Search Results

Search found 1931 results on 78 pages for 'clever human'.

Page 29/78 | < Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >

  • In Rails, how should I implement a Status field for a Tasks app - integer or enum?

    - by Doug
    For a Rails 3.0 Todo app, I have a Tasks model with a Status field. What's the best way to store the Status field data (field type) and still display a human-readable version in a view (HTML table)? Status can be: 0 = Normal 1 = Active 2 = Completed Right now I have this: Rails Schema Here: create_table "tasks", :force = true do |t| t.integer "status", :limit = 1, :default = 0, :null = false Rails Model Here: class Task < ActiveRecord::Base validates_inclusion_of :status, :in => 0..2, :message => "{{value}} must be 0, 1, or 2" Rails View Here: <h1>Listing tasks</h1> <table> <tr> <th>Status</th> <th>Name</th> <th></th> <th></th> <th></th> </tr> <% @tasks.each do |task| %> <tr> <td><%= task.status %></td> <td><%= task.name %></td> <td><%= link_to 'Show', task %></td> <td><%= link_to 'Edit', edit_task_path(task) %></td> <td><%= link_to 'Delete', task, :confirm => 'Are you sure?', :method => :delete %></td> </tr> <% end %> </table> Requirements Store a Task's status in the db such that the values are easily localizable, i.e. I'm not sure I want to store "normal", "active", "completed" as a string field. Solution must work with Rails 3.0. Questions: Should I store the field as an integer (see above)? If so, how do I display the correct human readable status in an HTML table in my Rails view, e.g. show "Active" instead of "1" in the HTML table. Should I use an enum? If so, is this easy to localize later? Should I use straight strings, e.g. "Normal", "Active", "Completed" Can you provide a quick code sample of the view helper, controller or view code to make this work?

    Read the article

  • iPhone SDK: How to record voices with ambient noise supression?

    - by Harkonian
    Can anyone point me in the right direction on how I would minimize ambient noise while recording someone speaking using the iPhone SDK Core Audio? I'm guessing a band-pass filter that eliminates any frequencies above and below the human vocal range might work. I have no idea how I would implement band filters on audio in the SDK though. The optimum solution would be one that eliminates the noise from the stream before it is written to memory/disk. Some sample code would be appreciated.

    Read the article

  • I want to scramble an array in PHP

    - by BRUL
    I want PHP to randomly create a multi-dimensional array by picking a vast amount of items out of predefined lists for n times, but never with 2 times the same. Let me put that to human words in a real-life example: i want to write a list of vegetables and meat and i want php to make a menu for me, with every day something else then yesterday. I tried and all i got was the scrambling but there were always doubles :s

    Read the article

  • Explain why MickroC pic18f4550 HID example works

    - by Dr Deo
    MickroC compiler has a library for HID(Human Interface Device) usb communication. In the supplied samples, they specify that the buffers below should be in USB ram and use a pic18f4550. unsigned char readbuff[64] absolute 0x500; // Buffers should be in USB RAM, please consult datasheet unsigned char writebuff[64] absolute 0x540; But the pic18f4550 datasheet says USB ram ranges from 400h to 4FFh So why does their example work when their buffers appear not to be between 400h to 4FFh? Link to full source

    Read the article

  • Difference between Service Engineer and FAE

    - by JB
    I'm a young engineer looking into different fields I can get into, and recently I've come across tons of FAE jobs (live in Japan) Another position is a service engineering position. My question is what's the difference between a Field appllication engineer and service engineer? (I hear that FAE job's require more sales and human interaction with pre-sales and post-sales support? And service engineers are basically highly specialized technicians that service broken equipment or something?) Appreciate any help

    Read the article

  • sqlite3 timestamp column

    - by Flavius
    Hi I feel stupid, but I can't get a TIMESTAMP column to be shown in human understandable way in a SELECT. I could do that in MySQL, not in sqlite3. Could someone show me an example please? Thanks

    Read the article

  • sizeof derived already from base

    - by Oops
    Hi, is it possible to return the sizeof a derived class already from base class/struct? imho the size of a class is a kind of property of itself, like the weight of a human being. But I don't want to write the same function in every class. many thanks in advance Oops

    Read the article

  • Rating mechanisms

    - by Jasie
    Is there any place that showcases a bunch of different types of rating systems (like using multiple sliders, star ratings, up/down votes)? I'm trying to get ideas for a better rating system than just up/down (more criteria). (I'm not interested in the backend, but the human/computer interaction part of it).

    Read the article

  • Prevent windows from presenting any dialog on native code unhandled exception

    - by Lucas Meijer
    Our buildserver compiles and runs testsuites for many different c++ programs. From time to time the programs are buggy, and can crash. When they crash, Windows7 will always throw this modal dialog: Which has to be clicked away by a human being, causing the buildserver to sit idle. Is there a way to at a system level prevent this from happening? I know I can do it from within the process itself, but I'd love to be able to do it across the entire system.

    Read the article

  • Incomplete information card game

    - by binil
    I would like to develop a trick taking card game. The game is between four players, one of which is a human and the other three hands are played by the computer. Where can I read up about developing the AI for such games?

    Read the article

  • Exact textual representation of an IEEE "double"

    - by CyberShadow
    I need to represent an IEEE 754-1985 double (64-bit) floating point number in a human-readable textual form, with the condition that the textual form can be parsed back into exactly the same (bit-wise) number. Is this possible/practical to do without just printing the raw bytes? If yes, code to do this would be much appreciated.

    Read the article

  • Package to compare LSA, TFIDF, Cosine metrics and Language Models

    - by gouwsmeister
    Hi, I'm looking for a package (any language, really) that I can use on a corpus of 50 documents to perform interdocument similarity testing in various metrics, like tfidf, okapi, language models, lsa, etc. I want as a result a document similarity matrix, i.e. doc1 is x% similar to doc2, etc... This is for research purposes, not for production. I specifically want the doc similarity matrix as I want to correlate this with human ratings. Thank you in advance!

    Read the article

  • Does Google punish content duplication across multiple country domains?

    - by Logan Koester
    I like the way Google handles internationalization, with domains such as google.co.uk, google.nl, google.de etc. I'd like to do this for my own site, but I'm concerned that Google will interpret this as content duplication, particularly across countries that speak the same human language, as there won't be any translation to hint that the content is different. My site is a web application, not a content farm, so is this a legitimate concern? Would I be better off with subdomains of my .com? Directories?

    Read the article

  • How do I distinguish files and folders on an FTP server

    - by soulmerge
    I want to list all files on an FTP server using PHP. According to RFC 959 the FTP command LIST is allowed to print arbitrary human-readable information on files/folders, which seems to make it impossible to determine the file type correctly. But how do other FTP clients manage to distinguish files and folders? Is there an unwritten standard or such?

    Read the article

  • Sorting a list of colors in one dimension?

    - by Ptah- Opener of the Mouth
    I would like to sort a one-dimensional list of colors so that colors that a typical human would perceive as "like" each other are near each other. Obviously this is a difficult or perhaps impossible problem to get "perfectly", since colors are typically described with three dimensions, but that doesn't mean that there aren't some sorting methods that look obviously more natural than others. For example, sorting by RGB doesn't work very well, as it will sort in the following order, for example: (1) R=254 G=0 B=0 (2) R=254 G=255 B=0 (3) R=255 G=0 B=0 (4) R=255 G=255 B=0 That is, it will alternate those colors red, yellow, red, yellow, with the two "reds" being essentially imperceivably different than each other, and the two yellows also being imperceivably different from each other. But sorting by HLS works much better, generally speaking, and I think HSL even better than that; with either, the reds will be next to each other, and the yellows will be next to each other. But HLS/HSL has some problems, too; things that people would perceive as "black" could be split far apart from each other, as could things that people would perceive as "white". Again, I understand that I pretty much have to accept that there will be some splits like this; I'm just wondering if anyone has found a better way than HLS/HSL. And I'm aware that "better" is somewhat arbitrary; I mean "more natural to a typical human". For example, a vague thought I've had, but have not yet tried, is perhaps "L is the most important thing if it is very high or very low", but otherwise it is the least important. Has anyone tried this? Has it worked well? What specifically did you decide "very low" and "very high" meant? And so on. Or has anyone found anything else that would improve upon HSL? I should also note that I am aware that I can define a space-filling curve through the cube of colors, and order them one-dimensionally as they would be encountered while travelling along that curve. That would eliminate perceived discontinuities. However, it's not really what I want; I want decent overall large-scale groupings more than I want perfect small-scale groupings. Thanks in advance for any help.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >