Search Results

Search found 49193 results on 1968 pages for 'name range'.

Page 29/1968 | < Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >

  • Range partition skip check

    - by user289429
    We have large amount of data partitioned on year value using range partition in oracle. We have used range partition but each partition contains data only for one year. When we write a query targeting a specific year, oracle fetches the information from that partition but still checks if the year is what we have specified. Since this year column is not part of the index it fetches the year from table and compares it. We have seen that any time the query goes to fetch table data it is getting too slow. Can we somehow avoid oracle comparing the year values since we for sure know that the partition contains information for only one year.

    Read the article

  • Searching a 2D array for a range of values in java

    - by Paige O
    I have a 2^n size int array and I want to check if an element exists that is greater than 0. If the element exists, I want to divide the array by 4 and check if the coordinates of the found element are in the 1st, 2nd, 3rd or 4th quadrant of the array. For example, logically if the element exists in the first quadrant it would look something like this: If array[][] 0 && the row of that coordinate is in the range 0-(grid.length/2-1) && the column of that coordinate is in the range 0-(grid.length/2-1) then do something. I'm really not sure how to check the row and column index of the found element and store those coordinates to use in my if statement. Help!

    Read the article

  • Getting column index out of range, 0 < 1

    - by Natraj
    I am using OpenJPA 2.2.0 and when I am executing a select statement I am getting "Column index out of range, 0 < 1" error. EntityManager entityMgrObj = emf.getEntityManager(); entityMgrObj.clear(); Query query = entityMgrObj.createNativeQuery("select * from company_user where user_id = 1001); List<CompanyUserDO> companyUserDOObj = null; try { companyUserDOObj = query.getResultList(); } catch (Exception e) { System.out.println(e.getMessage()); } When the query.getResultList() executes I get "Column index out of range, 0 < 1" error. Can somebody let me know what is wrong in the above code?

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • Select a row having a column with max value - On a date range

    - by Abhi
    Excuse me for posting a similar question. Please consider this: date value 18/5/2010, 1 pm 40 18/5/2010, 2 pm 20 18/5/2010, 3 pm 60 18/5/2010, 4 pm 30 18/5/2010, 5 pm 60 18/5/2010, 6 pm 25 19/5/2010, 6 pm 300 19/5/2010, 6 pm 450 19/5/2010, 6 pm 375 20/5/2010, 6 pm 250 20/5/2010, 6 pm 310 The query is to get the date and value for each day such that the value obtained for that day is max. If the max value is repeated on that day, the lowest time stamp is selected. The result should be like: 18/5/2010, 3 pm 60 19/5/2010, 6 pm 450 20/5/2010, 6 pm 310 The query should take in a date range like the one given below and find results for that range in the above fashion: where date = to_date('26/03/2010','DD/MM/YYYY') AND date < to_date('27/03/2010','DD/MM/YYYY')

    Read the article

  • Filter records based on Date Range + ASP.NET + Regex + Javascript

    - by ASIF
    Hi I need to filter data based on a date range. My table has a field Process date. I need to filter the records and display those in the range FromDate to ToDate. How do I write a function in VB.NET which can help me filter the data. Protected Shared Function ObjectInRange(ByRef obj As Object, ByVal str1 As String, ByVal str2 As String) As Boolean Dim inRange = False For Each prop As PropertyInfo In obj.GetType().GetProperties() Dim propVal = prop.GetValue(obj, Nothing) If propVal Is Nothing Then Continue For End If Dim propValString = Convert.ToString(propVal) If Regex....WHAT GOES HERE? Then inRange = True Exit For End If Next Return inRange End Function Am I on the right track??

    Read the article

  • Jquery UI Datepicker Date Range Inline Problem

    - by codeworxx
    Hey Guys, i have a big Problem with jQuery UI Datepicker. I have two Input Fields "From Date" and "To Date". When i choose a From Date - a Daterange of only 5 Days should appear on the "To Date" Picker. I used the Code from "Russ Cam" http://stackoverflow.com/questions/330737/jquery-datepicker-2-inputs-textboxes-and-restricting-range It worked perfect. Now my Problem: I have a second Calendar which is INLINE, means no Input Fields - it's shown directly on the Page - with "From Date" and "To Date". In this Calendar the Script does not work! All Fields in "From Date" and in the "To Date" are available - no Date Range Restrictions or something else. What's wrong here? Can someone give me a hint?

    Read the article

  • Behavior with primitive data types' value out of range & C99's PRI* macros

    - by Yktula
    Say we have an 8-bit unsigned integer n (UINT8_MAX=255); what is the behavior of the compiler for n=256? Where can I find a table of default behavior when the value of a data type is out of range for different data types? Is there a pattern to how they behave when set out of range? #include <stdio.h> #include <inttypes.h> uint8_t n = UINT8_MAX; int main() { printf("%hhu ",n++); printf("%hhu",n); return 0; } Compiling with gcc -std=c99 -Wall *.c, this prints: 255 0 Also, is it acceptable to use C99's PRI* macros? How are they named?

    Read the article

  • step attribute not working with HTML5 <input type="range"> on Safari

    - by Claudiu
    Are there known issues with range inputs not working fully on Safari? I have the following input element: <input type=?"range" min=?"0" max=?"360" step=?"0.0001" value=?"0">? On Chrome, the input goes according to the step variable. On Safari, it only goes by integer values. Even setting the step to 10 still makes it go by increments of 1. I'm confused because I thought Chrome and Safari both used WebKit.

    Read the article

  • parsing command option with default values and range constrains in C

    - by agramfort
    Hi, I need to parse command line arguments in C. My arguments are basically int or float with default values and range constrains. I've started to implement something that look like this: option_float(float* out, int argc, char* argv, char* name, description, float default_val, int is_optional, float min_value, float max_value) which I call for example with: float* pct; option_float(pct, argc, argv, "pct", "My super percentage option", 50, 1, FALSE, 0, 100) however I don't want to reinvent the wheel ! My objective is to have error checking of range constrains, throw an error when the option is not optional and is not set. And generate the help message usually given by usage() function. The usage text would look like this: --pct My super percentage option (default : 50). Should be in [0, 100] I've started with getopt but it is too limited for what I want to do and I feel it still requires me to write too much code for a simple usecase like this. thanks

    Read the article

  • VBA: For each cell does not work - Range is change and Out of context

    - by user1744638
    I have problem with for each cell. I have like that : Set cur_sheet = Worksheets("Sheet2") Set Rng = cur_sheet.Range("A1", "C1523") For Each cell In Rng.Cells a=1 next cell if there is row 370 that I have error message " Run time error 94" Invalid use of Null So I do not know what can I change. This row should be ok, filled with text. Why this FOR is not working properly and change range !! ? 370 rows are proceesed correctly, than it is error. Do you have any ideas ?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • I need to add a range for a date input field in jquery

    - by user338413
    I've got an input field in a form that needs a date value. I'm using jQuery UI's datepicker for the calendar and I've set a range for it. However, the user can override that by typing a different date in the input field. How can I specify a date range for the field with jQuery validation? All I see with jQuery is that you can only specify that the field be a date type. Can I create min and max values that work with dates?

    Read the article

  • how to restrict a page to only a specified ip range in php

    - by Mac Taylor
    hey guys im looking for a way to restrict my administration page to only my own ip range concider my ip range is 215.67.. so in php i will begin with this : $myip = "215.67.*.*"; $myip = explode(".", $my_ip); $userip = getenv("REMOTE_ADDR") ; $userip = explode(".", $userip); if ($myip[0] == $userip[0] AND $myip[1] == $userip[1] ) { //Contunue admin } is there any better and more professional way to do it ?

    Read the article

  • jQuery slider - set background color to show desired range

    - by David
    Howdy, I'm setting up a Filament Group jQuery UI slider and using it in a gradebook. We need to allow teachers to set a desired background range (to show the desirable values vs. the actual value for a given grade). I'm hoping to set a shaded area (as shown in this picture) that would indicate to people viewing the slider which values are desirable. If the handle is within the desired ranges, then the value is satisfactory. If the handle is out of the background shaded range, then some changes may need to happen. Any suggestions on how to accomplish this? Based on what I've experimented with using Firebug, it looks like a <div class="ui-slider"> is setup, but the values inside of it don't seem to allow setting background-colors (only the div allows for that). Thanks for your help.

    Read the article

  • Include upper bound in range()

    - by Jull
    How can I include the upper bound in range() function? I can't add by 1 because my for-loop looks like: for x in range(1,math.floor(math.sqrt(x))): y = math.sqrt(n - x * x) But as I understand it will actually be 1 < x < M where I need 1 < x <= M Adding 1 will completely change the result. I am trying to rewrite my old program from C# to Python. That's how it looked in C#: for (int x = 1; x <= Math.Floor(Math.Sqrt(n)); x++) double y = Math.Sqrt(n - x * x);

    Read the article

  • XML and XSD - use element name as replacement of xsi:type for polymorphism

    - by disown
    Taking the W3C vehicle XSD as an example: <schema xmlns="http://www.w3.org/2001/XMLSchema" targetNamespace="http://cars.example.com/schema" xmlns:target="http://cars.example.com/schema"> <complexType name="Vehicle" abstract="true"/> <complexType name="Car"> <complexContent> <extension base="target:Vehicle"/> ... </complexContent> </complexType> <complexType name="Plane"> <complexContent> <extension base="target:Vehicle"/> <sequence> <element name="wingspan" type="integer"/> </sequence> </complexContent> </complexType> </schema> , and the following definition of 'meansOfTravel': <complexType name="MeansOfTravel"> <complexContent> <sequence> <element name="transport" type="target:Vehicle"/> </sequence> </complexContent> </complexType> <element name="meansOfTravel" type="target:MeansOfTravel"/> With this definition you need to specify the type of your instance using xsi:type, like this: <meansOfTravel> <transport xsi:type="Plane"> <wingspan>3</wingspan> </transport> </meansOfTravel> I would just like to acheive a 'name of type' - 'name of element' mapping so that this could be replaced with just <meansOfTravel> <plane> <wingspan>3</wingspan> </plane> </meansOfTravel> The only way I could do this until now is by making it explicit: <complexType name="MeansOfTravel"> <sequence> <choice> <element name="plane" type="target:Plane"/> <element name="car" type="target:Car"/> </choice> </sequence> </complexType> <element name="meansOfTravel" type="target:MeansOfTravel"/> But this means that I have to list all possible sub-types in the 'MeansOfTravel' complex type. Is there no way of making the XML parser assume that you mean a 'Plane' if you call the element 'plane'? Or do I have to make the choice explicit? I would just like to keep my design DRY - if you have any other suggestions (like groups or so) - i would love to hear them.

    Read the article

  • My winform application doesn't work on others' pc without vs 2010 installed

    - by wings
    Just like I said, my winform application works properly on computers with VS installed, but on other computers, it will crash due to a FileNotFound Exception. I used using Application = Microsoft.Office.Interop.Excel.Application; in my source code to generate a Excel file, and the problem occurs as soon as the Excel-related function is called. But I don't know what it refers to exactly. Do I have to get some .dll included along with the .exe file? And what DLL is that? Below are part of my codes: private void FileExport(object objTable) { StartWaiting(); string[,] table = null; try { table = (string[,])objTable; } catch (Exception ex) { ShowStatus(ex.Message, StatusType.Warning); } if (table == null) { return; } Application excelApp = new Application { DisplayAlerts = false }; Workbooks workbooks = excelApp.Workbooks; Workbook workbook = workbooks.Add(XlWBATemplate.xlWBATWorksheet); Worksheet worksheet = (Worksheet)workbook.Worksheets[1]; worksheet.Name = "TABLE"; for (int i = 0; i < table.GetLength(0); i++) { for (int j = 0; j < table.GetLength(1); j++) { worksheet.Cells[i + 1, j + 1] = table[i, j]; } } Range range = excelApp.Range["A1", "H1"]; range.Merge(); range.Font.Bold = true; range.Font.Size = 15; range.RowHeight = 50; range.EntireRow.AutoFit(); range = excelApp.Range["A2", "H8"]; range.Font.Size = 11; range = excelApp.Range["A1", "H8"]; range.NumberFormatLocal = "@"; range.RowHeight = 300; range.ColumnWidth = 50; range.HorizontalAlignment = XlHAlign.xlHAlignCenter; range.VerticalAlignment = XlVAlign.xlVAlignCenter; range.EntireRow.AutoFit(); range.EntireColumn.AutoFit(); worksheet.UsedRange.Borders.LineStyle = 1; Invoke(new MainThreadInvokerDelegate(SaveAs), new object[] { worksheet, workbook, excelApp } ); EndWaiting(); }

    Read the article

  • Are upper bounds of indexed ranges always assumed to be exclusive?

    - by polygenelubricants
    So in Java, whenever an indexed range is given, the upper bound is almost always exclusive. From java.lang.String: substring(int beginIndex, int endIndex) Returns a new string that is a substring of this string. The substring begins at the specified beginIndex and extends to the character at index endIndex - 1 From java.util.Arrays: copyOfRange(T[] original, int from, int to) from - the initial index of the range to be copied, inclusive to - the final index of the range to be copied, exclusive. From java.util.BitSet: set(int fromIndex, int toIndex) fromIndex - index of the first bit to be set. toIndex - index after the last bit to be set. As you can see, it does look like Java tries to make it a consistent convention that upper bounds are exclusive. My questions are: Is this the official authoritative recommendation? Are there notable violations that we should be wary of? Is there a name for this system? (ala "0-based" vs "1-based")

    Read the article

  • Retrieve enum value based on XmlEnumAttribute name value

    - by CletusLoomis
    I need a Generic function to retrieve the name or value of an enum based on the XmlEnumAttribute "Name" property of the enum. For example I have the following enum defined: Public Enum Currency <XmlEnum("00")> CDN = 1 <XmlEnum("01")> USA= 2 <XmlEnum("02")> EUR= 3 <XmlEnum("03")> JPN= 4 End Enum The first Currency enum value is 1; the enum name is "CDN"; and the XMLEnumAttribute Name property value is "00". If I have the enum value, I can retrieve the XmlEnumAttribute "Name" value using the following generic function: Public Function GetXmlAttrNameFromEnumValue(Of T)(ByVal pEnumVal As T) As String Dim type As Type = pEnumVal.GetType Dim info As FieldInfo = type.GetField([Enum].GetName(GetType(T), pEnumVal)) Dim att As XmlEnumAttribute = CType(info.GetCustomAttributes(GetType(XmlEnumAttribute), False)(0), XmlEnumAttribute) 'If there is an xmlattribute defined, return the name Return att.Name End Function So using the above function, I can specify the Currency enum type, pass a value of 1, and the return value will be "00". What I need is a function to perform if the opposite. If I have the XmlEnumAttribute Name value "00", I need a function to return a Currency enum with a value of 1. Just as useful would be a function that would return the enum name "CDN". I could then simply parse this to get the enum value. Any assistance would be appreciated.

    Read the article

  • How to take name in one preg_match

    - by Julianto
    Hello guys, I am trying to extract just the names result from the hypothetical HTML file below. <ul class="cat"> <li>sport</li> <li>movie</li> </ul> <ul class="person-list"> <li>name 1</li> <li>name 2</li> <li>name 3</li> <li>name 4</li> <li>name 5</li> <li>name 6</li> </ul> Ideally, the result should come in an array format like the one below: Array( name 1 , name 2 , name 3 , .......... ) OK I can easily do this with 2 regex matches but I was wondering if I can do it with just one. Thanks in advance!

    Read the article

  • What should the name of this class be?

    - by Tim Murphy
    Naming classes is sometimes hard. What do you think name of the class should be? I originally created the class to use as a cache but can see its may have other uses. Example code to use the class. Dim cache = New NamePendingDictionary(Of String, Sample) Dim value = cache("a", Function() New Sample()) And here is the class that needs a name. ''' <summary> ''' Enhancement of <see cref="System.Collections.Generic.Dictionary"/>. See the Item property ''' for more details. ''' </summary> ''' <typeparam name="TKey">The type of the keys in the dictionary.</typeparam> ''' <typeparam name="TValue">The type of the values in the dictionary.</typeparam> Public Class NamePendingDictionary(Of TKey, TValue) Inherits Dictionary(Of TKey, TValue) Delegate Function DefaultValue() As TValue ''' <summary> ''' Gets or sets the value associated with the specified key. If the specified key does not exist ''' then <paramref name="createDefaultValue"/> is invoked and added to the dictionary. The created ''' value is then returned. ''' </summary> ''' <param name="key">The key of the value to get.</param> ''' <param name="createDefaultValue"> ''' The delegate to invoke if <paramref name="key"/> does not exist in the dictionary. ''' </param> ''' <exception cref="T:System.ArgumentNullException"><paramref name="key" /> is null.</exception> Default Public Overloads ReadOnly Property Item(ByVal key As TKey, ByVal createDefaultValue As DefaultValue) As TValue Get Dim value As TValue If createDefaultValue Is Nothing Then Throw New ArgumentNullException("createValue") End If If Not Me.TryGetValue(key, value) Then value = createDefaultValue.Invoke() Me.Add(key, value) End If Return value End Get End Property End Class

    Read the article

< Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >