Search Results

Search found 22613 results on 905 pages for 'variable length arguments'.

Page 29/905 | < Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >

  • Using a check contraint in MySQL for controlling string length

    - by ptrn
    I'm tumbled with a problem! I've set up my first check constraint using MySQL, but unfortunately I'm having a problem. When inserting a row that should fail the test, the row is inserted anyway. The structure: CREATE TABLE user ( id INT UNSIGNED NOT NULL AUTO_INCREMENT, uname VARCHAR(10) NOT NULL, fname VARCHAR(50) NOT NULL, lname VARCHAR(50) NOT NULL, mail VARCHAR(50) NOT NULL, PRIMARY KEY (id), CHECK (LENGTH(fname) > 30) ); The insert statement: INSERT INTO user VALUES (null, 'user', 'Fname', 'Lname', '[email protected]'); The length of the string in the fname column should be too short, but it's inserted anyway. I'm pretty sure I'm missing something basic here.

    Read the article

  • Uncaught TypeError: Cannot read property 'length' of undefined

    - by AnApprentice
    I'm working to built a contact list that is grouped by the first letter of the contact's last name. After a succesfull ajax request, the contact is pushed to addContact: Ajax success: ko.utils.arrayForEach(dataJS.contactList, function(c) { contactsModel.addContact(c); }); contactsModel.addContact: //add a contact in the right spot under the right letter contactsModel.addContact = function(newContact) { //grab first character var firstLetter = (newContact.lname || "").charAt(0).toUpperCase(); //if it is a number use # if (!isNaN(firstLetter)) { firstLetter = "#"; } //do we already have entries for this letter if (!this.letterIndex[firstLetter]) { //new object to track this letter's contacts var letterContacts = { letter: firstLetter, contacts: ko.observableArray([]) }; this.letterIndex[firstLetter] = letterContacts; //easy access to it //put the numbers at the end if (firstLetter === "#") { this.contactsByLetter.push(letterContacts); } else { //add the letter in the right spot for (var i = 0, lettersLength = this.contactsByLetter().length; i < lettersLength; i++) { var letter = this.contactsByLetter()[i].letter; if (letter === "#" || firstLetter < letter) { break; } } this.contactsByLetter.splice(i, 0, letterContacts); } } var contacts = this.letterIndex[firstLetter].contacts; //now we have a letter to add our contact to, but need to add it in the right spot var newContactName = newContact.lname + " " + newContact.fname; for (var j = 0, contactsLength = contacts().length; j < contactsLength; j++) { var contactName = contacts()[j].lName + " " + contacts()[j].fName; if (newContactName < contactName) { break; } } //add the contact at the right index contacts.splice(j, 0, newContact); }.bind(contactsModel); The contacts json object from the server looks like this: { "total_pages": 10, "page": page, "contactList": [{ "photo": "http://homepage.mac.com/millhouse/Family%20Tree/images/PersonListIcon.png", "lname": "Bond", "id": 241, "fname": "James", "email": "[email protected]"}, While this works in jsfiddle, when I try it locally, I get the following error during the first push to addContact: Uncaught TypeError: Cannot read property 'length' of undefined jQuery.jQuery.extend._Deferred.deferred.resolveWithjquery-1.5.1.js:869 donejquery-1.5.1.js:6591 jQuery.ajaxTransport.send.callbackjquery-1.5.1.js:7382 Ideas? Thanks

    Read the article

  • Calculating Length Based on Sensor Data

    - by BSchlinker
    I've got an IR sensor which writes its current information to a token which I then interpret in a C# application. That's all good -- no problems there, heres my code: SetLabelText(tokens [1],label_sensorValue); sensorreading = Int32.Parse(tokens[0]); sensordistance = (mathfunctionhere); Great. So the further away the IR sensor is from an object, the lower the sensor reading (as less light is reflected back and received by the sensor). My problem is in interpreting that length. I can go ahead and get lets say "110" as a value when an object is 5 inches away, and then "70" as a value when an object is 6 inches away. Now I want to be able to calculate the distance of an object using these constants for any length. Any ideas?

    Read the article

  • How to marshal structs with unknown length string fields in C#

    - by Ofir
    Hi all, I get an array of bytes, I need to unmarshal it to C# struct. I know the type of the struct, it has some strings fields. The strings in the byte array appears as so: two first bytes are the length of the string, then the string itself. I don;t know the length of the strings. I do know that its Unicode! [StructLayout(LayoutKind.Sequential, CharSet = CharSet.Unicode)] public class User { int Id;//should be 1 String UserName;//should be OFIR String FullName;//should be OFIR } the byte array looks like so: 00,00,01,00, 00,00,08,00, 4F,00,46,00,49,00,52,00, 00,00,08,00, 4F,00,46,00,49,00,52,00, I also found this link with same problem unsolved: loading binary data into a structure Thank you all, Ofir

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Problem calling stored procedure with a fixed length binary parameter using Entity Framework

    - by Dave
    I have a problem calling stored procedures with a fixed length binary parameter using Entity Framework. The stored procedure ends up being called with 8000 bytes of data no matter what size byte array I use to call the function import. To give some example, this is the code I am using. byte[] cookie = new byte[32]; byte[] data = new byte[2]; entities.Insert("param1", "param2", cookie, data); The parameters are nvarchar(50), nvarchar(50), binary(32), varbinary(2000) When I run the code through SQL profiler, I get this result. exec [dbo].[Insert] @param1=N'param1',@param2=N'param2',@cookie=0x00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 [SNIP because of 16000 zeros] ,@data=0x0000 All parameters went through ok other than the binary(32) cookie. The varbinary(2000) seemed to work fine and the correct length was maintained. Is there a way to prevent the extra data being sent to SQL server? This seems like a big waste of network resource.

    Read the article

  • Alter multiple tables' columns length

    - by gdoron
    So, we just found out that 254 tables in our Oracle DBMS have one column named "Foo" with the wrong length- Number(10) instead of Number(3). That foo column is a part from the PK of the tables. Those tables have other tables with forigen keys to it. What I did is: backed-up the table with a temp table. Disabled the forigen keys to the table. Disabled the PK with the foo column. Nulled the foo column for all the rows. Restored all the above But now we found out it's not just couple of tables but 254 tables. Is there an easy way, (or at least easier than this) to alter the columns length? P.S. I have DBA permissions.

    Read the article

  • Interview Question: .Any() vs if (.Length > 0) for testing if a collection has elements

    - by Chris
    In a recent interview I was asked what the difference between .Any() and .Length > 0 was and why I would use either when testing to see if a collection had elements. This threw me a little as it seems a little obvious but feel I may be missing something. I suggested that you use .Length when you simply need to know that a collection has elements and .Any() when you wish to filter the results. Presumably .Any() takes a performance hit too as it has to do a loop / query internally.

    Read the article

  • SQL select statement - returning records starting with variable length string

    - by alpheus
    I am using an alphabetical sorting feature and need a SQL statement to return records beginning with a variable length string. However, records also need to be returned if there are periods, spaces, or dashes between any of the characters in the string. For example, the string could be "M" (easy). Or "MA" (in which case it needs to return records starting with "MA", "M.A", "M A", and "M-A"). Or "MAA", and so on. This is the statement I have so far: "SELECT * from table where LEFT(name," + value.Length + ")='" + value + "'" But I can't work out how to get it to return results where there are periods, spaces or dashes in name. Any help constructing the statement would be great.

    Read the article

  • Barcode field length

    - by bestattendance
    I'm writing some attendance software. Each member will have an ID card with a barcode which they will use to sign in to events. How long should the barcode field be in my database? I'd like to accept Code 39 and Code 128 barcodes. I know these are variable length codes, so what should I set the max length to? Thanks! EDIT: My clients will be using a variety of third-party barcode printing tools.

    Read the article

  • SQL tables using VARCHAR with UTF8 (with respect to multi byte character length)

    - by Elius
    Like in Oracle VARCHAR( 60 CHAR ) I would like to specify a varchar field with variable length depending on the inserted characters. for example: create table X (text varchar(3)) insert into X (text) VALUES ('äöü') Should be possible (with UTF8 as the default charset of the database). On DB2 I got this Error: DB2 SQL Error: SQLCODE=-302, SQLSTATE=22001 (Character data, right truncation occurred; for example, an update or insert value is a string that is too long for the column, or a datetime value cannot be assigned to a host variable, because it is too small.) I'm looking for solutions for DB2, MsSql, MySql, Hypersonic.

    Read the article

  • Accessing Variables in Javascript using .length

    - by CoV
    Hey all, I'm pretty new to Javascript, so forgive me if this is a simple question. I'm trying to access the length of a set of checkboxes in a form using Javascript. However, I need to be able to change the "name" field of the checkboxes to check several different sets of them. Right now, my sample code looks like: var set = "set" + x; totalLength = optionBoxes.set.length; The variable x is being incremented by a for loop that wraps the whole thing and the name of the checkbox sets that I'm trying to access are set0, set1, set2, etc. Thanks. Edit: small typo fixes

    Read the article

  • Are function arguments stored in a closure?

    - by Nick Lowman
    I was reading this great article about closures here and the example below outputs 'item3 undefined' three times. I understand why it outputs 'item3' three times as the functions inside buildList() all use the same single closure but why can't it access the 'list' argument? Why is it undefined? Is it because the argument is passed in after the closure has been created? function buildList(list) { var result = []; for (var i = 0; i < list.length; i++) { var item = 'item' + list[i]; result.push( function() {console.log(item + ' ' + list[i])} ); } return result; } function testList() { var fnlist = buildList([1,2,3]); // using j only to help prevent confusion - could use i for (var j = 0; j < fnlist.length; j++) { fnlist[j](); } }

    Read the article

  • any other way to find char array length?

    - by user2785137
    public static int getLenth(char[] t) { int i=0; int count=0; try { while(t[i]!='\0') { ++count; i++; } return count; } catch(ArrayIndexOutOfBoundsException aiobe) { return count; } } This method returns length of charArray. But my question is, is there is some other "ways" to find the length of charArray without using this try, catch statements & all ?? Thanks in advance :)

    Read the article

  • Unable to assign command output to a variable

    - by Harish Maralihalli
    I am trying to assign the latest file name obtained from the below ls command but getting some error, it would be very nice if someone can answer how can I fix this! fn=`ls -lrt pur_bom_interface_daily*.log | cut -c59-102 | tail -1` or fn=$(ls -lrt pur_bom_interface_daily*.log | cut -c59-102 | tail -1) Error got: ls: 0653-341 The file pur_bom_interface_daily*.log does not exist Note: pur_bom_interface_daily*.log I am using * since there are multiple files starting their name with pur_bom_interface_daily and concatanated with the date on which they have got created.

    Read the article

  • New features of C# 4.0

    This article covers New features of C# 4.0. Article has been divided into below sections. Introduction. Dynamic Lookup. Named and Optional Arguments. Features for COM interop. Variance. Relationship with Visual Basic. Resources. Other interested readings… 22 New Features of Visual Studio 2008 for .NET Professionals 50 New Features of SQL Server 2008 IIS 7.0 New features Introduction It is now close to a year since Microsoft Visual C# 3.0 shipped as part of Visual Studio 2008. In the VS Managed Languages team we are hard at work on creating the next version of the language (with the unsurprising working title of C# 4.0), and this document is a first public description of the planned language features as we currently see them. Please be advised that all this is in early stages of production and is subject to change. Part of the reason for sharing our plans in public so early is precisely to get the kind of feedback that will cause us to improve the final product before it rolls out. Simultaneously with the publication of this whitepaper, a first public CTP (community technology preview) of Visual Studio 2010 is going out as a Virtual PC image for everyone to try. Please use it to play and experiment with the features, and let us know of any thoughts you have. We ask for your understanding and patience working with very early bits, where especially new or newly implemented features do not have the quality or stability of a final product. The aim of the CTP is not to give you a productive work environment but to give you the best possible impression of what we are working on for the next release. The CTP contains a number of walkthroughs, some of which highlight the new language features of C# 4.0. Those are excellent for getting a hands-on guided tour through the details of some common scenarios for the features. You may consider this whitepaper a companion document to these walkthroughs, complementing them with a focus on the overall language features and how they work, as opposed to the specifics of the concrete scenarios. C# 4.0 The major theme for C# 4.0 is dynamic programming. Increasingly, objects are “dynamic” in the sense that their structure and behavior is not captured by a static type, or at least not one that the compiler knows about when compiling your program. Some examples include a. objects from dynamic programming languages, such as Python or Ruby b. COM objects accessed through IDispatch c. ordinary .NET types accessed through reflection d. objects with changing structure, such as HTML DOM objects While C# remains a statically typed language, we aim to vastly improve the interaction with such objects. A secondary theme is co-evolution with Visual Basic. Going forward we will aim to maintain the individual character of each language, but at the same time important new features should be introduced in both languages at the same time. They should be differentiated more by style and feel than by feature set. The new features in C# 4.0 fall into four groups: Dynamic lookup Dynamic lookup allows you to write method, operator and indexer calls, property and field accesses, and even object invocations which bypass the C# static type checking and instead gets resolved at runtime. Named and optional parameters Parameters in C# can now be specified as optional by providing a default value for them in a member declaration. When the member is invoked, optional arguments can be omitted. Furthermore, any argument can be passed by parameter name instead of position. COM specific interop features Dynamic lookup as well as named and optional parameters both help making programming against COM less painful than today. On top of that, however, we are adding a number of other small features that further improve the interop experience. Variance It used to be that an IEnumerable<string> wasn’t an IEnumerable<object>. Now it is – C# embraces type safe “co-and contravariance” and common BCL types are updated to take advantage of that. Dynamic Lookup Dynamic lookup allows you a unified approach to invoking things dynamically. With dynamic lookup, when you have an object in your hand you do not need to worry about whether it comes from COM, IronPython, the HTML DOM or reflection; you just apply operations to it and leave it to the runtime to figure out what exactly those operations mean for that particular object. This affords you enormous flexibility, and can greatly simplify your code, but it does come with a significant drawback: Static typing is not maintained for these operations. A dynamic object is assumed at compile time to support any operation, and only at runtime will you get an error if it wasn’t so. Oftentimes this will be no loss, because the object wouldn’t have a static type anyway, in other cases it is a tradeoff between brevity and safety. In order to facilitate this tradeoff, it is a design goal of C# to allow you to opt in or opt out of dynamic behavior on every single call. The dynamic type C# 4.0 introduces a new static type called dynamic. When you have an object of type dynamic you can “do things to it” that are resolved only at runtime: dynamic d = GetDynamicObject(…); d.M(7); The C# compiler allows you to call a method with any name and any arguments on d because it is of type dynamic. At runtime the actual object that d refers to will be examined to determine what it means to “call M with an int” on it. The type dynamic can be thought of as a special version of the type object, which signals that the object can be used dynamically. It is easy to opt in or out of dynamic behavior: any object can be implicitly converted to dynamic, “suspending belief” until runtime. Conversely, there is an “assignment conversion” from dynamic to any other type, which allows implicit conversion in assignment-like constructs: dynamic d = 7; // implicit conversion int i = d; // assignment conversion Dynamic operations Not only method calls, but also field and property accesses, indexer and operator calls and even delegate invocations can be dispatched dynamically: dynamic d = GetDynamicObject(…); d.M(7); // calling methods d.f = d.P; // getting and settings fields and properties d[“one”] = d[“two”]; // getting and setting thorugh indexers int i = d + 3; // calling operators string s = d(5,7); // invoking as a delegate The role of the C# compiler here is simply to package up the necessary information about “what is being done to d”, so that the runtime can pick it up and determine what the exact meaning of it is given an actual object d. Think of it as deferring part of the compiler’s job to runtime. The result of any dynamic operation is itself of type dynamic. Runtime lookup At runtime a dynamic operation is dispatched according to the nature of its target object d: COM objects If d is a COM object, the operation is dispatched dynamically through COM IDispatch. This allows calling to COM types that don’t have a Primary Interop Assembly (PIA), and relying on COM features that don’t have a counterpart in C#, such as indexed properties and default properties. Dynamic objects If d implements the interface IDynamicObject d itself is asked to perform the operation. Thus by implementing IDynamicObject a type can completely redefine the meaning of dynamic operations. This is used intensively by dynamic languages such as IronPython and IronRuby to implement their own dynamic object models. It will also be used by APIs, e.g. by the HTML DOM to allow direct access to the object’s properties using property syntax. Plain objects Otherwise d is a standard .NET object, and the operation will be dispatched using reflection on its type and a C# “runtime binder” which implements C#’s lookup and overload resolution semantics at runtime. This is essentially a part of the C# compiler running as a runtime component to “finish the work” on dynamic operations that was deferred by the static compiler. Example Assume the following code: dynamic d1 = new Foo(); dynamic d2 = new Bar(); string s; d1.M(s, d2, 3, null); Because the receiver of the call to M is dynamic, the C# compiler does not try to resolve the meaning of the call. Instead it stashes away information for the runtime about the call. This information (often referred to as the “payload”) is essentially equivalent to: “Perform an instance method call of M with the following arguments: 1. a string 2. a dynamic 3. a literal int 3 4. a literal object null” At runtime, assume that the actual type Foo of d1 is not a COM type and does not implement IDynamicObject. In this case the C# runtime binder picks up to finish the overload resolution job based on runtime type information, proceeding as follows: 1. Reflection is used to obtain the actual runtime types of the two objects, d1 and d2, that did not have a static type (or rather had the static type dynamic). The result is Foo for d1 and Bar for d2. 2. Method lookup and overload resolution is performed on the type Foo with the call M(string,Bar,3,null) using ordinary C# semantics. 3. If the method is found it is invoked; otherwise a runtime exception is thrown. Overload resolution with dynamic arguments Even if the receiver of a method call is of a static type, overload resolution can still happen at runtime. This can happen if one or more of the arguments have the type dynamic: Foo foo = new Foo(); dynamic d = new Bar(); var result = foo.M(d); The C# runtime binder will choose between the statically known overloads of M on Foo, based on the runtime type of d, namely Bar. The result is again of type dynamic. The Dynamic Language Runtime An important component in the underlying implementation of dynamic lookup is the Dynamic Language Runtime (DLR), which is a new API in .NET 4.0. The DLR provides most of the infrastructure behind not only C# dynamic lookup but also the implementation of several dynamic programming languages on .NET, such as IronPython and IronRuby. Through this common infrastructure a high degree of interoperability is ensured, but just as importantly the DLR provides excellent caching mechanisms which serve to greatly enhance the efficiency of runtime dispatch. To the user of dynamic lookup in C#, the DLR is invisible except for the improved efficiency. However, if you want to implement your own dynamically dispatched objects, the IDynamicObject interface allows you to interoperate with the DLR and plug in your own behavior. This is a rather advanced task, which requires you to understand a good deal more about the inner workings of the DLR. For API writers, however, it can definitely be worth the trouble in order to vastly improve the usability of e.g. a library representing an inherently dynamic domain. Open issues There are a few limitations and things that might work differently than you would expect. · The DLR allows objects to be created from objects that represent classes. However, the current implementation of C# doesn’t have syntax to support this. · Dynamic lookup will not be able to find extension methods. Whether extension methods apply or not depends on the static context of the call (i.e. which using clauses occur), and this context information is not currently kept as part of the payload. · Anonymous functions (i.e. lambda expressions) cannot appear as arguments to a dynamic method call. The compiler cannot bind (i.e. “understand”) an anonymous function without knowing what type it is converted to. One consequence of these limitations is that you cannot easily use LINQ queries over dynamic objects: dynamic collection = …; var result = collection.Select(e => e + 5); If the Select method is an extension method, dynamic lookup will not find it. Even if it is an instance method, the above does not compile, because a lambda expression cannot be passed as an argument to a dynamic operation. There are no plans to address these limitations in C# 4.0. Named and Optional Arguments Named and optional parameters are really two distinct features, but are often useful together. Optional parameters allow you to omit arguments to member invocations, whereas named arguments is a way to provide an argument using the name of the corresponding parameter instead of relying on its position in the parameter list. Some APIs, most notably COM interfaces such as the Office automation APIs, are written specifically with named and optional parameters in mind. Up until now it has been very painful to call into these APIs from C#, with sometimes as many as thirty arguments having to be explicitly passed, most of which have reasonable default values and could be omitted. Even in APIs for .NET however you sometimes find yourself compelled to write many overloads of a method with different combinations of parameters, in order to provide maximum usability to the callers. Optional parameters are a useful alternative for these situations. Optional parameters A parameter is declared optional simply by providing a default value for it: public void M(int x, int y = 5, int z = 7); Here y and z are optional parameters and can be omitted in calls: M(1, 2, 3); // ordinary call of M M(1, 2); // omitting z – equivalent to M(1, 2, 7) M(1); // omitting both y and z – equivalent to M(1, 5, 7) Named and optional arguments C# 4.0 does not permit you to omit arguments between commas as in M(1,,3). This could lead to highly unreadable comma-counting code. Instead any argument can be passed by name. Thus if you want to omit only y from a call of M you can write: M(1, z: 3); // passing z by name or M(x: 1, z: 3); // passing both x and z by name or even M(z: 3, x: 1); // reversing the order of arguments All forms are equivalent, except that arguments are always evaluated in the order they appear, so in the last example the 3 is evaluated before the 1. Optional and named arguments can be used not only with methods but also with indexers and constructors. Overload resolution Named and optional arguments affect overload resolution, but the changes are relatively simple: A signature is applicable if all its parameters are either optional or have exactly one corresponding argument (by name or position) in the call which is convertible to the parameter type. Betterness rules on conversions are only applied for arguments that are explicitly given – omitted optional arguments are ignored for betterness purposes. If two signatures are equally good, one that does not omit optional parameters is preferred. M(string s, int i = 1); M(object o); M(int i, string s = “Hello”); M(int i); M(5); Given these overloads, we can see the working of the rules above. M(string,int) is not applicable because 5 doesn’t convert to string. M(int,string) is applicable because its second parameter is optional, and so, obviously are M(object) and M(int). M(int,string) and M(int) are both better than M(object) because the conversion from 5 to int is better than the conversion from 5 to object. Finally M(int) is better than M(int,string) because no optional arguments are omitted. Thus the method that gets called is M(int). Features for COM interop Dynamic lookup as well as named and optional parameters greatly improve the experience of interoperating with COM APIs such as the Office Automation APIs. In order to remove even more of the speed bumps, a couple of small COM-specific features are also added to C# 4.0. Dynamic import Many COM methods accept and return variant types, which are represented in the PIAs as object. In the vast majority of cases, a programmer calling these methods already knows the static type of a returned object from context, but explicitly has to perform a cast on the returned value to make use of that knowledge. These casts are so common that they constitute a major nuisance. In order to facilitate a smoother experience, you can now choose to import these COM APIs in such a way that variants are instead represented using the type dynamic. In other words, from your point of view, COM signatures now have occurrences of dynamic instead of object in them. This means that you can easily access members directly off a returned object, or you can assign it to a strongly typed local variable without having to cast. To illustrate, you can now say excel.Cells[1, 1].Value = "Hello"; instead of ((Excel.Range)excel.Cells[1, 1]).Value2 = "Hello"; and Excel.Range range = excel.Cells[1, 1]; instead of Excel.Range range = (Excel.Range)excel.Cells[1, 1]; Compiling without PIAs Primary Interop Assemblies are large .NET assemblies generated from COM interfaces to facilitate strongly typed interoperability. They provide great support at design time, where your experience of the interop is as good as if the types where really defined in .NET. However, at runtime these large assemblies can easily bloat your program, and also cause versioning issues because they are distributed independently of your application. The no-PIA feature allows you to continue to use PIAs at design time without having them around at runtime. Instead, the C# compiler will bake the small part of the PIA that a program actually uses directly into its assembly. At runtime the PIA does not have to be loaded. Omitting ref Because of a different programming model, many COM APIs contain a lot of reference parameters. Contrary to refs in C#, these are typically not meant to mutate a passed-in argument for the subsequent benefit of the caller, but are simply another way of passing value parameters. It therefore seems unreasonable that a C# programmer should have to create temporary variables for all such ref parameters and pass these by reference. Instead, specifically for COM methods, the C# compiler will allow you to pass arguments by value to such a method, and will automatically generate temporary variables to hold the passed-in values, subsequently discarding these when the call returns. In this way the caller sees value semantics, and will not experience any side effects, but the called method still gets a reference. Open issues A few COM interface features still are not surfaced in C#. Most notably these include indexed properties and default properties. As mentioned above these will be respected if you access COM dynamically, but statically typed C# code will still not recognize them. There are currently no plans to address these remaining speed bumps in C# 4.0. Variance An aspect of generics that often comes across as surprising is that the following is illegal: IList<string> strings = new List<string>(); IList<object> objects = strings; The second assignment is disallowed because strings does not have the same element type as objects. There is a perfectly good reason for this. If it were allowed you could write: objects[0] = 5; string s = strings[0]; Allowing an int to be inserted into a list of strings and subsequently extracted as a string. This would be a breach of type safety. However, there are certain interfaces where the above cannot occur, notably where there is no way to insert an object into the collection. Such an interface is IEnumerable<T>. If instead you say: IEnumerable<object> objects = strings; There is no way we can put the wrong kind of thing into strings through objects, because objects doesn’t have a method that takes an element in. Variance is about allowing assignments such as this in cases where it is safe. The result is that a lot of situations that were previously surprising now just work. Covariance In .NET 4.0 the IEnumerable<T> interface will be declared in the following way: public interface IEnumerable<out T> : IEnumerable { IEnumerator<T> GetEnumerator(); } public interface IEnumerator<out T> : IEnumerator { bool MoveNext(); T Current { get; } } The “out” in these declarations signifies that the T can only occur in output position in the interface – the compiler will complain otherwise. In return for this restriction, the interface becomes “covariant” in T, which means that an IEnumerable<A> is considered an IEnumerable<B> if A has a reference conversion to B. As a result, any sequence of strings is also e.g. a sequence of objects. This is useful e.g. in many LINQ methods. Using the declarations above: var result = strings.Union(objects); // succeeds with an IEnumerable<object> This would previously have been disallowed, and you would have had to to some cumbersome wrapping to get the two sequences to have the same element type. Contravariance Type parameters can also have an “in” modifier, restricting them to occur only in input positions. An example is IComparer<T>: public interface IComparer<in T> { public int Compare(T left, T right); } The somewhat baffling result is that an IComparer<object> can in fact be considered an IComparer<string>! It makes sense when you think about it: If a comparer can compare any two objects, it can certainly also compare two strings. This property is referred to as contravariance. A generic type can have both in and out modifiers on its type parameters, as is the case with the Func<…> delegate types: public delegate TResult Func<in TArg, out TResult>(TArg arg); Obviously the argument only ever comes in, and the result only ever comes out. Therefore a Func<object,string> can in fact be used as a Func<string,object>. Limitations Variant type parameters can only be declared on interfaces and delegate types, due to a restriction in the CLR. Variance only applies when there is a reference conversion between the type arguments. For instance, an IEnumerable<int> is not an IEnumerable<object> because the conversion from int to object is a boxing conversion, not a reference conversion. Also please note that the CTP does not contain the new versions of the .NET types mentioned above. In order to experiment with variance you have to declare your own variant interfaces and delegate types. COM Example Here is a larger Office automation example that shows many of the new C# features in action. using System; using System.Diagnostics; using System.Linq; using Excel = Microsoft.Office.Interop.Excel; using Word = Microsoft.Office.Interop.Word; class Program { static void Main(string[] args) { var excel = new Excel.Application(); excel.Visible = true; excel.Workbooks.Add(); // optional arguments omitted excel.Cells[1, 1].Value = "Process Name"; // no casts; Value dynamically excel.Cells[1, 2].Value = "Memory Usage"; // accessed var processes = Process.GetProcesses() .OrderByDescending(p =&gt; p.WorkingSet) .Take(10); int i = 2; foreach (var p in processes) { excel.Cells[i, 1].Value = p.ProcessName; // no casts excel.Cells[i, 2].Value = p.WorkingSet; // no casts i++; } Excel.Range range = excel.Cells[1, 1]; // no casts Excel.Chart chart = excel.ActiveWorkbook.Charts. Add(After: excel.ActiveSheet); // named and optional arguments chart.ChartWizard( Source: range.CurrentRegion, Title: "Memory Usage in " + Environment.MachineName); //named+optional chart.ChartStyle = 45; chart.CopyPicture(Excel.XlPictureAppearance.xlScreen, Excel.XlCopyPictureFormat.xlBitmap, Excel.XlPictureAppearance.xlScreen); var word = new Word.Application(); word.Visible = true; word.Documents.Add(); // optional arguments word.Selection.Paste(); } } The code is much more terse and readable than the C# 3.0 counterpart. Note especially how the Value property is accessed dynamically. This is actually an indexed property, i.e. a property that takes an argument; something which C# does not understand. However the argument is optional. Since the access is dynamic, it goes through the runtime COM binder which knows to substitute the default value and call the indexed property. Thus, dynamic COM allows you to avoid accesses to the puzzling Value2 property of Excel ranges. Relationship with Visual Basic A number of the features introduced to C# 4.0 already exist or will be introduced in some form or other in Visual Basic: · Late binding in VB is similar in many ways to dynamic lookup in C#, and can be expected to make more use of the DLR in the future, leading to further parity with C#. · Named and optional arguments have been part of Visual Basic for a long time, and the C# version of the feature is explicitly engineered with maximal VB interoperability in mind. · NoPIA and variance are both being introduced to VB and C# at the same time. VB in turn is adding a number of features that have hitherto been a mainstay of C#. As a result future versions of C# and VB will have much better feature parity, for the benefit of everyone. Resources All available resources concerning C# 4.0 can be accessed through the C# Dev Center. Specifically, this white paper and other resources can be found at the Code Gallery site. Enjoy! span.fullpost {display:none;}

    Read the article

< Previous Page | 25 26 27 28 29 30 31 32 33 34 35 36  | Next Page >