Search Results

Search found 8354 results on 335 pages for 'count boxer'.

Page 282/335 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

• Hundreds of custom UserControls create thousands of USER Objects

  - by Andy Blackman

  I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

  Read the article

• A little confused about MVC and where to put a database query

  - by jax

  OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

  Read the article

• Testing ActionMailer's receive method (Rails)

  - by Brian Armstrong

  There is good documentation out there on testing ActionMailer send methods which deliver mail. But I'm unable to figure out how to test a receive method that is used to parse incoming mail. I want to do something like this: require 'test_helper' class ReceiverTest < ActionMailer::TestCase test "parse incoming mail" do email = TMail::Mail.parse(File.open("test/fixtures/emails/example1.txt",'r').read) assert_difference "ProcessedMail.count" do Receiver.receive email end end end But I get the following error on the line which calls Receiver.receive NoMethodError: undefined method `index' for #<TMail::Mail:0x102c4a6f0> /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/stringio.rb:128:in `gets' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:392:in `parse_header' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:139:in `initialize' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/stringio.rb:43:in `open' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/port.rb:340:in `ropen' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:138:in `initialize' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:123:in `new' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:123:in `parse' /Library/Ruby/Gems/1.8/gems/actionmailer-2.3.4/lib/action_mailer/base.rb:417:in `receive' Tmail is parsing the test file I have correctly. So that's not it. Thanks!

  Read the article

• Indy client receive string

  - by Eszee

  Im writing an Indy chat app, and am wondering if there is a way for the server component to tell the client that there is a string waiting, or even a way for the client to have an "OnExecute" like event. This is what i have now: server: procedure TServer.ServerExecute(AContext: TIdContext); var sResponse: string; I: Integer; list: Tlist; begin List := Server.Contexts.LockList; sResponse:= AContext.Connection.Socket.ReadLn; try for I := 0 to List.Count-1 do begin try TIdContext(List[I]).Connection.IOHandler.WriteLn(sResponse); except end; end; finally Server.Contexts.UnlockList; end; end; Client: procedure TForm1.Button1Click(Sender: TObject); var sMsg : string; begin Client.Socket.WriteLn(edit1.Text); sMsg := Client.Socket.ReadLn; Memo1.Lines.Add(sMsg); end; The problem is when i have 2 or more clients running the messages keep stacking because the button only processes 1 message a time. I'd like a way for the client to wait for messages and when it is triggered it processes those messages, like it does now under the button procedure. I've tried to put the "readln" part under a timer, but that causes some major problems. Im Using Delphi 2010 and Indy 10

  Read the article

• Application Code Redesign to reduce no. of Database Hits from Performance Perspective

  - by Rachel

  Scenario I want to parse a large CSV file and inserts data into the database, csv file has approximately 100K rows of data. Currently I am using fgetcsv to parse through the file row by row and insert data into Database and so right now I am hitting database for each line of data present in csv file so currently database hit count is 100K which is not good from performance point of view. Current Code: public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (:id, :code, :connectid, :connectcode)"; $stmt = $this->prepare($query); // Then, for each line : bind the parameters $stmt->bindValue(':id', $data[0], PDO::PARAM_INT); $stmt->bindValue(':code', $data[1], PDO::PARAM_INT); $stmt->bindValue(':connectid', $data[2], PDO::PARAM_INT); $stmt->bindValue(':connectcode', $data[3], PDO::PARAM_INT); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } } I am looking for a way wherein instead of hitting Database for every row of data, I can prepare the query and than hit it once and populate Database with the inserts. Any Suggestions !!! Note: This is the exact sample code that I am using but CSV file has more no. of field and not only id, code, connectid and connectcode but I wanted to make sure that I am able to explain the logic and so have used this sample code here. Thanks !!!

  Read the article

• SQL Server 2008 Stored Proc suddenly returns -1

  - by aaginor

  I use the following stored procedure from my SQL Server 2008 database to return a value to my C#-Program ALTER PROCEDURE [dbo].[getArticleBelongsToCatsCount] @id int AS BEGIN SET NOCOUNT ON; DECLARE @result int; set @result = (SELECT COUNT(*) FROM art_in_cat WHERE child_id = @id); return @result; END I use a SQLCommand-Object to call this Stored Procedure public int ExecuteNonQuery() { try { return _command.ExecuteNonQuery(); } catch (Exception e) { Logger.instance.ErrorRoutine(e, "Text: " + _command.CommandText); return -1; } } Till recently, everything works fine. All of a sudden, the stored procedure returned -1. At first, I suspected, that the ExecuteNonQuery-Command would have caused and Exception, but when stepping through the function, it shows that no Exception is thrown and the return value comes directly from return _command.ExecuteNonQuery(); I checked following parameters and they were as expected: - Connection object was set to the correct database with correct access values - the parameter for the SP was there and contained the right type, direction and value Then I checked the SP via SQLManager, I used the same value for the parameter like the one for which my C# brings -1 as result (btw. I checked some more parameter values in my C' program and they ALL returned -1) but in the manager, the SP returns the correct value. It looks like the call from my C# prog is somehow bugged, but as I don't get any error (it's just the -1 from the SP), I have no idea, where to look for a solution.

  Read the article

• Constructor initializer list: code from the C++ Primer, chapter 16

  - by Alexandros Gezerlis

  Toward the end of Chapter 16 of the "C++ Primer" I encountered the following code (I've removed a bunch of lines): class Sales_item { public: // default constructor: unbound handle Sales_item(): h() { } private: Handle<Item_base> h; // use-counted handle }; My problem is with the Sales_item(): h() { } line. For the sake of completeness, let me also quote the parts of the Handle class template that I think are relevant to my question (I think I don't need to show the Item_base class): template <class T> class Handle { public: // unbound handle Handle(T *p = 0): ptr(p), use(new size_t(1)) { } private: T* ptr; // shared object size_t *use; // count of how many Handles point to *ptr }; I would have expected something like either: a) Sales_item(): h(0) { } which is a convention the authors have used repeatedly in earlier chapters, or b) Handle<Item_base>() if the intention was to invoke the default constructor of the Handle class. Instead, what the book has is Sales_item(): h() { }. My gut reaction is that this is a typo, since h() looks suspiciously similar to a function declaration. On the other hand, I just tried compiling under g++ and running the example code that uses this class and it seems to be working correctly. Any thoughts?

  Read the article

• StreamReader not working as expected

  - by Jon Preece

  Hi, I have written a simple utility that loops through all C# files in my project and updates the copyright text at the top. For example, a file may look like this; //Copyright My Company, © 2009-2010 The program should update the text to look like this; //Copyright My Company, © 2009-2010 However, the code I have written results in this; //Copyright My Company, � 2009-2011 Here is the code I am using; public bool ModifyFile(string filePath, List<string> targetText, string replacementText) { if (!File.Exists(filePath)) return false; if (targetText == null || targetText.Count == 0) return false; if (string.IsNullOrEmpty(replacementText)) return false; string modifiedFileContent = string.Empty; bool hasContentChanged = false; //Read in the file content using (StreamReader reader = File.OpenText(filePath)) { string file = reader.ReadToEnd(); //Replace any target text with the replacement text foreach (string text in targetText) modifiedFileContent = file.Replace(text, replacementText); if (!file.Equals(modifiedFileContent)) hasContentChanged = true; } //If we haven't modified the file, dont bother saving it if (!hasContentChanged) return false; //Write the modifications back to the file using (StreamWriter writer = new StreamWriter(filePath)) { writer.Write(modifiedFileContent); } return true; } Any help/suggestions are appreciated. Thanks!

  Read the article

• Modifying bundled properties from visitor

  - by ravenspoint

  How should I modify the bundled properties of a vertex from inside a visitor? I would like to use the simple method of sub-scripting the graph, but the graph parameter passed into the visitor is const, so compiler disallows changes. I can store a reference to the graph in the visitor, but this seems weird. /** A visitor which identifies vertices as leafs or trees */ class bfs_vis_leaf_finder:public default_bfs_visitor { public: /** Constructor @param[in] total reference to int variable to store total number of leaves @param[in] g reference to graph ( used to modify bundled properties ) */ bfs_vis_leaf_finder( int& total, graph_t& g ) : myTotal( total ), myGraph( g ) { myTotal = 0; } /** Called when the search finds a new vertex If the vertex has no children, it is a leaf and the total leaf count is incremented */ template <typename Vertex, typename Graph> void discover_vertex( Vertex u, Graph& g) { if( out_edges( u, g ).first == out_edges( u, g ).second ) { myTotal++; //g[u].myLevel = s3d::cV::leaf; myGraph[u].myLevel = s3d::cV::leaf; } else { //g[u].myLevel = s3d::cV::tree; myGraph[u].myLevel = s3d::cV::tree; } } int& myTotal; graph_t& myGraph; };

  Read the article

• How to validate DataReader is actually closed using FxCop custom rule?

  - by tanmay

  I have written couple of custom rules in for FxCop 1.36. I have written code to find weather an opened DataReader is closed or not. But it does not check which DataReader object is calling the Close() method so I can't be sure if all opened DataReader objects are closed!! 2nd: If I am a DataReader in an 'if/else' like if 1=2 dr = cmd.ExecuteReader(); else dr = cmd2.ExecuteReader(); end if In this case it will search for 2 DataReader objects to be closed. I am putting my code for more clarity. public override ProblemCollection Check(Member member) { Method method = member as Method; int countCatch =0; int countErrLog = 0; Instruction objInstr = null; if (method != null) { for (int i = 0; i < method.Instructions.Count; i++) { objInstr = method.Instructions[i]; if (objInstr.Value != null) { if (objInstr.Value.ToString() .Contains("System.Data.SqlClient.SqlDataReader")) { countCatch += 1; } if (countCatch>0) { if (objInstr.Value.ToString().Contains( "System.Data.SqlClient.SqlDataReader.Close")) { countErrLog += 1; } } } } } if (countErrLog!=countCatch) { Resolution resolu = GetResolution(new string[] { method.ToString() }); Problems.Add(new Problem(resolu)); } return Problems; }

  Read the article

• How to find whole graph coverage path in dynamic state-flow diagram?

  - by joseph

  Hello, As I've been researching algorithms for path finding in graph, I found interesting problem. Definition of situation: 1)State diagram can have p states, and s Boolean Fields, and z Int Fields 2)Every state can have q ingoing and r outgoing transitions, and h Int fields (h belongs to z - see above) 3)Every transition can have only 1 event, and only 1 action 4)every action can change n Boolean Fields, and x Int Fields 5)every event can have one trigger from combination of any count of Boolean Fields in diagram 6)Transition can be in OPEN/CLOSED form. If the transition is open/closed depends on trigger2 compounded from 0..c Boolean fields. 7) I KNOW algorithm for finding shortest paths from state A to state B. 8) I KNOW algorithm for finding path that covers all states and transitions of whole state diagram, if all transitions are OPEN. Now, what is the goal: I need to find shortest path that covers all states and transitions in dynamically changing state diagram described above. When an action changes some int field, the algorithm should go through all states that have changed int field. The algorithm should also be able to open and close transition (by going through transitions that open and close another transitions by action) in the way that the founded path will be shortest and covers all transitions and states. Any idea how to solve it? I will be really pleased for ANY idea. Thanks for answers.

  Read the article

• Is there a way to detect Layout or Display changes in WPF?

  Hello! I am trying to check how fast the Frame control can display a FixedPage object when it is assigned to Frame.Content property. I plan to check the tick count before and after the assignment to the Content property. Example: int starttime = Environment.TickCount; frame1.Content = fixedpage; int endtime = Environment.TickCount; The problem is that the assignment to the Content property might be asynchronous and returns immediately therefore i get a zero amount of time. The rendering of the FixedPage however visually has a lag time from assignment of the Content property up to the point where the FixedPage appears on screen. The Frame.ContentChanged() event is no good either because it gets triggered even before the FixedPage appears on screen so it's not accurate. I'm thinking of detecting the change on the window or control's display instead in order to get the time when the FixedPage is actually displayed on screen. Is there a way to do this in WPF? Thanks!

  Read the article

• Runtime Error 1004 using Select with several workbooks

  - by Johaen

  I have an Excel workbook which pulls out data from two other workbooks. Since the data changes hourly there is the possibility that this macro is used more than one time a day for the same data. So I just want to select all previous data to this date period and want to delete them. Later on the data will be copied in anyway. But as soon as I want to use WBSH.Range(Cells(j, "A"), Cells(lastRow - 1, "M")).Select the code stopes with Error 1004 Application-defined or object-defined error. Followed just a snippet of the code with the relevant part. What is wrong here? 'Set source workbook Dim currentWb As Workbook Set currentWb = ThisWorkbook Set WBSH = currentWb.Sheets("Tracking") 'Query which data from the tracking files shoud get pulled out to the file CheckDate = Application.InputBox(("From which date you want to get data?" & vbCrLf & "Format: yyyy/mm/dd "), "Tracking data", Format(Date - 1, "yyyy/mm/dd")) 'states the last entry which is done ; know where to start ; currentWb File With currentWb.Sheets("Tracking") lastRow = .Range("D" & .Rows.Count).End(xlUp).Row lastRow = lastRow + 1 End With 'just last 250 entries get checked since not so many entries are made in one week j = lastRow - 250 'Check if there is already data to the look up date in the analyses sheet and if so deletes these records Do j = j + 1 'Exit Sub if there is no data to compare to prevent overflow If WBSH.Cells(j + 1, "C").Value = "" Then Exit Do End If Loop While WBSH.Cells(j, "C").Value < CheckDate If j <> lastRow - 1 Then 'WBSH.Range(Cells(j, "A"), Cells(lastRow - 1, "M")).Select 'Selection.ClearContents End If Thank you!

  Read the article

• Can't add/remove items from a collection while foreach is iterating over it

  - by flockofcode

  If I make my own implementation of IEnumerator interface, then I am able ( inside foreach statement )to add or remove items from a albumsList without generating an exception.But if foreach statement uses IEnumerator supplied by albumsList, then trying to add/delete ( inside the foreach )items from albumsList will result in exception: class Program { static void Main(string[] args) { string[] rockAlbums = { "rock", "roll", "rain dogs" }; ArrayList albumsList = new ArrayList(rockAlbums); AlbumsCollection ac = new AlbumsCollection(albumsList); foreach (string item in ac) { Console.WriteLine(item); albumsList.Remove(item); //works } foreach (string item in albumsList) { albumsList.Remove(item); //exception } } class MyEnumerator : IEnumerator { ArrayList table; int _current = -1; public Object Current { get { return table[_current]; } } public bool MoveNext() { if (_current + 1 < table.Count) { _current++; return true; } else return false; } public void Reset() { _current = -1; } public MyEnumerator(ArrayList albums) { this.table = albums; } } class AlbumsCollection : IEnumerable { public ArrayList albums; public IEnumerator GetEnumerator() { return new MyEnumerator(this.albums); } public AlbumsCollection(ArrayList albums) { this.albums = albums; } } } a) I assume code that throws exception ( when using IEnumerator implementation A supplied by albumsList ) is located inside A? b) If I want to be able to add/remove items from a collection ( while foreach is iterating over it), will I always need to provide my own implementation of IEnumerator interface, or can albumsList be set to allow adding/removing items? thank you

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Cant access NString after callback in [NSURLConnection sendSynchronousRequest]

  - by John ClearZ

  Hi I am trying to get a cookie from a site which I can do no problem. The problem arises when I try and save the cookie to a NSString in a holder class or anywhere else for that matter and try and access it outside the delegate method where it is first created. - (void)connection:(NSURLConnection *)connection didReceiveResponse:(NSURLResponse *)response { int i; NSString* c; NSArray* all = [NSHTTPCookie cookiesWithResponseHeaderFields:[response allHeaderFields] forURL:[NSURL URLWithString:@"http://johncleary.net"]]; //NSLog(@"RESPONSE HEADERS: \n%@", [response allHeaderFields]); for (i=0;i<[all count];i++) { NSHTTPCookie* cc = [all objectAtIndex: i]; c = [NSString stringWithFormat: @"%@=%@", [cc name], [cc value]]; [Cookie setCookie: c]; NSLog([Cookie cookie]) // Prints the cookie fine. } [receivedData setLength:0]; } I can see and print the cookie when I am in the method but I cant when trying to access it form anywhere else even though it gets stored in the holder class @interface Cookie : NSObject { NSString* cookie; } + (NSString*) cookie; + (void) setCookie: (NSString*) cookieValue; @end int main (void) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; JCLogin* login; login = [JCLogin new]; [login DoLogin]; NSLog([Cookie cookie]); // Crashes the program [pool drain]; return 0; }

  Read the article

• MySQL left outer join is slow

  - by Ryan Doherty

  Hi, hoping to get some help with this query, I've worked at it for a while now and can't get it any faster: SELECT date, count(id) as 'visits' FROM dates LEFT OUTER JOIN visits ON (dates.date = DATE(visits.start) and account_id = 40 ) WHERE date >= '2010-12-13' AND date <= '2011-1-13' GROUP BY date ORDER BY date ASC That query takes about 8 seconds to run. I've added indexes on dates.date, visits.start, visits.account_id and visits.start+visits.account_id and can't get it to run any faster. Table structure (only showing relevant columns in visit table): create table visits ( `id` int(11) NOT NULL AUTO_INCREMENT, `account_id` int(11) NOT NULL, `start` DATETIME NOT NULL, `end` DATETIME NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; CREATE TABLE `dates` ( `date` date NOT NULL, PRIMARY KEY (`date`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1; dates table contains all days from 2010-1-1 to 2020-1-1 (~3k rows). visits table contains about 400k rows dating from 2010-6-1 to yesterday. I'm using the date table so the join will return 0 visits for days there were no visits. Results I want for reference: +------------+--------+ | date | visits | +------------+--------+ | 2010-12-13 | 301 | | 2010-12-14 | 356 | | 2010-12-15 | 423 | | 2010-12-16 | 332 | | 2010-12-17 | 346 | | 2010-12-18 | 226 | | 2010-12-19 | 213 | | 2010-12-20 | 311 | | 2010-12-21 | 273 | | 2010-12-22 | 286 | | 2010-12-23 | 241 | | 2010-12-24 | 149 | | 2010-12-25 | 102 | | 2010-12-26 | 174 | | 2010-12-27 | 258 | | 2010-12-28 | 348 | | 2010-12-29 | 392 | | 2010-12-30 | 395 | | 2010-12-31 | 278 | | 2011-01-01 | 241 | | 2011-01-02 | 295 | | 2011-01-03 | 369 | | 2011-01-04 | 438 | | 2011-01-05 | 393 | | 2011-01-06 | 368 | | 2011-01-07 | 435 | | 2011-01-08 | 313 | | 2011-01-09 | 250 | | 2011-01-10 | 345 | | 2011-01-11 | 387 | | 2011-01-12 | 0 | | 2011-01-13 | 0 | +------------+--------+ Thanks in advance for any help!

  Read the article

• Why am I getting a EXC_BAD_ACCESS in a NSTimer selector?

  - by AngeDeLaMort

  I've got quite a weird problem. To make it short, i'll write some pseudo-code: init: create a dictionary and insert n elements. create a "repeat timer" and add it to the currentRunLoop using the timerRefresh selector. timerRefresh: using a list of keys, find the items in the dictionary if the item exists -> call a function So, for an unknown reason, I get an EXC_BAD_ACCESS when I do: [item function]; But I traced the address I got from the dictionary items and it's ok. The ref count of the items in the dictionary is still 1. The {release, dealloc} of the items in the dictionary aren't called. Everything seems fine. Also, to make it worst, it works for some items. So, I'm wondering if there is a threading problem? or something else obscure? The callstack is quite simple: #0 0x93e0604b in objc_msgSend_fpret #1 0x00f3e6b0 in ?? #2 0x0001cfca in -[myObject functionm:] at myObject.m:000 #3 0x305355cd in __NSFireTimer #4 0x302454a0 in CFRunLoopRunSpecific #5 0x30244628 in CFRunLoopRunInMode #6 0x32044c31 in GSEventRunModal #7 0x32044cf6 in GSEventRun #8 0x309021ee in UIApplicationMain #9 0x000027e0 in main at main.m:14 So, any suggestion where to look would be appreciated.

  Read the article

• twitter streaming api instead of search api

  - by user1711576

  I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

  Read the article

• How to combine the multiple part linq into one query?

  - by user2943399

  Operator should be ‘AND’ and not a ‘OR’. I am trying to refactor the following code and i understood the following way of writing linq query may not be the correct way. Can somone advice me how to combine the following into one query. AllCompany.Where(itm => itm != null).Distinct().ToList(); if (AllCompany.Count > 0) { //COMPANY NAME if (isfldCompanyName) { AllCompany = AllCompany.Where(company => company["Company Name"].StartsWith(fldCompanyName)).ToList(); } //SECTOR if (isfldSector) { AllCompany = AllCompany.Where(company => fldSector.Intersect(company["Sectors"].Split('|')).Any()).ToList(); } //LOCATION if (isfldLocation) { AllCompany = AllCompany.Where(company => fldLocation.Intersect(company["Location"].Split('|')).Any()).ToList(); } //CREATED DATE if (isfldcreatedDate) { AllCompany = AllCompany.Where(company => company.Statistics.Created >= createdDate).ToList(); } //LAST UPDATED DATE if (isfldUpdatedDate) { AllCompany = AllCompany.Where(company => company.Statistics.Updated >= updatedDate).ToList(); } //Allow Placements if (isfldEmployerLevel) { fldEmployerLevel = (fldEmployerLevel == "Yes") ? "1" : ""; AllCompany = AllCompany.Where(company => company["Allow Placements"].ToString() == fldEmployerLevel).ToList(); }

  Read the article

• measure the response time of a link

  - by Ahoura Ghotbi

  I am trying to create a simple load balance script and I was wondering if it is possible to find the response time of a server live? By that I mean is it possible to measure how long it takes for a server to respond after the request has been sent out? What I am trying to do is fairly simple, I want to send a request to a link/server and do a count down, if the server took more than 5 seconds to reply, I would like to fall on the backup server. Note that it doesnt have to be in pure php, I wouldnt mind using other languages such as javascript, C/C++, asp, but I prefer to do it in PHP. if it is possible to do the task, could you just point me to the right direction so I can read up on it. Clarification What I want to do is not to download a file and see how long it took, my servers have high load and it takes a while for them to respond when you click on a file to download, what I want to do is to measure the time it takes the server to respond (in this situation, its the time it takes the server to respond and allow the user to download the file), and if it takes longer than x seconds, it should fall back on a backup server.

  Read the article

• How can I get the Twitter following and follower Email id and MobileNo in the iPhone sdk Using MGTwitterEngine?

  - by user1808090

  I'm unable to get the Twitter following and Followers Email id and MobileNo i am using below code for that using below code i am able to get only Twitter following name and Id Please help? if([[NSUserDefaults standardUserDefaults] valueForKey:@"UseridLoop"]==nil) { urlString = [NSString stringWithFormat:@"https://api.twitter.com/1/friends/ids.json?cursor=-1&user_id=%@",[[NSUserDefaults standardUserDefaults] valueForKey:@"Userid"]]; } else { urlString = [NSString stringWithFormat:@"https://api.twitter.com/1/followers/ids.json?cursor=-1&user_id=%@",[[NSUserDefaults standardUserDefaults] valueForKey:@"UseridLoop"]]; } NSURLRequest *notificationRequest = [NSURLRequest requestWithURL:[NSURL URLWithString:urlString]]; NSHTTPURLResponse *response; NSError *error; NSData *responData; responData = [NSURLConnection sendSynchronousRequest:notificationRequest returningResponse:&response error:&error]; NSLog(@"%@",responData); NSString *dataString = [[NSString alloc] initWithData:responData encoding:NSUTF8StringEncoding]; // NSDictionary *dict = [[NSDictionary alloc] initWithDictionary:(NSDictionary *)[dataString JSONValue]]; // // NSMutableDictionary *globalCelebDict=[[NSMutableDictionary alloc]initWithDictionary:(NSMutableDictionary *)[dataString JSONValue ] ]; // //NSMutableDictionary *globalCelebDictNext=[[NSMutableDictionary alloc]initWithDictionary:(NSMutableDictionary *)[[ globalCelebDict objectForKey:@"GetGroupDetailsResult"] JSONValue]]; // NSLog(@"dict %@",dict); SBJSON *json = [[SBJSON alloc] init]; NSMutableDictionary *customDetailDict=[[NSMutableDictionary alloc]init]; customDetailDict=[json objectWithString:dataString error:&error]; // NSDictionary *customDetailDict = [json objectWithString:dataString error:&error]; NSLog(@"%@",customDetailDict); if (customDetailDict!=nil) { array=[[customDetailDict objectForKey:@"ids"]retain]; NSLog(@"%@",array); NSLog(@"%d",[array count]); [[NSUserDefaults standardUserDefaults]removeObjectForKey:@"UseridLoop"]; NSLog(@"%@",[[NSUserDefaults standardUserDefaults]valueForKey:@"UseridLoop"]); } }

  Read the article

• Listview not being populated

  - by Luke

  I have put some console.writeline code in to test, but they arent appearing in the output box? public static ArrayList myDeliveries = new ArrayList(); public mainForm() { InitializeComponent(); } private void mainForm_Load(object sender, EventArgs e) { if (!File.Exists("../../MealDeliveries.txt")) { MessageBox.Show("File not found!"); return; } using (StreamReader sr = new StreamReader("../../MealDeliveries.txt")) { //first line is delivery name string strDeliveryName = sr.ReadLine(); Console.WriteLine("some tetttttttttt23423423423423423ttttttttttttttttttttttt"); while (strDeliveryName != null) { //other lines Delivery d = new Delivery(strDeliveryName, sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine()); mainForm.myDeliveries.Add(d); //check for further values strDeliveryName = sr.ReadLine(); } } displayDeliveries(); } private void displayDeliveries() { lstDeliveryDetails.Items.Clear(); Console.WriteLine("some tettttttttttttttttttttttttttttttttt"); Console.WriteLine(mainForm.myDeliveries.Count); foreach (Delivery d in mainForm.myDeliveries) { lstDeliveryDetails.Items.Add(d.DeliveryName); } } Can anyone help??

  Read the article

• Returning a reference from a Class member?

  - by nebukadnezzar

  Hi, I've a class that basically looks like this: class App { public function newTemplate($filename, $vars=array()) { $smarty = new Smarty; $smarty->compile_dir = $this->template_compile_path; if(count($vars) > 0) { foreach($vars as $v_key => $v_name) { $smarty->assign($v_key, $v_name); } } return $smarty; } } However, when I create a Instance of 'App', the reference to $smarty seems broken, as every call to the membermethods don't seem to do anything: $app = new App; $tpl = $app->newTemplate("index.tmpl"); $tpl->assign("foo", "bar"); // {$foo} does not appear with "bar" in the template Now I wonder why? Of course I tried to use references: ... public function &newTemplate() ... ... But that doesn't work. Variable references don't seem to work either: ... $tpl = &$app->newTemplate("index.tmpl"); ... What is causing PHP here not to return a proper reference? Help is very appreciated!

  Read the article

• Should I use early returns in C#?

  - by Bobby

  I've learned Visual Basic and was always taught to keep the flow of the program without interruptions, like Goto, Exit and Return. Using nested ifs instead of one return statement seems very natural to me. Now that I'm partly migrating towards C#, I wonder what the best practice is for C-like languages. I've been working on a C# project for some time, and of course discover more code of ExampleB and it's hurting my mind somehow. But what is the best practice for this, what is more often used and are there any reasons against one of the styles? public void ExampleA() { if (a != b) { if (a != c) { bool foundIt; for (int i = 0; i < d.Count && !foundIt; i++) { if (element == f) foundIt = true; } } } } public void ExampleB() { if (a == b) return; if (a == c) return; foreach (object element in d) { if (element == f) break; } }

  Read the article

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >