nil]; [parts_to_send addObject:image_part]; test_smtp_message.parts = parts_to_send; Spinner.hidden = NO; [Spinner startAnimating]; ProgressBar.hidden = NO; HighestState = 0; [test_smtp_message send]; } }else { UIAlertView *alertNoconnection = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ???? ???? " delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [alertNoconnection show]; } } but when I tried to send it gives me the following Exception: *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFString appendString:]: nil argument' and it highlighted this line in SKPSMTPMessage.m [message appendString:[part objectForKey:kSKPSMTPPartMessageKey]]; and I Can't understand what is nil exactly Can Anyone help me in this issue? Thanks in Advance.

    Read the article

  • Is this a valid pattern for raising events in C#?

    - by Will Vousden
    Update: For the benefit of anyone reading this, since .NET 4, the lock is unnecessary due to changes in synchronization of auto-generated events, so I just use this now: public static void Raise<T>(this EventHandler<T> handler, object sender, T e) where T : EventArgs { if (handler != null) { handlerCopy(sender, e); } } And to raise it: SomeEvent.Raise(this, new FooEventArgs()); Having been reading one of Jon Skeet's articles on multithreading, I've tried to encapsulate the approach he advocates to raising an event in an extension method like so (with a similar generic version): public static void Raise(this EventHandler handler, object @lock, object sender, EventArgs e) { EventHandler handlerCopy; lock (@lock) { handlerCopy = handler; } if (handlerCopy != null) { handlerCopy(sender, e); } } This can then be called like so: protected virtual void OnSomeEvent(EventArgs e) { this.someEvent.Raise(this.eventLock, this, e); } Are there any problems with doing this? Also, I'm a little confused about the necessity of the lock in the first place. As I understand it, the delegate is copied in the example in the article to avoid the possibility of it changing (and becoming null) between the null check and the delegate call. However, I was under the impression that access/assignment of this kind is atomic, so why is the lock necessary? Update: With regards to Mark Simpson's comment below, I threw together a test: static class Program { private static Action foo; private static Action bar; private static Action test; static void Main(string[] args) { foo = () => Console.WriteLine("Foo"); bar = () => Console.WriteLine("Bar"); test += foo; test += bar; test.Test(); Console.ReadKey(true); } public static void Test(this Action action) { action(); test -= foo; Console.WriteLine(); action(); } } This outputs: Foo Bar Foo Bar This illustrates that the delegate parameter to the method (action) does not mirror the argument that was passed into it (test), which is kind of expected, I guess. My question is will this affect the validity of the lock in the context of my Raise extension method? Update: Here is the code I'm now using. It's not quite as elegant as I'd have liked, but it seems to work: public static void Raise<T>(this object sender, ref EventHandler<T> handler, object eventLock, T e) where T : EventArgs { EventHandler<T> copy; lock (eventLock) { copy = handler; } if (copy != null) { copy(sender, e); } }

    Read the article

  • Matrix Multiplication with Threads: Why is it not faster?

    - by prelic
    Hey all, So I've been playing around with pthreads, specifically trying to calculate the product of two matrices. My code is extremely messy because it was just supposed to be a quick little fun project for myself, but the thread theory I used was very similar to: #include <pthread.h> #include <stdio.h> #include <stdlib.h> #define M 3 #define K 2 #define N 3 #define NUM_THREADS 10 int A [M][K] = { {1,4}, {2,5}, {3,6} }; int B [K][N] = { {8,7,6}, {5,4,3} }; int C [M][N]; struct v { int i; /* row */ int j; /* column */ }; void *runner(void *param); /* the thread */ int main(int argc, char *argv[]) { int i,j, count = 0; for(i = 0; i < M; i++) { for(j = 0; j < N; j++) { //Assign a row and column for each thread struct v *data = (struct v *) malloc(sizeof(struct v)); data->i = i; data->j = j; /* Now create the thread passing it data as a parameter */ pthread_t tid; //Thread ID pthread_attr_t attr; //Set of thread attributes //Get the default attributes pthread_attr_init(&attr); //Create the thread pthread_create(&tid,&attr,runner,data); //Make sure the parent waits for all thread to complete pthread_join(tid, NULL); count++; } } //Print out the resulting matrix for(i = 0; i < M; i++) { for(j = 0; j < N; j++) { printf("%d ", C[i][j]); } printf("\n"); } } //The thread will begin control in this function void *runner(void *param) { struct v *data = param; // the structure that holds our data int n, sum = 0; //the counter and sum //Row multiplied by column for(n = 0; n< K; n++){ sum += A[data->i][n] * B[n][data->j]; } //assign the sum to its coordinate C[data->i][data->j] = sum; //Exit the thread pthread_exit(0); } source: http://macboypro.com/blog/2009/06/29/matrix-multiplication-in-c-using-pthreads-on-linux/ For the non-threaded version, I used the same setup (3 2-d matrices, dynamically allocated structs to hold r/c), and added a timer. First trials indicated that the non-threaded version was faster. My first thought was that the dimensions were too small to notice a difference, and it was taking longer to create the threads. So I upped the dimensions to about 50x50, randomly filled, and ran it, and I'm still not seeing any performance upgrade with the threaded version. What am I missing here?

    Read the article

  • Drupal's not reading correct values from DB

    - by John
    Hey Everyone, Here is my current problem. I am working with the chat module and I'm building a module that notifies users via AJAX that they have been invited to a chat. The current table structure for the invites table looks like this: |-------------------------------------------------------------------------| | CCID | NID | INVITER_UID | INVITEE_UID | NOTIFIED | ACCEPTED | |-------------------------------------------------------------------------| | int | int | int | int | (0 or 1) | (0 or 1) | |-------------------------------------------------------------------------| I'm using the periodical updater plug-in for JQuery to continually poll the server to check for invites. When an invite is found, I set the notified from 0 to 1. However, my problem is the periodical updater. When I first see that there is an invite, I notify the user, and set notified to 1. On the next select though, I get the same results before, as if the update didn't work. But, when I got check the database, I can see that it worked just fine. It's as if the query is querying a cache, but I can't figure it out. My code for the periodical updater is as follows: window.onload = function() { var uid = $('a#chat_uid').html(); $.PeriodicalUpdater( '/steelylib/sites/all/modules/_chat_whos_online/ajax/ajax.php', //url to service { method: 'get', //send data via... data: {uid: uid}, //data to send minTimeout: '1000', //min time before server is polled (milli-sec.) maxTimeout: '20000', //max time before server is polled (milli-sec.) multiplyer: '1.5', //multiply against curretn poll time every time constant data is returned type: 'text', //type of data recieved (response type) maxCalls: 0, //max calls to make (0=unlimited) autoStop: 0 //max calls with constant data (0=unlimited/disabled) }, function(data) //callback function { alert( data ); //for now, until i get it working } ); } And my code for the ajax call is as follows: <?php #bootstrap Drupal, and call function, passing current user's uid. function _create_chat_node_check_invites($uid) { cache_clear_all('chatroom_chat_list', 'cache'); $query = "SELECT * FROM {chatroom_chat_invite} WHERE notified=0 AND invitee_uid=%d and accepted=0"; $query_results = db_query( $query, $uid ); $json = '{"invites":['; while( $row = db_fetch_object($query_results) ) { var_dump($row); global $base_url; $url = $base_url . '/content/privatechat' . $uid .'-' . $row->inviter_uid; $inviter = db_fetch_object( db_query( "SELECT name FROM {users} WHERE uid = %d", $row->inviter_uid ) ); $invitee = db_fetch_object( db_query( "SELECT name FROM {users} WHERE uid = %d", $row->invitee_uid ) ); #reset table $query = "UPDATE {chatroom_chat_invite} " ."SET notified=1 " ."WHERE inviter_uid=%d AND invitee_uid=%d"; db_query( $query, $row->inviter_uid, $row->invitee_uid ); $json .= '['; $json .= '"' . $url . '",'; $json .= '"' . ($inviter->name) . '",'; $json .= '"' . ($invitee->name) . '"' ; $json .= '],'; } $json = substr($json, 0, -1); $json .= ']}'; return $json; } ?> I can't figure out what is going wrong, any help is greatly appreciated!

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Perfect Forwarding to async lambda

    - by Alexander Kondratskiy
    I have a function template, where I want to do perfect forwarding into a lambda that I run on another thread. Here is a minimal test case which you can directly compile: #include <thread> #include <future> #include <utility> #include <iostream> #include <vector> /** * Function template that does perfect forwarding to a lambda inside an * async call (or at least tries to). I want both instantiations of the * function to work (one for lvalue references T&, and rvalue reference T&&). * However, I cannot get the code to compile when calling it with an lvalue. * See main() below. */ template <typename T> std::string accessValueAsync(T&& obj) { std::future<std::string> fut = std::async(std::launch::async, [](T&& vec) mutable { return vec[0]; }, std::forward<T>(obj)); return fut.get(); } int main(int argc, char const *argv[]) { std::vector<std::string> lvalue{"Testing"}; // calling with what I assume is an lvalue reference does NOT compile std::cout << accessValueAsync(lvalue) << std::endl; // calling with rvalue reference compiles std::cout << accessValueAsync(std::move(lvalue)) << std::endl; // I want both to compile. return 0; } For the non-compiling case, here is the last line of the error message which is intelligible: main.cpp|13 col 29| note: no known conversion for argument 1 from ‘std::vector<std::basic_string<char> >’ to ‘std::vector<std::basic_string<char> >&’ I have a feeling it may have something to do with how T&& is deduced, but I can't pinpoint the exact point of failure and fix it. Any suggestions? Thank you! EDIT: I am using gcc 4.7.0 just in case this could be a compiler issue (probably not)

    Read the article

  • Contact Form using validation to send to phpmailer

    - by Jaciinto
    This is the first time I have ever wrote anything in java script so I am unsure if I am doing anything right. I used yensdesign.com tutorial as an example and went from there but cant get it to submit the var to validation.php and also can not get it to at the end give me congrats message for it passing. Any help would be greatly appreciated. //Form $(document).ready(function(){ //global vars var form = $("#contactForm"); var title = $("#contactTitle"); var name = $("#contactName"); var email = $("#contactEmail"); var message = $("#contactMessage"); //On blur name.blur(validateName); email.blur(validateEmail); title.blur(validateTitle); //On key press name.keyup(validateName); email.keyup(validateEmail); title.keyup(validateTitle); message.keyup(validateMessage); //validation functions function validateEmail() { //testing regular expression var a = $("#contactEmail").val(); var filter = /^[a-zA-Z0-9]+[a-zA-Z0-9_.-]+[a-zA-Z0-9_-]+@[a-zA-Z0-9]+[a-zA-Z0-9.-]+[a-zA-Z0-9]+.[a-z]{2,4}$/; //if it's valid email if(filter.test(a)) { email.removeClass("contactError"); return true; } //if it's NOT valid else { email.addClass("contactError"); return false; } } function validateName() { //if it's NOT valid if(name.val().length < 4) { name.addClass("contactError"); return false; } //if it's valid else { name.removeClass("contactError"); return true; } } function validateTitle() { //if it's NOT valid if(title.val().length < 4) { title.addClass("contactError"); return false; } //if it's valid else { title.removeClass("contactError"); return true; } } function validateMessage(){ //it's NOT valid if(message.val().length < 10){ message.addClass("contactError"); return false; } //it's valid else{ message.removeClass("contactError"); return true; } } var dataString = 'name='+ name + '&email=' + email + '&number=' + number + '&comment=' + comment; function valid () { if(validateName() & validateEmail() & validateTitle() & validateMessage()) { type: "POST", url: "bin/process.php", data: dataString, success: function() { $('#contactForm').html("<div id='message'></div>"); $('#message').html("<h2>Thanks!</h2>") .append("<p>We will be in touch soon.</p>") .hide() .fadeIn(1500, function() { $('#message').append("<img id='checkmark' src='images/check.png' />"); }); } else { return false; } } });

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • How to make a jQuery plugin (the right way)?

    - by macek
    I know there are jQuery cookie plugins out there, but I wanted to write one for the sake of better learning the jQuery plugin pattern. I like the separation of "work" in small, manageable functions, but I feel like I'm passing name, value, and options arguments around too much. Is there a way this can be refactored? I'm looking for snippets of code to help illustrate examples provided with in answers. Any help is appreciated. Thanks :) example usage $.cookie('foo', 'bar', {expires:7}); $.cookie('foo'); //=> bar $.cookie('foo', null); $.cookie('foo'); //=> undefined Edit: I did a little bit of work on this. You can view the revision history to see where this has come from. It still feels like more refactoring can be done to optimize the flow a bit. Any ideas? the plugin (function($){ $.cookie = function(name, value, options) { if (typeof value == 'undefined') { return get(name); } else { options = $.extend({}, $.cookie.defaults, options || {}); return (value != null) ? set(name, value, options) : unset(name, options); } }; $.cookie.defaults = { expires: null, path: '/', domain: null, secure: false }; var set = function(name, value, options){ console.log(options); return document.cookie = options_string(name, value, options); }; var get = function(name){ var cookies = {}; $.map(document.cookie.split(';'), function(pair){ var c = $.trim(pair).split('='); cookies[c[0]] = c[1]; }); return decodeURIComponent(cookies[name]); }; var unset = function(name, options){ value = ''; options.expires = -1; set(name, value, options); }; var options_string = function(name, value, options){ var pairs = [param.name(name, value)]; $.each(options, function(k,v){ pairs.push(param[k](v)); }); return $.map(pairs, function(p){ return p === null ? null : p; }).join(';'); }; var param = { name: function(name, value){ return name + "=" + encodeURIComponent(value); }, expires: function(value){ // no expiry if(value === null){ return null; } // number of days else if(typeof value == "number"){ d = new Date(); d.setTime(d.getTime() + (value * 24 * 60 * 60 * 1000)); } // date object else if(typeof value == "object" && value instanceof "Date") { d = value; } return "expires=" + d.toUTCString(); }, path: function(value){ return "path="+value; }, domain: function(value){ return value === null ? null : "domain=" + value; }, secure: function(bool){ return bool ? "secure" : null; } }; })(jQuery);

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • java will this threading setup work or what can i be doing wrong

    - by Erik
    Im a bit unsure and have to get advice. I have the: public class MyApp extends JFrame{ And from there i do; MyServer = new MyServer (this); MyServer.execute(); MyServer is a: public class MyServer extends SwingWorker<String, Object> { MyServer is doing listen_socket.accept() in the doInBackground() and on connection it create a new class Connection implements Runnable { I have the belove DbHelper that are a singleton. It holds an Sqlite connected. Im initiating it in the above MyApp and passing references all the way in to my runnable: class Connection implements Runnable { My question is what will happen if there are two simultaneous read or `write? My thought here was the all methods in the singleton are synchronized and would put all calls in the queue waiting to get a lock on the synchronized method. Will this work or what can i change? public final class DbHelper { private boolean initalized = false; private String HomePath = ""; private File DBFile; private static final String SYSTEM_TABLE = "systemtable"; Connection con = null; private Statement stmt; private static final ContentProviderHelper instance = new ContentProviderHelper (); public static ContentProviderHelper getInstance() { return instance; } private DbHelper () { if (!initalized) { initDB(); initalized = true; } } private void initDB() { DBFile = locateDBFile(); try { Class.forName("org.sqlite.JDBC"); // create a database connection con = DriverManager.getConnection("jdbc:sqlite:J:/workspace/workComputer/user_ptpp"); } catch (SQLException e) { e.printStackTrace(); } catch (ClassNotFoundException e) { e.printStackTrace(); } } private File locateDBFile() { File f = null; try{ HomePath = System.getProperty("user.dir"); System.out.println("HomePath: " + HomePath); f = new File(HomePath + "/user_ptpp"); if (f.canRead()) return f; else { boolean success = f.createNewFile(); if (success) { System.out.println("File did not exist and was created " + HomePath); // File did not exist and was created } else { System.out.println("File already exists " + HomePath); // File already exists } } } catch (IOException e) { System.out.println("Maybe try a new directory. " + HomePath); //Maybe try a new directory. } return f; } public String getHomePath() { return HomePath; } private synchronized String getDate(){ SimpleDateFormat dateFormat = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss"); Date date = new Date(); return dateFormat.format(date); } public synchronized String getSelectedSystemTableColumn( String column) { String query = "select "+ column + " from " + SYSTEM_TABLE ; try { stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); ResultSet rs = stmt.executeQuery(query); while (rs.next()) { String value = rs.getString(column); if(value == null || value == "") return ""; else return value; } } catch (SQLException e ) { e.printStackTrace(); return ""; } finally { } return ""; } }

    Read the article

  • Infinite sharing system (PHP/MySQLi)

    - by Toine Lille
    I'm working on a discount system for whichever customer shares a product and brings in new customers. Each unique visit = $0.05 off, each new customer = $0.50 off (it's a cheap product so yeah, no big numbers). When a new customer shares the site, the customer initially responsible for the new customer (if any) will get half of the new customer's discount as well. The initial customer would get a fourth for the next level and the new customer half of that, etc, creating a tree or pyramid that way that could be infinite. Initial customer ($1.35 discount: 2 new+3 visits + half of 1 new+2 visits) Visitor ($0) Visitor ($0) New customer ($0.60) Visitor ($0) Visitor ($0) Newer customer ($0) New customer ($0) Visitor ($0) The customers are saved along with their IP addresses (bin2hex(inet_pton)) in a database table (customers) with info like a unique id, e-mail address and first date/time the purchased a product (= time of registration). The shares are saved in a separate table within the same database (sharing). Each unique IP addresses that visits the site creates a new row featuring the IP address (also saved as bin2hex(inet_pton)), the id of the customer who shared it and the date/time of the visit. Sharing goes via URL, featuring a GET element containing the customer's id. Visits and new customers overlap, as visits will always occur before the new customer does. That's fine. The date/times are used just to make it a little more secure (I also use the IP along with cookies to see if people cheat the system). If an IP is already in the sharing or customer tables, it does not count and will not create a new entry. Now the problem is, how to make the infinity happen and apply the different values to it? That's all I'd need to know. It needs to calculate the discount for each customer separately, but also allow for monitoring altogether (though that's just a matter of passing all ID's through it). I figured I'd start (after the database connection) with $stmt = $con->prepare('SELECT ip,datetime FROM sharing WHERE sender=?'); $stmt->bind_param('i',$customerid); $stmt->execute(); $stmt->store_result(); $discount = $discount + ($stmt->num_rows * 0.05); $stmt->bind_result($ip,$timeofsharing); to translate all the visits to $0.05 of discount each. To check for the new customers that came from these visits, I wrote the following: while ($sql->fetch()) { $stmt2 = $con->prepare("SELECT datetime FROM users WHERE ip=?"); $stmt2->bind_param('s',$ip); $stmt2->execute(); $stmt2->store_result(); $stmt2->bind_result($timeofpurchase); Followed by a little more security comparing the datetimes: while ($stmt2->fetch()) { if (strtotime($timeofpurchase) < strtotime($timeofsharing)) { $discount = $discount + $0.50; } But this is just for the initial customer's direct results. If I'd want to check for the next level, I'd basically have to put the exact same check and loop in itself, checking each new customer the initial customer they brought to the site, and then for the next level again to check all of the newer customers, etc, etc. What to do? / Where to go? / What would be the correct practice for this? Thanks!

    Read the article

  • How to get Augmented Reality: A Practical Guide examples working?

    - by Glen
    I recently bought the book: Augmented Reality: A Practical Guide (http://pragprog.com/titles/cfar/augmented-reality). It has example code that it says runs on Windows, MacOS and Linux. But I can't get the binaries to run. Has anyone got this book and got the binaries to run on ubuntu? I also can't figure out how to compile the examples in Ubuntu. How would I do this? Here is what it says to do: Compiling for Linux Refreshingly, there are no changes required to get the programs in this chapter to compile for Linux, but as with Windows, you’ll first have to find your GL and GLUT files. This may mean you’ll have to download the correct version of GLUT for your machine. You need to link in the GL, GLU, and GLUT libraries and provide a path to the GLUT header file and the files it includes. See whether there is a glut.h file in the /usr/include/GL directory; otherwise, look elsewhere for it—you could use the command find / -name "glut.h" to search your entire machine, or you could use the locate command (locate glut.h). You may need to customize the paths, but here is an example of the compile command: gcc -o opengl_template opengl_template.cpp -I /usr/include/GL -I /usr/include -lGL -lGLU -lglut gcc is a C/C++ compiler that should be present on your Linux or Unix machine. The -I /usr/include/GL command-line argument tells gcc to look in /usr/include/GL for the include files. In this case, you’ll find glut.h and what it includes. When linking in libraries with gcc, you use the -lX switch—where X is the name of your library and there is a correspond- ing libX.a file somewhere in your path. For this example, you want to link in the library files libGL.a, libGLU.a, and libglut.a, so you will use the gcc arguments -lGL -lGLU -lglut. These three files are found in the default directory /usr/lib/, so you don’t need to specify their location as you did with glut.h. If you did need to specify the library path, you would add -L to the path. To run your compiled program, type ./opengl_template or, if the current directory is in your shell’s paths, just opengl_template. When working in Linux, it’s important to know that you may need to keep your texture files to a maximum of 256 by 256 pixels or find the settings in your system to raise this limit. Often an OpenGL program will work in Windows but produce a blank white texture in Linux until the texture size is reduced. The above instructions make no sense to me. Do I have to use gcc to compile or can I use eclipse? If I use either eclipse or gcc what do I need to do to compile and run the program?

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • asp.net mvc radio button state

    - by Josh Bush
    I'm trying out asp.net mvc for a new project, and I ran across something odd. When I use the MVC UI helpers for textboxes, the values get persisted between calls. But, when I use a series of radio buttons, the checked state doesn't get persisted. Here's an example from my view. <li> <%=Html.RadioButton("providerType","1")%><label>Hospital</label> <%=Html.RadioButton("providerType","2")%><label>Facility</label> <%=Html.RadioButton("providerType","3")%><label>Physician</label> </li> When the form gets posted back, I build up an object with "ProviderType" as one of it's properties. The value on the object is getting set, and then I RedirectToAction with the provider as a argument. All is well, and I end up at a URL like "http://localhost/Provider/List?ProviderType=1" with ProviderType showing. The value gets persisted to the URL, but the UI helper isn't picking up the checked state. I'm having this problem with listbox, dropdownlist, and radiobutton. Textboxes pick up the values just fine. Do you see something I'm doing wrong? I'm assuming that the helpers will do this for me, but maybe I'll just have to take care of this on my own. I'm just feeling my way through this, so your input is appreciated. Edit: I just found the override for the SelectList constructor that takes a selected value. That took care of my dropdown issue I mentioned above. Edit #2: I found something that works, but it pains me to do it this way. I feel like this should be inferred. <li> <%=Html.RadioButton("ProviderType","1",Request["ProviderType"]=="1")%><label>Hospital</label> <%=Html.RadioButton("ProviderType", "2", Request["ProviderType"] == "2")%><label>Facility</label> <%=Html.RadioButton("ProviderType", "3", Request["ProviderType"] == "3")%><label>Physician</label> </li> Hopefully someone will come up with another way.

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >