Search Results

Search found 2776 results on 112 pages for 'overlapping matches'.

Page 29/112 | < Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >

  • Redirect all access requests to a domain and subdomain(s) except from specific IP address? [closed]

    - by Christopher
    This is a self-answered question... After much wrangling I found the magic combination of mod_rewrite rules so I'm posting here. My scenario is that I have two domains - domain1.com and domain2.com - both of which are currently serving identical content (by way of a global 301 redirect from domain1 to domain2). Domain1 was then chosen to be repurposed to be a 'portal' domain - with a corporate CMS-based site leading off from the front page, and the existing 'retail' domain (domain2) left to serve the main web site. In addition, a staging subdomain was created on domain1 in order to prepare the new corporate site without impinging on the root domain's existing operation. I contemplated just rewriting all requests to domain2 and setting up the new corporate site 'behind the scenes' without using a staging domain, but I usually use subdomains when setting up new sites. Finally, I required access to the 'actual' contents of the domains and subdomains - i.e., to not be redirected like all other visitors - in order that I can develop the new site and test it in the staging environment on the live server, as I'm not using a separate development webserver in this case. I also have another test subdomain on domain1 which needed to be preserved. The way I eventually set it up was as follows: (10.2.2.1 would be my home WAN IP) .htaccess in root of domain1 RewriteEngine On RewriteCond %{REMOTE_ADDR} !^10\.2\.2\.1 RewriteCond %{HTTP_HOST} !^staging.domain1.com$ [NC] RewriteCond %{HTTP_HOST} !^staging2.domain1.com$ [NC] RewriteRule ^(.*)$ http://domain2.com/$1 [R=301] .htaccess in staging subdomain on domain1: RewriteEngine On RewriteCond %{REMOTE_ADDR} !^10\.2\.2\.1 RewriteCond %{HTTP_HOST} ^staging.revolver.coop$ [NC] RewriteRule ^(.*)$ http://domain2.com/$1 [R=301,L] The multiple .htaccess files and multiple rulesets require more processing overhead and longer iteration as the visitor is potentially redirected twice, however I find it to be a more granular method of control as I can selectively allow more than one IP address access to individual staging subdomain(s) without automatically granting them access to everything else. It also keeps the rulesets fairly simple and easy to read. (or re-interpret, because I'm always forgetting how I put rules together!) If anybody can suggest a more efficient way of merging all these rules and conditions into just one main ruleset in the root of domain1, please post! I'm always keen to learn, this post is more my attempt to preserve this information for those who are looking to redirect entire domains for all visitors except themselves (for design/testing purposes) and not just denying specific file access for maintenance mode (there are many good examples of simple mod_rewrite rules for 'maintenance mode' style operation easily findable via Google). You can also extend the IP address detection - firstly by using wildcards ^10\.2\.2\..*: the last octet's \..* denotes the usual "." and then "zero or more arbitrary characters", signified by the .* - so you can specify specific ranges of IPs in a subnet or entire subnets if you wish. You can also use square brackets: ^10\.2\.[1-255]\.[120-140]; ^10\.2\.[1-9]?[0-9]\.; ^10\.2\.1[0-1][0-9]\. etc. The third way, if you wish to specify multiple discrete IP addresses, is to bracket them in the style of ^(1.1.1.1|2.2.2.2|3.3.3.3)$, and you can of course use square brackets to substitute octets or single digits again. NB: if you're using individual RewriteCond lines to specify multiple IPs / ranges, make sure to put [OR] at the end of each one otherwise mod_rewrite will interpret as "if IP address matches 1.1.1.1 AND if IP address matches 2.2.2.2... which is of course impossible! However as far as I'm aware this isn't necessary if you're using the ! negator to specify "and is not...". Kudos also to SE: this older question also came in useful when I was verifying my own knowledge prior to my futzing around with code. This page was helpful, as were the various other links posted below (can't hyperlink them all due to spam protection... other regex checkers are available). The AddedBytes cheat sheet's useful to pin up on your wall. Other referenced URLs: internetofficer.com/seo-tool/regex-tester/ fantomaster.com/faarticles/rewritingurls.txt internetofficer.com/seo-tool/regex-tester/ addedbytes.com/cheat-sheets/mod_rewrite-cheat-sheet/

    Read the article

  • Top 5 Mobile Apps To Keep Track Of Cricket Scores [ICC World Cup]

    - by Gopinath
    The ICC World Cup 2011 has started with a bang today and the first match between India vs Bangladesh was a cracker. India trashed Bangladesh with a huge margin, thanks to Sehwag for scoring an entertaining 175 runs in 140 runs. At the moment it’s very clear that whole India is gripped with cricket fever and so the rest of fans across the globe. Couple of days ago we blogged about how to watch live streaming of ICC cricket world cup online for free as well as top 10 websites to keep track live scores on your computers. What about tracking live cricket scores on mobiles phones? Here is our guide to top mobile apps available for Symbian(Nokia), Android, iOS and Windows mobiles. By the way, we are covering free apps alone in this post. Why to waste money when free apps are available? SnapTu – Symbian Mobile App SnapTu is a multi feature application that lets you to track live cricket scores, read latest news and check stats published on cric info. SnapTu has tie up with Cric Info and accessing all of CricInfo website on your mobile is very easy. Along with live scores, SnapTu also lets you access your Facebook, Twitter and Picassa on your mobile. This is my favourite application to track cricket on Symbian mobiles. Download SnapTu for your mobiles here Yahoo! Cricket – Symbian & iOS App Yahoo! Cricket Scores is another dedicated application to catch up with live scores and news on your Nokia mobiles and iPhones. This application is developed by Yahoo!, the web giant as well as the official partner of ICC. Features of the app at a glance Cricket: Get a summary page with latest scores, upcoming matches and details of the recent matches News: View sections devoted to the latest news, interviews and photos Statistics: Find the latest team and player stats Download Yahoo! Cricket For Symbian Phones   Download Yahoo! Cricket For iOS ESPN CricInfo – Android and iOS App Is there any site that is better than CricInfo to catch up with latest cricket news and live scores? I say No. ESPN CricInfo is the best website available on the web to get up to the minute  cricket information with in-depth analysis from cricket experts. The live commentary provided by CricInfo site is equally enjoyable as watching live cricket on TV. CricInfo guys have their official applications for Android mobiles and iOS devices and you accessing ball by ball updates on these application is joy. Download ESPN Crick Info App: Android Version, iPhone Version NDTV Cricket – Android, iOS and Blackberry App NDTV Cricket App is developed by NDTV, the most popular English TV news channel in India. This application provides live coverage of international and domestic cricket (Test, ODI & T20) along with latest News, Photos, Videos and Stats. This application is available for iOS devices(iPhones, iPads, iPod Touch), Android mobiles and Blackberry devices. Download NDTV Cricket for iOS here & here    Download NDTV Apps For Rest of OSs ECB Cricket – Symbian, iOS & Android App If you are an UK citizen then  this may be the right application to download for getting live cricket score updates as well as latest news about England Cricket Board. ECB Cricket is an official application of England Cricket Board Download ECB Cricket : Android Version, iPhone Version, Symbian Version Are there any better apps that we missed to feature in this list? This article titled,Top 5 Mobile Apps To Keep Track Of Cricket Scores [ICC World Cup], was originally published at Tech Dreams. Grab our rss feed or fan us on Facebook to get updates from us.

    Read the article

  • Converting .docx to pdf (or .doc to pdf, or .doc to odt, etc.) with libreoffice on a webserver on the fly using php

    - by robertphyatt
    Ok, so I needed to convert .docx files to .pdf files on the fly, but none of the free php libraries that were available let me do it on my server (a webservice was not good enough). Basically either I needed to pay for a library (and have it maybe suck) or just deal with the free ones that didn't convert the formatting well enough. Not good enough! I found that LibreOffice (OpenOffice's successor) allows command line conversion using the LibreOffice conversion engine (which DID preserve the formatting like I wanted and generally worked great). I loaded the latest version of Ubuntu (http://www.ubuntu.com/download/ubuntu/download) onto my Virtual Box (https://www.virtualbox.org/wiki/Downloads) on my computer and found that I was able to easily convert files using the commandline like this: libreoffice --headless -convert-to pdf fileToConvert.docx -outdir output/path/for/pdf I thought: sweet...but I don't have admin rights on my host's web server. I tried to use a "portable" version of LibreOffice that I obtained from http://portablelinuxapps.org/ but I was unable to get it to work on my host's webserver, because my host's webserver didn't have all the dependencies (Dependency Hell! http://en.wikipedia.org/wiki/Dependency_hell) I was at a loss of how to make it work, until I ran across a cool project made by a Ph.D. student (Philip J. Guo) at Stanford called CDE: http://www.stanford.edu/~pgbovine/cde.html I will let you look at his explanations of how it works (I followed what he did in http://www.youtube.com/watch?feature=player_embedded&v=6XdwHo1BWwY, starting at about 32:00 as well as the directions on his site), but in short, it allows one to avoid dependency hell by copying all the files used when you run certain commands, recreating the linux environment where the command worked. I was able to use this to run LibreOffice without having to resort to someone's portable version of it, and it worked just like it did when I did it on Ubuntu with the command above, with a tweak: I needed to run the wrapper of LibreOffice the CDE generated. So, below is my PHP code that calls it. In this code snippet, the filename to be copied is passed in as $_POST["filename"]. I copy the file to the same spot where I originally converted the file, convert it, copy it back and then delete all the files (so that it doesn't start growing exponentially). I did it this way because I wasn't able to make it work otherwise on the webserver. If there is a linux + webserver ninja out there that can figure out how to make it work without doing this, I would be interested to know what you did. Please post a comment or something if you did that. <?php //first copy the file to the magic place where we can convert it to a pdf on the fly copy($time.$_POST["filename"], "../LibreOffice/cde-package/cde-root/home/robert/Desktop/".$_POST["filename"]); //change to that directory chdir('../LibreOffice/cde-package/cde-root/home/robert'); //the magic command that does the conversion $myCommand = "./libreoffice.cde --headless -convert-to pdf Desktop/".$_POST["filename"]." -outdir Desktop/"; exec ($myCommand); //copy the file back copy("Desktop/".str_replace(".docx", ".pdf", $_POST["filename"]), "../../../../../documents/".str_replace(".docx", ".pdf", $_POST["filename"])); //delete all the files out of the magic place where we can convert it to a pdf on the fly $files1 = scandir('Desktop'); //my files that I generated all happened to start with a number. $pattern = '/^[0-9]/'; foreach ($files1 as $value) { preg_match($pattern, $value, $matches); if(count($matches) ?> 0) { unlink("Desktop/".$value); } } //changing the header to the location of the file makes it work well on androids header( 'Location: '.str_replace(".docx", ".pdf", $_POST["filename"]) ); ?> And here is the tar.gz file I generated I generated with CDE. To duplicate what I did exactly, put the tar.gz file in a folder somewhere. I will call that folder the "root". Make a new folder called "documents" in the "root" folder. Unpack the tar.gz and run the php script above from the "documents" folder. Success! I made a truly portable version of LibreOffice that can convert files on the fly on a webserver using 100% free, open source software!

    Read the article

  • Delphi Exception handling problem with multiple Exception handling blocks

    - by Robert Oschler
    I'm using Delphi Pro 6 on Windows XP with FastMM 4.92 and the JEDI JVCL 3.0. Given the code below, I'm having the following problem: only the first exception handling block gets a valid instance of E. The other blocks match properly with the class of the Exception being raised, but E is unassigned (nil). For example, given the current order of the exception handling blocks when I raise an E1 the block for E1 matches and E is a valid object instance. However, if I try to raise an E2, that block does match, but E is unassigned (nil). If I move the E2 catching block to the top of the ordering and raise an E1, then when the E1 block matches E is is now unassigned. With this new ordering if I raise an E2, E is properly assigned when it wasn't when the E2 block was not the first block in the ordering. Note I tried this case with a bare-bones project consisting of just a single Delphi form. Am I doing something really silly here or is something really wrong? Thanks, Robert type E1 = class(EAbort) end; E2 = class(EAbort) end; procedure TForm1.Button1Click(Sender: TObject); begin try raise E1.Create('hello'); except On E: E1 do begin OutputDebugString('E1'); end; On E: E2 do begin OutputDebugString('E2'); end; On E: Exception do begin OutputDebugString('E(all)'); end; end; // try() end;

    Read the article

  • Delph Exception handling problem with multiple Exception handling blocks

    - by Robert Oschler
    I'm using Delphi Pro 6 on Windows XP with FastMM 4.92 and the JEDI JVCL 3.0. Given the code below, I'm having the following problem: only the first exception handling block gets a valid instance of E. The other blocks match properly with the class of the Exception being raised, but E is unassigned (nil). For example, given the current order of the exception handling blocks when I raise an E1 the block for E1 matches and E is a valid object instance. However, if I try to raise an E2, that block does match, but E is unassigned (nil). If I move the E2 catching block to the top of the ordering and raise an E1, then when the E1 block matches E is is now unassigned. With this new ordering if I raise an E2, E is properly assigned when it wasn't when the E2 block was not the first block in the ordering. Note I tried this case with a bare-bones project consisting of just a single Delphi form. Am I doing something really silly here or is something really wrong? Thanks, Robert type E1 = class(EAbort) end; E2 = class(EAbort) end; procedure TForm1.Button1Click(Sender: TObject); begin try raise E1.Create('hello'); except On E: E1 do begin OutputDebugString('E1'); end; On E: E2 do begin OutputDebugString('E2'); end; On E: Exception do begin OutputDebugString('E(all)'); end; end; // try() end;

    Read the article

  • Sphinx PHP Geodist problems

    - by James
    Below is my PHP function to call nearby points using Sphinx for MySQL. There are hundreds of thousands of nearby points which to what I can tell, are being indexed by Sphinx, but simply fails silently when searching with Sphinx. Other Sphinx queries I run against other indexes work completely fine. function nearby($latitude, $longitude, $radius) { global $sphinx; $sphinx->SetMatchMode(SPH_MATCH_ALL); $sphinx->SetArrayResult(true); $sphinx->SetLimits(0, 1000); $sphinx->SetGeoAnchor('latitude', 'longitude', (float) deg2rad($latitude), (float) deg2rad($longitude)); $circle = (float) $radius * 1.609344; $sphinx->SetFilterFloatRange('@geodist', 0.0, $circle); $matches = $sphinx->Query('', 'geo'); return $matches; } $nearby = nearby($latitude, $longitude, 10000); var_dump($nearby); This, when called with valid latitude and longitude co-ords and a very large radius for debugging produces: bool(false) Below is my sphinx.conf covering the geo part: source geo { type = mysql sql_host = 127.0.0.1 sql_user = user sql_pass = pass sql_db = db sql_port = 3306 sql_query_pre = set names utf8 sql_query_pre = set session query_cache_type=OFF sql_query = SELECT id,city,region,country,radians(longitude) AS longitude, radians(latitude) AS latitude FROM points; sql_attr_float = longitude sql_attr_float = latitude sql_ranged_throttle = 0 sql_query_info = SELECT * FROM points WHERE id = $id } index geo { source = geo path = /var/data/geo docinfo = extern #mlock = 0 #morphology = none min_word_len = 1 charset_type = utf-8 #charset_table = 0..9, A..Z->a..z, _, a..z, U+410..U+42F->U+430..U+44F, U+430..U+44F ignore_chars = U+00AD html_strip = 0 enable_star = 0 } indexer { mem_limit = 1024M } searchd { port = 3312 log = /var/log/searchd.log query_log = /var/log/query.log read_timeout = 5 max_children = 5 pid_file = /var/log/searchd.pid max_matches = 10000 seamless_rotate = 1 preopen_indexes = 0 unlink_old = 1 }

    Read the article

  • JAVA Regular Expression Errors

    - by Berkay
    I'm working on a simply password strength checker and i can not success applying regular expressions. In different resources different kinds of regular expressions are defined. i also find javascript regular expressions but had some problems to adapt. First, these are the regular expressions i need for JAVA: at least one lower case letter at least one upper case letter at least one number at least three numbers at least one special character at least two special characters both letters and numbers both upper and lower case letters, numbers, and special characters My goal is not being a regular expression expert i just want to use the parts i need.If you direct me good tutorials which discusses above for java, will be appreciated. Second, in this link some of them are mentioned but i'm getting problems to apply them. here does not catch the lower case letter (my pass: A5677a) if (passwd.matches("(?=.*[a-z])")) // [verified] at least one lower case letter {Score = Score+5;} Also here i'm getting error : illegal escape character. if (passwd.matches("(?=.*\d)")) // [verified] at least one number Finally, are these expressions all different in different kind of programming or script languages?

    Read the article

  • What is the PIXELFORMATDESCRIPTOR parameter in SetPixelFormat() used for?

    - by Mads Elvheim
    Usually when setting up OpenGL contexts, I've simply filled out a PIXELFORMATDESCRIPTOR structure with the necessary information and called ChoosePixelFormat(), followed by a call to SetPixelFormat() with the returned matching pixelformat from ChoosePixelFormat(). Then I've simply passed the initial descriptor without giving much thought of why. But now I use wglChoosePixelFormatARB() instead if ChoosePixelFormat() because I need some extended traits like sRGB and multisampling. It takes an attribute list of integers, just like XLib/GLX on Linux, not a PIXELFORMATDESCRIPTOR structure. So, do I really have to fill in a descriptor for SetPixelFormat() to use? What does SetPixelFormat() use the descriptor for when it already has the pixelformat descriptor index? Why do I have to specify the same pixelformat attributes in two different places? And which one takes precedence; the attribute list to wglChoosePixelFormatARB(), or the PIXELFORMATDESCRIPTOR attributes passed to SetPixelFormat()? Here are the function prototypes, to make the question more clear: /* Finds a best match based on a PIXELFORMATDESCRIPTOR, and returns the pixelformat index */ int ChoosePixelFormat(HDC hdc, const PIXELFORMATDESCRIPTOR *ppfd); /* Finds a best match based on an attribute list of integers and floats, and returns a list of indices of matches, with the best matches at the head. Also supports extended pixelformat traits like sRGB color space, floating-point framebuffers and multisampling. */ BOOL wglChoosePixelFormatARB(HDC hdc, const int *piAttribIList, const FLOAT *pfAttribFList, UINT nMaxFormats, int *piFormats, UINT *nNumFormats ); /* Sets the pixelformat based on the pixelformat index */ BOOL SetPixelFormat(HDC hdc, int iPixelFormat, const PIXELFORMATDESCRIPTOR *ppfd);

    Read the article

  • Warning: preg_match() [function.preg-match]: Unknown modifier '/' problem

    - by SonOfOmer
    I am building custom implementation of php MVC routing engine, and I have custom routes like one in $routes array below. Each time when I send asynchronous GET request like xmlhttp.open("GET","someurl"); I get following message Warning: preg_match() [function.preg-match]: Unknown modifier '/' problem but with synchronous (normal) request it all works fine <?php $routes = array( array('url' => '/^someurl$/', 'controller' => 'somecontroller', 'view' => 'someview') ); $url = $_SERVER['REQUEST_URI']; $url = substr( $url, 1 ); $params = array(); $route_match = false; foreach($routes as $urls => $route) { if(preg_match($route['url'], $url, $matches)) { $params = array_merge($params, $matches); $route_match = true; break; } } require_once(CONTROLLER_PATH.$route['controller'].'.php'); ?> string(11) "/^someurl$/" is the result of var_dump($route['url']); Thanks.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • rename files with the same name

    - by snorpey
    Hi. I use the following function to rename thumbnails. For example, if I upload a file called "image.png" to an upload folder, and this folder already has a file named "image.png" in it, the new file automatically gets renamed to "image-copy-1.png". If there also is a file called "image-copy-1.png" it gets renamed to "image-copy-2.png" and so on. The following function returns the new filename. At least that's what it is supposed to do... The renaming doesn't seeem to work correctly, though. Sometimes it produces strange results, like: 1.png 1-copy-1.png 1-copy-2.png 1-copy-2-copy-1.png 1-copy-2-copy-3.png I hope you understand my problem, despite my description being somewhat complex... Can you tell me what went wrong here? (bonus question: Is regular expressions the right tool for doing this kind of stuff?) <?php function renameDuplicates($path, $file) { $fileName = pathinfo($path . $file, PATHINFO_FILENAME); $fileExtension = "." . pathinfo($path . $file, PATHINFO_EXTENSION); if(file_exists($path . $file)) { $fileCopy = $fileName . "-copy-1"; if(file_exists($path . $fileCopy . $fileExtension)) { if ($contains = preg_match_all ("/.*?(copy)(-)(\\d+)/is", $fileCopy, $matches)) { $copyIndex = $matches[3][0]; $fileName = substr($fileCopy, 0, -(strlen("-copy-" . $copyIndex))) . "-copy-" . ($copyIndex + 1); } } else { $fileName .= "-copy-1"; } } $returnValue = $fileName . $fileExtension; return $returnValue; }?>

    Read the article

  • Using Regex, how can I remove certain characters from inside angle-brackets, leaving the characters

    - by Iain Fraser
    Edit: To be clear, please understand that I am not using Regex to parse the html, that's crazy talk! I'm simply wanting to clean up a messy string of html so it will parse Edit #2: I should also point out that the control character I'm using is a special unicode character - it's not something that would ever be used in a proper tag under any normal circumstances Suppose I have a string of html that contains a bunch of control characters and I want to remove the control characters from inside tags only, leaving the characters outside the tags alone. For example Here the control character is the numeral "1". Input The quick 1<strong>orange</strong> lemming <sp11a1n 1class1='jumpe111r'11>jumps over</span> 1the idle 1frog Desired Output The quick 1<strong>orange</strong> lemming <span class='jumper'>jumps over</span> 1the idle 1frog So far I can match tags which contain the control character but I can't remove them in one regex. I guess I could perform another regex on my matches, but I'd really like to know if there's a better way. My regex Bear in mind this one only matches tags which contain the control character. <(([^>])*?`([^>])*?)*?> Thanks very much for your time and consideration. Iain Fraser

    Read the article

  • Calling ASP.NET Web API using JQuery ajax - cross site scripting issue

    - by SimonF
    I have a Web API which I am calling using the JQuery ajax function. When I test the service directly (using the Chrome RESTEasy extension) it works fine, however when I call it using the JQuery ajax function I get an error. I'm calling it on port 81: $.ajax({ url: "http://127.0.0.1:81/api/people", data: JSON.stringify(personToCreate), type: "POST", contentType: "application/json;charset=utf-8", statusCode: { 201: function (newPerson) { callback(newPerson); } }, success: function (newPerson) { alert("New person created with an Id of " + newPerson.Id); }, error: function (jqXHR, textStatus, errorThrown) { alert('Error. '+textStatus+'. '+errorThrown); } }); ...but when I trace it using FireBug Lite the response comes from port 82: {"Message":"No HTTP resource was found that matches the request URI 'http://127.0.0.1:82/api/people'.","MessageDetail":"No action was found on the controller 'People' that matches the request."} I think the error is, effectively, due to cross-site scripting being blocked, but I'm not actually cross-site scripting, if you see what I mean. Has anyone else come across this and been able to fix it? Edit: Routing config (global.asax.vb) is: RouteTable.Routes.MapHttpRoute(name:="DefaultApi", routeTemplate:="api/{controller}/{id}", defaults:=New With {Key .id = System.Web.Http.RouteParameter.Optional}) Controller: Public Function PostValue(ByVal departmentid As Integer, ByVal emailaddress As String, ByVal firstname As String, ByVal lastname As String) As Guid Dim context As New WSMModelDataContext Dim bllPeople As New PeopleBLL(context) Return bllPeople.Create(firstname, lastname, emailaddress, departmentid) End Function When I debug it, it doesn't get as far as running the controller, although when calling it through RESTEasy it routes correctly and the controller executes successfully. The only difference seemes to be that wen called through RESTEasy it is (correctly) using http://127.0.0.1:81 but for some reason when called via JQuery/ajax it seems to be using http://127.0.0.1:82.

    Read the article

  • Why can't I use accented characters next to a word boundary?

    - by Rexxars
    I'm trying to make a dynamic regex that matches a persons name. It works without problems on most names, until I ran into accented characters at the end of the name. Example: Some Fancy Namé The regex I've used so far is: /\b(Fancy Namé|Namé)\b/i Used like this: "Goal: Some Fancy Namé. Awesome.".replace(/\b(Fancy Namé|Namé)\b/i, '<a href="#">$1</a>'); This simply won't match. If I replace the é with a e, it matches just fine. If I try to match a name such as "Some Fancy Naméa", it works just fine. If I remove the word last word boundary anchor, it works just fine. Why doesn't the word boundary flag work here? Any suggestions on how I would get around this problem? I have concidered using something like this, but I'm not sure what the performance penalties would be like: "Some fancy namé. Allow me to ellaborate.".replace(/([\s.,!?])(fancy namé|namé)([\s.,!?]|$)/g, '$1<a href="#">$2</a>$3') Suggestions? Ideas?

    Read the article

  • emacs: x-popup-menu max size constraints?

    - by Cheeso
    I'm working on an intellisense or code-completion capability for C#. So far, so good. Right now I have basic completion working. There are 2 ways to request completion. The first cycles through all the potential matches. The second presents a popup menu of the matches. It works for types: And also for local variables: I'm confronting two problems with x-popup-menu: the popup menu can expand to consume all available screen space, when the number of choices is large. Literally it can obscure the entire screen. The silly thing is, it's scrollable. First it expands to consume all available space, then it also becomes scrollable. Is there a way I can limit the maximum size of x-popup-menu? To specify the position of the popup menu, I pass in a position, and x-popup-menu uses that as the *middle*, not the left, of the top line of the menu. Why middle? who knows. What this means is, if I specify (40 . 60) for the location of the menu, and the menu happens to be 100 pixels wide, the menu will extend beyond the left border of the emacs window. You can see this in the 2nd image above. If I knew how wide the popup would be before specifying the position, I could compensate. But I don't. Is there a workaround? Is there a way to get x-popup-menu to take its position as the LEFT rather than the middle.

    Read the article

  • Query MySQL data from Excel (or vice-versa)

    - by Charles
    I'm trying to automate a tedious problem. I get large Excel (.xls or .csv, whatever's more convenient) files with lists of people. I want to compare these against my MySQL database.* At the moment I'm exporting MySQL tables and reading them from an Excel spreadsheet. At that point it's not difficult to use =LOOKUP() and such commands to do the work I need, and of course the various text processing I need to do is easy enough to do in Excel. But I can't help but think that this is more work than it needs to be. Is there some way to get at the MySQL data directly from Excel? Alternately, is there a way I could access a reasonably large (~10k records) csv file in a sql script? This seems to be rather basic, but I haven't managed to make it work so far. I found an ODBC connection for MySQL but that doesn't seem to do what I need. In particular, I'm testing whether the name matches or whether any of four email addresses match. I also return information on what matched for the benefit of the next person to use the data, something like "Name 'Bob Smith' not found, but 'Robert Smith' matches on email address robert.smith@foo".

    Read the article

  • Algorithm to see if keywords exist inside a string

    - by rksprst
    Let's say I have a set of keywords in an array {"olympics", "sports tennis best", "tennis", "tennis rules"} I then have a large list (up to 50 at a time) of strings (or actually tweets), so they are a max of 140 characters. I want to look at each string and see what keywords are present there. In the case where a keyword is composed of multiple words like "sports tennis best", the words don't have to be together in the string, but all of them have to show up. I've having trouble figuring out an algorithm that does this efficiently. Do you guys have suggestions on a way to do this? Thanks! Edit: To explain a bit better each keyword has an id associated with it, so {1:"olympics", 2:"sports tennis best", 3:"tennis", 4:"tennis rules"} I want to go through the list of strings/tweets and see which group of keywords match. The output should be, this tweet belongs with keyword #4. (multiple matches may be made, so anything that matches keyword 2, would also match 3 -since they both contain tennis). When there are multiple words in the keyword, e.g. "sports tennis best" they don't have to appear together but have to all appear. e.g. this will correctly match: "i just played tennis, i love sports, its the best"... since this string contains "sports tennis best" it will match and be associated with the keywordID (which is 2 for this example).

    Read the article

  • .NET RegEx - First N chars of First M lines

    - by George
    Hello! I want 4 general RegEx expressions for the following 4 basic cases: Up to A chars starting after B chars from start of line on up to C lines starting after D lines from start of file Up to A chars starting after B chars from start of line on up to C lines occurring before D lines from end of file Up to A chars starting before B chars from end of line on up to C lines starting after D lines from start of file Up to A chars starting before B chars from end of line on up to C lines starting before D lines from end of file These would allow to select arbitrary text blocks anywhere in the file. So far I have managed to come up with cases that only work for lines and chars separately: (?<=(?m:^[^\r]{N}))[^\r]{1,M} = UP TO M chars OF EVERY LINE, AFTER FIRST N chars [^\r]{1,M}(?=(?m:.{N}\r$)) = UP TO M chars OF EVERY LINE, BEFORE LAST N chars The above 2 expressions are for chars, and they return MANY matches (one for each line). (?<=(\A([^\r]*\r\n){N}))(?m:\n*[^\r]*\r$){1,M} = UP TO M lines AFTER FIRST N lines (((?=\r?)\n[^\r]*\r)|((?=\r?)\n[^\r]+\r?)){1,M}(?=((\n[^\r]*\r)|(\n[^\r]+\r?)){N}\Z) = UP TO M lines BEFORE LAST N lines from end These 2 expressions are equivalents for the lines, but they always return just ONE match. The task is to combine these expressions to allow for scenarios 1-4. Anyone can help? Note that the case in the title of the question, is just a subclass of scenario #1, where both B = 0 and D = 0. EXAMPLE: SOURCE: line1 blah 1 line2 blah 2 line3 blah 3 line4 blah 4 line5 blah 5 line6 blah 6 DESIRED RESULT: Characters 3-6 of lines 3-5: A total of 3 matches: <match>ne3 </match> <match>ne4 </match> <match>ne5 </match>

    Read the article

  • How to display data stored in core data in a table view?

    - by Dipanjan Dutta
    Hello All, I have developed a core data model for my application. I need to display the saved data into a table view. For my app I have selected split view controller. I am writing down my codes below. Please help me in this regard and write me the code that needs to be added. This is very important as my continuation in my company depends on this. #import "RootViewController.h" #import "DetailViewController.h" #import "AddViewController.h" #import "EmployeeDetailsAppDelegate.h" /* This template does not ensure user interface consistency during editing operations in the table view. You must implement appropriate methods to provide the user experience you require. */ @interface RootViewController () - (void)configureCell:(UITableViewCell *)cell atIndexPath:(NSIndexPath *)indexPath; @end @implementation RootViewController @synthesize detailViewController, fetchedResultsController, managedObjectContext, results, empName; #pragma mark - #pragma mark View lifecycle - (void)viewDidLoad { results = [[NSMutableDictionary alloc]init]; [results setObject:empName.text forKey:@"EmployeeName"]; [self.tableView reloadData]; [super viewDidLoad]; } /* - (void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; } */ /* - (void)viewDidAppear:(BOOL)animated { [super viewDidAppear:animated]; } */ /* - (void)viewWillDisappear:(BOOL)animated { [super viewWillDisappear:animated]; } */ /* - (void)viewDidDisappear:(BOOL)animated { [super viewDidDisappear:animated]; } */ - (BOOL)shouldAutorotateToInterfaceOrientation:(UIInterfaceOrientation)interfaceOrientation { // Ensure that the view controller supports rotation and that the split view can therefore show in both portrait and landscape. return YES; } - (void)configureCell:(UITableViewCell *)cell atIndexPath:(NSIndexPath *)indexPath { NSManagedObject *managedObject = [self.fetchedResultsController objectAtIndexPath:indexPath]; cell.textLabel.text = [[managedObject valueForKey:@"EmployeeName"] description]; } #pragma mark - #pragma mark Add a new object - (void)insertNewObject:(id)sender { AddViewController *add = [[AddViewController alloc]initWithNibName:@"AddViewController" bundle:nil]; self.modalPresentationStyle = UIModalPresentationFormSheet; add.wantsFullScreenLayout = NO; [self presentModalViewController:add animated:YES]; [add release]; } #pragma mark - #pragma mark Table view data source - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 1; } - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { return 1; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } // Configure the cell. NSManagedObject *managedObject = [self.fetchedResultsController objectAtIndexPath:indexPath]; cell.textLabel.text = [[managedObject valueForKey:@"EmployeeName"] description]; return cell; } - (void)tableView:(UITableView *)tableView commitEditingStyle:(UITableViewCellEditingStyle)editingStyle forRowAtIndexPath:(NSIndexPath *)indexPath { if (editingStyle == UITableViewCellEditingStyleDelete) { // Delete the managed object. NSManagedObject *objectToDelete = [self.fetchedResultsController objectAtIndexPath:indexPath]; if (self.detailViewController.detailItem == objectToDelete) { self.detailViewController.detailItem = nil; } NSManagedObjectContext *context = [self.fetchedResultsController managedObjectContext]; [context deleteObject:objectToDelete]; NSError *error; if (![context save:&error]) { /* Replace this implementation with code to handle the error appropriately. abort() causes the application to generate a crash log and terminate. You should not use this function in a shipping application, although it may be useful during development. If it is not possible to recover from the error, display an alert panel that instructs the user to quit the application by pressing the Home button. */ NSLog(@"Unresolved error %@, %@", error, [error userInfo]); abort(); } } } - (BOOL)tableView:(UITableView *)tableView canMoveRowAtIndexPath:(NSIndexPath *)indexPath { // The table view should not be re-orderable. return NO; } #pragma mark - #pragma mark Table view delegate - (void)tableView:(UITableView *)aTableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Set the detail item in the detail view controller. NSManagedObject *selectedObject = [self.fetchedResultsController objectAtIndexPath:indexPath]; self.detailViewController.detailItem = selectedObject; } #pragma mark - #pragma mark Fetched results controller - (NSFetchedResultsController *)fetchedResultsController { if (fetchedResultsController != nil) { return fetchedResultsController; } /* Set up the fetched results controller. */ // Create the fetch request for the entity. NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; // Edit the entity name as appropriate. NSEntityDescription *entity = [NSEntityDescription entityForName:@"Details" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // Set the batch size to a suitable number. [fetchRequest setFetchBatchSize:20]; // Edit the sort key as appropriate. NSSortDescriptor *sortDescriptor = [[NSSortDescriptor alloc] initWithKey:@"EmployeeName" ascending:NO]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortDescriptor, nil]; [fetchRequest setSortDescriptors:sortDescriptors]; // Edit the section name key path and cache name if appropriate. // nil for section name key path means "no sections". NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:fetchRequest managedObjectContext:managedObjectContext sectionNameKeyPath:nil cacheName:@"Root"]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; [aFetchedResultsController release]; [fetchRequest release]; [sortDescriptor release]; [sortDescriptors release]; return fetchedResultsController; } #pragma mark - #pragma mark Fetched results controller delegate - (void)controllerWillChangeContent:(NSFetchedResultsController *)controller { [self.tableView beginUpdates]; } - (void)controller:(NSFetchedResultsController *)controller didChangeSection:(id <NSFetchedResultsSectionInfo>)sectionInfo atIndex:(NSUInteger)sectionIndex forChangeType:(NSFetchedResultsChangeType)type { switch(type) { case NSFetchedResultsChangeInsert: [self.tableView insertSections:[NSIndexSet indexSetWithIndex:sectionIndex] withRowAnimation:UITableViewRowAnimationFade]; break; case NSFetchedResultsChangeDelete: [self.tableView deleteSections:[NSIndexSet indexSetWithIndex:sectionIndex] withRowAnimation:UITableViewRowAnimationFade]; break; } } - (void)controller:(NSFetchedResultsController *)controller didChangeObject:(id)anObject atIndexPath:(NSIndexPath *)indexPath forChangeType:(NSFetchedResultsChangeType)type newIndexPath:(NSIndexPath *)newIndexPath { UITableView *tableView = self.tableView; switch(type) { case NSFetchedResultsChangeInsert: [tableView insertRowsAtIndexPaths:[NSArray arrayWithObject:newIndexPath] withRowAnimation:UITableViewRowAnimationFade]; break; case NSFetchedResultsChangeDelete: [tableView deleteRowsAtIndexPaths:[NSArray arrayWithObject:indexPath] withRowAnimation:UITableViewRowAnimationFade]; break; case NSFetchedResultsChangeUpdate: [self configureCell:[tableView cellForRowAtIndexPath:indexPath] atIndexPath:indexPath]; break; case NSFetchedResultsChangeMove: [tableView deleteRowsAtIndexPaths:[NSArray arrayWithObject:indexPath] withRowAnimation:UITableViewRowAnimationFade]; [tableView insertRowsAtIndexPaths:[NSArray arrayWithObject:newIndexPath]withRowAnimation:UITableViewRowAnimationFade]; break; } } - (void)controllerDidChangeContent:(NSFetchedResultsController *)controller { [self.tableView endUpdates]; } #pragma mark - #pragma mark Memory management - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Relinquish ownership any cached data, images, etc. that aren't in use. } - (void)viewDidUnload { // Relinquish ownership of anything that can be recreated in viewDidLoad or on demand. // For example: self.myOutlet = nil; } - (void)dealloc { [detailViewController release]; [fetchedResultsController release]; [managedObjectContext release]; [super dealloc]; } @end // // AddViewController.m // EmployeeDetails // // Created by Dipanjan on 15/02/11. // Copyright 2011 __MyCompanyName__. All rights reserved. // #import "AddViewController.h" #import "EmployeeDetailsAppDelegate.h" #import "RootViewController.h" @implementation AddViewController @synthesize empName; @synthesize empID; @synthesize empDepartment; @synthesize backButton; // The designated initializer. Override if you create the controller programmatically and want to perform customization that is not appropriate for viewDidLoad. /* - (id)initWithNibName:(NSString *)nibNameOrNil bundle:(NSBundle *)nibBundleOrNil { self = [super initWithNibName:nibNameOrNil bundle:nibBundleOrNil]; if (self) { // Custom initialization. } return self; } */ /* // Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { [super viewDidLoad]; } */ -(void)saveDetails{ EmployeeDetailsAppDelegate *appDelegate = [[UIApplication sharedApplication]delegate]; NSManagedObjectContext *context = [appDelegate managedObjectContext]; NSManagedObject *newDetails; newDetails = [NSEntityDescription insertNewObjectForEntityForName:@"Details" inManagedObjectContext:context]; [newDetails setValue:empID.text forKey:@"EmployeeID"]; [newDetails setValue:empName.text forKey:@"EmployeeName"]; [newDetails setValue:empDepartment.text forKey:@"EmployeeDepartment"]; empID.text = @""; empName.text = @""; empDepartment.text = @""; NSLog(@"%@........----->>>...", newDetails); NSError *error; [context save:&error]; [self dismissModalViewControllerAnimated:YES]; } -(void)findDetails { EmployeeDetailsAppDelegate *appDelegate = [[UIApplication sharedApplication]delegate]; NSManagedObjectContext *context = [appDelegate managedObjectContext]; NSEntityDescription *entityDesc = [NSEntityDescription entityForName:@"Details" inManagedObjectContext:context]; NSFetchRequest *request = [[NSFetchRequest alloc]init]; [request setEntity:entityDesc]; NSPredicate *pred = [NSPredicate predicateWithFormat:@"(EmployeeName = %@)", empName.text]; [request setPredicate:pred]; NSManagedObject *matches = nil; NSError *error; NSArray *objects = [context executeFetchRequest:request error:&error]; if ([objects count] == 0) { } else { matches = [objects objectAtIndex:0]; empID.text = [matches valueForKey:@"EmployeeID"]; empDepartment.text = [matches valueForKey:@"EmployeeDepartment"]; } [request release]; [self dismissModalViewControllerAnimated:YES]; } - (BOOL)shouldAutorotateToInterfaceOrientation:(UIInterfaceOrientation)interfaceOrientation { // Overriden to allow any orientation. return YES; } - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Release any cached data, images, etc. that aren't in use. } - (void)viewDidUnload { self.empName = nil; self.empID = nil; self.empDepartment = nil; [super viewDidUnload]; // Release any retained subviews of the main view. // e.g. self.myOutlet = nil; } - (void)dealloc { [empID release]; [empName release]; [empDepartment release]; [super dealloc]; } @end Please let me know the answer as soon as possible. Thank you. Regards, Dipanjan

    Read the article

  • matching an element's class to another element's ID, or *part* of another element's ID

    - by shecky
    hello again Such a simple concept but I'm struggling to express it ... apologies in advance for my verbosity. I have a container div with a class, e.g., ; I want to use that class to do two things: add a class (e.g., 'active') to the nav element whose ID matches the class of div#container (e.g., #nav-primary li# apples) add the same class to another element if part of this element's ID matches the class of #container (e.g., div#secondary-apples) I assume there's an .each() loop to check the primary nav's list items' IDs, and to check the div IDs of the secondary nav ... though the latter needs to have its prefix trimmed ... or should I say more simply if the secondary nav div IDs contain the class of div#container? I've tried a few variations of something like this: <script type="text/javascript"> $(document).ready(function() { $('#nav-primary li').each(function(){ var containerClass = $('#container').attr('class'); var secondaryID = $('#nav-primary li').attr('id'); // something like if ('#nav-primary li id' == (containerClass) { } // or should I first store a variable of the LI's ID and do something like this: if ( secondaryID == containerClass ) { } // and for the trickier part, how do I filter/trim the secondary nav div IDs, something like this: var secondaryNavID = $('#aux-left div[id ... something here to strip the 'secondary-' bit ... ]'); }); // end each }); // end doc.ready.func </script> The markup is, e.g.: ... ... ... ... ... ... ... Many thanks in advance for any suggestions, svs

    Read the article

  • mySQL ORDER BY ASC works, DESC does not...

    - by Ben
    I've "integrated" SMF into Wordpress by querying the forum for a list of the most recent videos from a specific forum board and displaying them on the Wordpress homepage. However when I add the ORDER BY clause, the query (which I tested on other parts of the same page successfully), breaks. To add to the mix, I am using the Auto Embed plugin to allow the videos to be played on the homepage, as well as using a jCarousel feature to rotate them. People were kind enough to help me here last time with the regexp to filter the video urls, I'm hoping for the same luck this time! Here is the entire function (remove the DESC and it works...): function SMF_getRecentVids($limit=10){ global $smf_settingsphp_d; if(file_exists($smf_settingsphp_d)) include($smf_settingsphp_d); include "AutoEmbed-1.4/AutoEmbed.class.php"; $AE = new AutoEmbed(); $connect = new wpdb($db_user,$db_passwd,$db_name,$db_server); $connect->query("SET NAMES 'UTF8'"); $sql = SELECT m.subject, m.ID_MSG, m.body, m.ID_TOPIC, m.ID_BOARD, t.ID_FIRST_MSG FROM {$db_prefix}messages AS m LEFT JOIN {$db_prefix}topics AS t ON (m.ID_TOPIC = t.ID_TOPIC) WHERE (m.ID_BOARD = 8) ORDER BY t.ID_FIRST_MSG DESC"; $vids = $connect->get_results($sql); $c = 0; $content = "imageCarousel_itemList = ["; foreach ($vids as $vid) { if ($c > $limit) continue; //extract video code from body $input = $vid->body; $regexp = "/\b(?:(?:https?|ftp):\/\/|www\.)[-a-z0-9+&@#\/%?=~_|!:,.;]*[-a-z0-9+&@#\/%=~_|]/i"; if(preg_match_all($regexp, $input, $matches)) { $AE->parseUrl($matches[0][0]); $imageURL = $AE->getImageURL(); $AE->setWidth(290); $AE->setHeight(240); $content .= "{url: '".$AE->getEmbedCode()."', title: '".$vid->subject."', caption: '', description: ''},"; } $c++; } $content .= "]"; echo $content; $wpdb = new wpdb(DB_USER, DB_PASSWORD, DB_NAME, DB_HOST); }

    Read the article

  • PL/SQL - How to pull data from 3 tables based on latest created date

    - by Nancy
    Hello, I'm hoping someone can help me as I've been stuck on this problem for a few days now. Basically I'm trying to pull data from 3 tables in Oracle: 1) Orders Table 2) Vendor Table and 3) Master Data Table. Here's what the 3 tables look like: Table 1: BIZ_DOC2 (Orders table) OBJECTID (Unique key) UNIQUE_DOC_NAME (Document Name i.e. ORD-005) CREATED_AT (Date the order was created) Table 2: UDEF_VENDOR (Vendors Table): PARENT_OBJECT_ID (This matches up to the ObjectId in the Orders table) VENDOR_OBJECT_NAME (This is the name of the vendor i.e. Acme) Table 3: BIZ_UNIT (Master Data table) PARENT_OBJECT_ID (This matches up to the ObjectID in the Orders table) BIZ_UNIT_OBJECT_NAME (This is the name of the business unit i.e. widget A, widget B) Note: The Vendors Table and Master Data do not have a link between them except through the Orders table. I can join all of the data from the tables and it looks something like this: Before selecting latest order date: ORD-005 | Widget A | Acme | 3/14/10 ORD-005 | Widget B | Acme | 3/14/10 ORD-004 | Widget C | Acme | 3/10/10 Ideally I'd like to return the latest order for each vendor. However, each order may contain multiple business units (e.g. types of widgets) so if a Vendor's latest record is ORD-005 and the order contains 2 business units, here's what the result set should look like by the following columns: UNIQUE_DOC_NAME, BIZ_UNIT_OBJECT_NAME, VENDOR_OBJECT_NAME, CREATED_AT After selecting by latest order date: ORD-005 | Widget A | Acme | 3/14/10 ORD-005 | Widget B | Acme | 3/14/10 I tried using Select Max and several variations of sub-queries but I just can't seem to get it working. Any help would be hugely appreciated!

    Read the article

  • How to isolate a single element from a scraped web page in R

    - by PaulHurleyuk
    Hello, I'm trying to do soemone a favour, and it's a tad outside my comfort zone, so I'm stuck. I want to use R to scrape this page (http://www.fifa.com/worldcup/archive/germany2006/results/matches/match=97410001/report.html ) and others, to get the goal scorers and times. So far, this is what I've got require(RCurl) require(XML) theURL <-"http://www.fifa.com/worldcup/archive/germany2006/results/matches/match=97410001/report.html" webpage <- getURL(theURL, header=FALSE, verbose=TRUE) webpagecont <- readLines(tc <- textConnection(webpage)); close(tc) pagetree <- htmlTreeParse(webpagecont, error=function(...){}, useInternalNodes = TRUE) and the pagetree object now contains a pointer to my parsed html (I think). The part I want is <div class="cont")<ul> <div class="bold medium">Goals scored</div> <li>Philipp LAHM (GER) 6', </li> <li>Paulo WANCHOPE (CRC) 12', </li> <li>Miroslav KLOSE (GER) 17', </li> <li>Miroslav KLOSE (GER) 61', </li> <li>Paulo WANCHOPE (CRC) 73', </li> <li>Torsten FRINGS (GER) 87'</li> </ul></div> but I'm now lost as to how to isolate them, and frankly xpathSApply, xpathApply confuse the beejeebies out of me !. So, does anyone know how to fomulate a command to suck out the element conmtaiend within the tags ? Thanks Paul.

    Read the article

  • Regex help in java validations

    - by user1697113
    Hi i want to do some validations.I used to put regex in JS but im new to regex in java, so i tried to make up a code on similar lines in java. Here is what i did. 1)Check whether first character in string is alphanumeric. 2)Check whether the string atleast 1 number. so i wrote a code, but it is always returning false.I am not sure if i'm doing this correctly. private static boolean checkEmbeddedPassword(final String field) { boolean returnValue=true; String testpatternAlpha="/^[A-Za-z0-9].+$/"; String testNumber="/[0-9]/"; Pattern pattern=Pattern.compile(testpatternAlpha); Pattern pattern2=Pattern.compile(testNumber); Matcher matcher = pattern.matcher(field); Matcher matcher2 = pattern2.matcher(field); boolean firstChar=matcher.matches(); boolean numberFlag=matcher2.matches(); System.out.println("-----the value of pwd iss-----"+field); System.out.println("---------Regex---------Out--put-----"+firstChar); System.out.println("---------Regex---------Out- for numeral-put-----"+numberFlag); if(firstChar){ returnValue=false; } else if(field.contains(" ")) { System.out.println("-----------cannot have space------"); returnValue=false; } else if(numberFlag) { returnValue=false; } return returnValue; }

    Read the article

  • Python halts while iteratively processing my 1GB csv file

    - by Dan
    I have two files: metadata.csv: contains an ID, followed by vendor name, a filename, etc hashes.csv: contains an ID, followed by a hash The ID is essentially a foreign key of sorts, relating file metadata to its hash. I wrote this script to quickly extract out all hashes associated with a particular vendor. It craps out before it finishes processing hashes.csv stored_ids = [] # this file is about 1 MB entries = csv.reader(open(options.entries, "rb")) for row in entries: # row[2] is the vendor if row[2] == options.vendor: # row[0] is the ID stored_ids.append(row[0]) # this file is 1 GB hashes = open(options.hashes, "rb") # I iteratively read the file here, # just in case the csv module doesn't do this. for line in hashes: # not sure if stored_ids contains strings or ints here... # this probably isn't the problem though if line.split(",")[0] in stored_ids: # if its one of the IDs we're looking for, print the file and hash to STDOUT print "%s,%s" % (line.split(",")[2], line.split(",")[4]) hashes.close() This script gets about 2000 entries through hashes.csv before it halts. What am I doing wrong? I thought I was processing it line by line. ps. the csv files are the popular HashKeeper format and the files I am parsing are the NSRL hash sets. http://www.nsrl.nist.gov/Downloads.htm#converter UPDATE: working solution below. Thanks everyone who commented! entries = csv.reader(open(options.entries, "rb")) stored_ids = dict((row[0],1) for row in entries if row[2] == options.vendor) hashes = csv.reader(open(options.hashes, "rb")) matches = dict((row[2], row[4]) for row in hashes if row[0] in stored_ids) for k, v in matches.iteritems(): print "%s,%s" % (k, v)

    Read the article

< Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >