Search Results

Search found 9147 results on 366 pages for 'big smile'.

Page 282/366 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

  • Modified jQuery innerfade sluggish

    - by Jay Hankins
    HI. I am using the jQuery innerfade plugin to scroll through some images on my site. Innerfade is sluggish to move on Firefox 3.6.3, and IE 8. IE 8 is much worse than Firefox, and Chrome runs smoothly. Can you analyze my code to see what the problem is? I've used the modified innerfade from here: http://www.stylephp.com/2009/01/17/customizing-jquery-innerfade-plug-in-adding-controls-navigation-and-caption/ My sites are here: Without bg image: http://dl.dropbox.com/u/145908/doozie2/index.html With bg image: http://dl.dropbox.com/u/145908/doozie2/index2.html Removing my background image fixes the situation; it's not that big of a file. I don't understand why that is an issue. I am using a technique to resize the image to fit the browser window, as you can see in the CSS. Thanks so much. P.S. Sorry, I'm a new user so I can't post more than one link. Please copy and paste the address between <.

    Read the article

  • Find TableLeyout in a thread (Because of the ProgressDialog)

    - by Shaulian
    Hi all, On my activity, im getting some big data from web, and while getting this data i want to show the user a ProgressDialog with spinning wheel. That i can do only with putting this code into a thread, right ? the problem is that after im getting this data i need to insert it into my tableLayout as TableRows and it seems impossible to access the TableLayout from the thread. What can i do to show this progress dialog and to be able access the table layout from the thread ?? Is there any event that happens on the end of the thread ? My code fails for : _tableLayout.addView(_tableRowVar, new TableLayout.LayoutParams( LayoutParams.FILL_PARENT, LayoutParams.FILL_PARENT)); My full code is : final ProgressDialog dialog = ProgressDialog.show(MyActivity.this, "", "Getting data.\nPlease wait...",true); new Thread() { public void run() { try { TableLayout _tableLayout; _tableLayout = (TableLayout)MyActivity.this.findViewById(R.id.tableLayoutID); List<String> data = getDataFromWeb(); // Get the data and bind it into the table publishTableLayoutWithTableRows(_tableLayout, data ); } catch (Exception e) { new AlertDialog.Builder(MyActivity.this) .setMessage(e.getMessage()) .show(); } dialog.dismiss(); } }.start();

    Read the article

  • How can I setup Hudson to use the same repository for different projects and maintain separate chang

    - by Allen
    I typically setup SVN to host 1 big project per repository but a lot of our infrastructure has changed and we now have one main SVN server that has a hierarchy like so Branches Tags Trunk Project1 files & folders Project2 files & folders Project3 files & folders Projects1,2, and 3 do not share anything amongst themselves, they are independent projects each with their own solution file to be built. I can setup projects in Hudson like so Repository Url: http://server/svn/MainRepository Local module directory (optional): /Trunk/Project1 And that will maintain a separate workspace for each project, but every time you commit to Project 2 or Project 3, a build gets kicked off in Hudson for every project based in that repository. Also, any commit made anywhere in the repository is pulled down and inserted into the Hudson changelog for all of them. I know the easiest solution would be to simply separate every project into its own repository. However, if I couldn't do that due to various reasons, is there a feasible way to achieve the functionality that having separate repositories gets me? I want commits to the sub folder of project 1 to only affect project 1. No other project's commits should cause project 1 to build and project 1's changelog in Hudson should only have commit notes from project 1.

    Read the article

  • Hibernate: Dirty Checking and Only Update of Dirty Attributes?

    - by jens
    Hello Experts, in "good old JDBC days" I wrote a lot of SQL Queries that did very targeted updates of only the "attributes/members" that were actually changed: For Example having an object with the following members: public String name; public String address; public Date date; If only date was changed in some Business Method I would only issue an SQL UPDATE for the date member. ==It seems however (thats my "impression" of hibernate) that when working with a standard Hibernate mapping (mapping the full class), even updates of only one single member lead to a full update of the object in SQL Statements generated by Hibernate. My Questions are: 1.) Is this observation correct, that hibernate DOES NOT intelligently check (in a fully mapped class), what member(s) where changed and then only issue updates for the specific changed members, but rather always will update (in the generated SQL Update Statement) all mapped members (of a class), even if they were not changed (in case the object is dirty due to one member being dirty...) 2.) What can I do to make Hibernate only update those members, that have been changed? I am searching for a solution to have hibernate only update the member that actually changed. (I know hibernate does some big work on doing dirty-checking, but as far as I know this dirtychecking is only relevant to identify if the object as whole is dirty, not what single member is dirty.) Thank you very much! Jens

    Read the article

  • rails best practices where to place unobtrusive javascript

    - by nathanvda
    Hi there, my rails applications (all 2.3.5) use a total mix of inline javascript, rjs, prototype and jquery. Let's call it learning or growing pains. Lately i have been more and more infatuated with unobtrusive javascript. It makes your html clean, in the same way css cleaned it up. But most examples i have seen are small examples, and they put all javascript(jquery) inside application.js Now i have a pretty big application, and i am thinking up ways to structure my js. I like somehow that my script is still close to the view, so i am thinking something like orders.html.erb orders.js where orders.js contains the unobtrusive javascript specific to that view. But maybe that's just me being too conservative :) I have read some posts by Yehuda Katz about this very problem here and here, where he tackles this problem. It will go through your js-files and only load those relevant to your view. But alas i can't find a current implementation. So my questions: how do you best structure your unobtrusive javascript; manage your code, how do you make sure that it is obvious from the html what something is supposed to do. I guess good class names go a long way :) how do you arrange your files, load them all in? just a few? do you use content_for :script or javascript_include_tag in your view to load the relevant scripts. Or ... ? do you write very generic functions (like a delete), with parameters (add extra attributes?), or do you write very specific functions (DRY?). I know in Rails 3 there is a standard set, and everything is unobtrusive there. But how to start in Rails 2.3.5? In short: what are the best practices for doing unobtrusive javascript in rails? :)

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • Form is submitting when the page loads

    - by RailAddict
    I have a really simple Rails app. Basically an article with comments. I want the article page to show the article, comments underneath and then a textbox to write a comment and a submit button to submit it. I got it all working except for one (big) problem. When the page loads.. example.com/article/1 a blank comment is submitted to the database. I fixed that by including "validates_presence_of :body" in the Comment model. But that results in the following image when the page loads: This is my code by the way: def show @place = Article.find(params[:id]) @comment = Article.find(params[:id]).comments.create(params[:comment]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @article } end end and <% form_for([@article, @comment]) do |f| %> <p> <%= f.label :commenter %><br /> <%= f.text_field :commenter %> </p> <p> <%= f.label :body %><br /> <%= f.text_area :body %> </p> <p> <%= f.submit "Create" %> </p> <% end %>

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Force creation of query execution plan

    - by Marc
    I have the following situation: .net 3.5 WinForm client app accessing SQL Server 2008 Some queries returning relatively big amount of data are used quite often by a form Users are using local SQL Express and restarting their machines at least daily Other users are working remotely over slow network connections The problem is that after a restart, the first time users open this form the queries are extremely slow and take more or less 15s on a fast machine to execute. Afterwards the same queries take only 3s. Of course this comes from the fact that no data is cached and must be loaded from disk first. My question: Would it be possible to force the loading of the required data in advance into SQL Server cache? Note My first idea was to execute the queries in a background worker when the application starts, so that when the user starts the form the queries will already be cached and execute fast directly. I however don't want to load the result of the queries over to the client as some users are working remotely or have otherwise slow networks. So I thought just executing the queries from a stored procedure and putting the results into temporary tables so that nothing would be returned. Turned out that some of the result sets are using dynamic columns so I couldn't create the corresponding temp tables and thus this isn't a solution. Do you happen to have any other idea?

    Read the article

  • Getting Google results in Java? Need help!

    - by Cris Carter
    Hello. Right now, I'm trying to get the results from Google in Java, by searching for a term. I'm using a desktop program, not an applet. That in itself isn't complicated. but then Google gave me a 403 error. Anyways, I added referrer and User Agent and then it worked. Now, my problem is that I don't get the results page from Google. Instead, I get their script which gets the results page. My code right now simply uses a GET request on "http://www.google.com/search?q=" + Dork; Then it outputs each line. Here is what I get when I run my program: <.!doctype html<.head<.titledork - Google Search<./title<.scriptwindow.google={kEI:"9myaS-Date).getTime()}}};try{}catch(u){}window.google.jsrt_kill=1; align:center}#logo{display:block;overflow:hidden;position:relative;width:103px;height:37px; <./ script<./div Lots of stuff like that. I shortened it (A LOT) and put in dots to fit it here. So my big question is: How do I turn this whole mess into the nice results page I get when searching Google with a browser? Any help would be seriously appreciated, and I really need the answer fast. Also, please keep in mind that I do NOT want to use Google's API for this. Thanks in advance!

    Read the article

  • Cannot install XML::LibXML module on Windows

    - by Deepak Konidena
    I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

    Read the article

  • Can someone describe the nested set model from a C#/LINQ perspective?

    - by Chad
    I know the nested set model doesn't pertain to the C# language or LINQ directly... it's what I'm using to develop my web app. For hierarchical data (categories with sub-categories in my case), I'm currently using something similar to the Adjacency List model. At the moment, I've only got 2 levels of categories, but I'd like to take it further and allow for n levels of categories using the nested set model. I'm not quite clear on how to use it in a C# context. Here's the article I'm reading on the nested set model. Though this article cleared up my confusion some, I still have a big ?? in my head: - Is inserting, updating or deleting categories tedious? It looks like the left and right numbers would require re-numbering... what would the LINQ queries look like for the following scenarios? Delete a child node (re-number all node's left/right values) Delete a parent node (what do you do with the orphans?) Move a child node to a different parent node (renumber again) If my understanding is correct, at all times the child node's left/right values will always be between the parent node's left/right values, am I correct? Seems easy enough, if only the categories were static... most likely I need to spend more time to get my head around the concept. Any help is greatly appreciated!

    Read the article

  • Product Catalog Schema design

    - by FlySwat
    I'm building a proof of concept schema for a product catalog to possibly replace a very aging and crufty one we use. In our business, we sell both physical materials and services (one time and reoccurring charges). The current catalog schema has each distinct category broken out into individual tables, while this is nicely normalized and performs well, it is fairly difficult to extend. Adding a new attribute to a particular product involves changing the table schema and backpopulating old data. An idea I've been toying with has been something along the line of a base set of entity tables in 3rd normal form, these will contain the facts that are common among ALL products. Then, I'd like to build an Attribute-Entity-Value schema that allows each entity type to be extended in a flexible way using just data and no schema changes. Finally, I'd like to denormalize this data model into materialized views for each individual entity type. This views are what the application would access. We also have many tables that contain business rules and compatibility rules. These would join against the base entity tables instead of the views. My big concerns here are: Performance - Attribute-Entity-Value schemas are flexible, but typically perform poorly, should I be concerned? More Performance - Denormalizing using materialized views may have some risks, I'm not positive on this yet. Complexity - While this schema is flexible and maintainable using just data, I worry that the complexity of the design might make future schema changes difficult. For those who have designed product catalogs for large scale enterprises, am I going down the totally wrong path? Is there any good best practice schema design reading available for product catalogs?

    Read the article

  • Fixed mouse pointer with jQuery draggable

    - by MikeWyatt
    I'm building a little game in HTML5. The canvas element is a viewport into the game world. The user can move the viewport's position in the world by clicking and dragging with the mouse on a small icon. The problem is that the scrolling stops when the mouse pointer hits the edge of the screen. In all likelihood, that will limit scrolling in one of the directions severely, since the icon will be in one of the corners of the page. The only technical solution I can think of would be to somehow fix the mouse pointer's position on the icon and detect the relative movement each frame. Basically I would just reset the pointer position back to the center of the icon after each drag event. Unfortunately, I'm fairly positive that this is not possible. Playing with the user's pointer is a big no-no from a usability and security standpoint. So, is there any other way to do what I want? I'm primarily looking for technical ideas here, but suggestions for a more appropriate interface would also be welcome.

    Read the article

  • MYSQL Data -> PHP arrays -> Javascript (or Jquery) How can I pass the data with JSON ?

    - by Alex
    I am starting with a new site (it's my first one) and I am getting big troubles ! I wrote this code <?php include("misc.inc"); $cxn=mysqli_connect($host,$user,$password,$database) or die("couldn't connect to server"); $query="SELECT DISTINCT country FROM stamps"; $result=mysqli_query($cxn,$query) or die ("couldn't execute query"); $numberOfRows=mysqli_num_rows($result); for ($i=0;$i<$numberOfRows;$i++){ $row=mysqli_fetch_assoc($result); extract($row); $a=json_encode($row); $a=$a.","; echo $a; } ?> and the output is as follows : {"country":"liechtenstein"},{"country":"romania"},{"country":"jugoslavia"},{"country":"polonia"}, which should be a correct JSON outout ... How can I get it now in Jquery ? I tried with $.getJSON but I am not able to fuse it properly. I don't want yet to pass the data to a DIV or something similar in HTML. Alex

    Read the article

  • SIMPLE PHP MVC Framework!

    - by Allen
    I need a simple and basic MVC example to get me started. I dont want to use any of the available packaged frameworks. I am in need of a simple example of a simple PHP MVC framework that would allow, at most, the basic creation of a simple multi-page site. I am asking for a simple example because I learn best from simple real world examples. Big popular frameworks (such as code ignighter) are to much for me to even try to understand and any other "simple" example I have found are not well explained or seem a little sketchy in general. I should add that most examples of simple MVC frameworks I see use mod_rewrite (for URL routing) or some other Apache-only method. I run PHP on IIS. I need to be able to understand a basic MVC framework, so that I could develop my own that would allow me to easily extend functionality with classes. I am at the point where I understand basic design patterns and MVC pretty well. I understand them in theory, but when it comes down to actually building a real world, simple, well designed MVC framework in PHP, i'm stuck. I would really appreciate some help! Edit: I just want to note that I am looking for a simple example that an experienced programmer could whip up in under an hour. I mean simple as in bare bones simple. I dont want to use any huge frameworks, I am trying to roll my own. I need a decent SIMPLE example to get me going.

    Read the article

  • Seeking reporting or templating tool to generate large formatted PDF reports from dataset

    - by Mr. Tacos
    Say I have some data in MySQL or a big ole CSV file. I also have a report. It's a PDF, call it 100 pages long. I need to generate variations on this PDF for slices of the data. More specific example: I have a CSV file with each StackOverflow user in a row and each column contains various statistics about that user. I have a report called "Your StackOverflow Performance". Its got lots of text, always the same, but each section contains something like: "You Vs. The Average StackOverflow Poster on this metric". I want a table that appears there that has the average data, which is the same in every run of the PDF, in one column. In the second column, I want your data, which is different for each PDF/row in the CSV file/user of StackOverflow. I'm pretty sure people use things like Crystal for this? Is there something in MS SQL Server that's good for this? An open source template language? I'm not even really sure if what I need is called a 'reporting' tool (since I don't really need to do any crunching, the data in this case is being crunched by a series of scripts and SPSS, I don't need bands and subbands and so on) or 'templating'. Is there even such a thing as templating PDFs? Natch, I'd be fine with something that generates output easily scriptable to PDF, like eps, but not something like HTML. The report formatting is fussy and done and externally determined and handed down from on high. It's print-oriented, not webby. Thanks in advance.

    Read the article

  • Vertical-Align: A Full Explanation

    - by Livvy Jeffs
    I've been struggling with vertical alignments, a seemingly simple enough process that has a lot of idiosyncrasies throughout different languages and element types. I've done a lot of reading through stackexchange and can't seem to find a common thread of understanding. Here are the rules that I have been able to gather: 1) Vertical-align does not work in <\div>s, you have to set div {display: table-cell; vertical-align: middle} This seems like a big hassle, especially since table-cells override the height limitation even when overflow is set to hidden and expands to fit content, which means the vertical "center" is variable. I just read some source-code from Pinterest where button {vertical-align: middle}, but no other vertical-align commands seem to work. It seems as if button is by default aligned in the middle. Can someone provide a clear explanation for the vertical-align attribute? What html elements respond to vertical-align? Which html elements have default vertical-align attributes? Which html elements have non-overridable vertical-align attributes? And any clues as to understanding the idiosyncracies would help as well! Thanks in advance!

    Read the article

  • Read a buffer of unknown size (Console input)

    - by Sanarothe
    Hi. I'm a little behind in my X86 Asm class, and the book is making me want to shoot myself in the face. The examples in the book are insufficient and, honestly, very frustrating because of their massive dependencies upon the author's link library, which I hate. I wanted to learn ASM, not how to call his freaking library, which calls more of his library. Anyway, I'm stuck on a lab that requires console input and output. So far, I've got this for my input: input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP I need to use the input and output procedures multiple times, so I'm trying to make it abstract. I'm just not sure how to use the data that is set to eax here. My initial idea was to take that string array and manually crawl through it by adding 8 to the offset for each possible digit (Input is integer, and there's a little bit of processing) but this doesn't work out because I don't know how big the input actually is. So, how would you swap the string array into an integer that could be used? Full code: (Haven't done the integer logic or the instruction string output because I'm stuck here.) include c:/irvine/irvine32.inc .data inputHandle HANDLE ? outputHandle HANDLE ? buffer BYTE BufSize DUP(?),0,0 bytesRead DWORD ? str1 BYTE "Enter an integer:",0Dh, 0Ah str2 BYTE "Enter another integer:",0Dh, 0Ah str3 BYTE "The higher of the two integers is: " int1 WORD ? int2 WORD ? int3 WORD ? Buf = 80 .code main PROC call handle push str1 call output call input push str2 call output call input push str3 call output call input main EndP larger PROC Ret larger EndP output PROC INVOKE WriteConsole Ret output EndP handle PROC USES eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov inputHandle,eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov outputHandle,eax Ret handle EndP input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP END main

    Read the article

  • Modularity in Flex

    - by Fernando
    I'm working on a pretty big application for Flex/Air. We are using GraniteDS and Tide to interact with the model from our Java EE server. I've been reading about modularization and Modules in Flex. The application has already been built, and I'm figuring a way out to re-design some classes and parts. From what I've read so far, I understand a Module is a different swf which can be dynamically load. Most of the tutorials/documentation are oriented to Flash "programmers" who are using Flex or Air instead of real developers, so that makes online resources harder to get. What I can't understand - yet - is how to encapsulate ActionScript classes or MXML views under this module. I've separated some of the code into libraries. For example, the generated code from Granite is in a "server" library. But I would like to separate parts of the logic with its Moderators, Controllers and Views. Are modules the way to go? Is there a "modules for dummies" or "head first Flex Modules for programmers" like tutorial in order to get a better perspective in order to build my architecture? When to choose libraries and when to choose modules? I'm using Flex 3.5, and a migration to Flex 4 is way far into the future, so no Flex 4 answers please, thanks!

    Read the article

  • Huge mysql table with Zend Framework

    - by Uffo
    I have a mysql table with over 4 million of data; well the problem is that SOME queries WORK and SOME DON'T it depends on the search term, if the search term has a big volume of data in the table than I get the following error: Fatal error: Allowed memory size of 1048576000 bytes exhausted (tried to allocate 75 bytes) in /home/****/public_html/Zend/Db/Statement/Pdo.php on line 290 I currently have Zend Framework cache for metadata enabled, I have index on all the fields from that table.The site is running on a dedicated server with 2gb of ram. I've also set memory limit to: ini_set("memory_limit","1000M"); Any other things that I can optimize? Those are the types of query that I'm currently using: $do = $this->select() ->where('branche LIKE ?','%'.mysql_escape_string($branche).'%') ->order('premium DESC'); } //For name if(empty($branche) && empty($plz)) { $do = $this->select("MATCH(`name`) AGAINST ('{$theString}') AS score") ->where('MATCH(`name`) AGAINST( ? IN BOOLEAN MODE)', $theString) ->order('premium DESC, score'); } And a few other, but they are pretty much the same. Best Regards

    Read the article

  • Where's the Win32 resource for the mouse cursor for dragging splitters?

    - by Luther Baker
    I am building a custom win32 control/widget and would like to change the cursor to a horizontal "splitter" symbol when hovering over a particular vertical line in the control. IE: I want to drag this vertical line (splitter bar) left and right (WEST and EAST). Of the the system cursors (OCR_*), the only cursor that makes sense is the OCR_SIZEWE. Unfortunately, that is the big, awkward cursor the system uses when resizing a window. Instead, I am looking for the cursor that is about 20 pixels tall and around 3 or 4 pixel wide with two small arrows pointing left and right. I can easily draw this and include it as a resource in my application but the cursor itself is so prevalent that I wanted to be sure it wasn't missing something. For example: when you use the COM drag and drop mechanism (CLSID_DragDropHelper, IDropTarget, etc) you implicitly have access to the "drag" icon (little box under the pointer). I didn't see an explicit OCR_* constant for this guy ... so likewise, if I can't find this splitter cursor outright, I am wondering if it is part of a COM object or something else in the win32 lib.

    Read the article

  • Python Pre-testing for exceptions when coverage fails

    - by Tal Weiss
    I recently came across a simple but nasty bug. I had a list and I wanted to find the smallest member in it. I used Python's built-in min(). Everything worked great until in some strange scenario the list was empty (due to strange user input I could not have anticipated). My application crashed with a ValueError (BTW - not documented in the official docs). I have very extensive unit tests and I regularly check coverage to avoid surprises like this. I also use Pylint (everything is integrated in PyDev) and I never ignore warnings, yet I failed to catch this bug before my users did. Is there anything I can change in my methodology to avoid these kind of runtime errors? (which would have been caught at compile time in Java / C#?). I'm looking for something more than wrapping my code with a big try-except. What else can I do? How many other build in Python functions are hiding nasty surprises like this???

    Read the article

  • Perl XML SAX parser emulating XML::Simple record for record

    - by DVK
    Short Q summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog - due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. What I'm looking for is an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been.

    Read the article

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >