Search Results

Search found 12912 results on 517 pages for 'auto suggest'.

Page 298/517 | < Previous Page | 294 295 296 297 298 299 300 301 302 303 304 305  | Next Page >

• Query only the first detail record for each master record

  - by Neal S.

  If I have the following master-detail relationship: owner_tbl auto_tbl --------- -------- owner --- owner auto year And I have the following table data: owner_tbl auto_tbl --------- -------- john john, corvette, 1968 john, prius, 2008 james james, f-150, 2004 james, cadillac, 2002 james, accord, 2009 jeff jeff, tesla, 2010 jeff, hyundai, 1996 Now, I want to perform a query that returns the following result: john, corvette, 1968 jeff, hyundai, 1996 james, cadillac, 2002 The query should join the two tables, and sort all the records on the "year" field, but only return the first detail record for each master record. I know how to join the tables and sort on the "year" field, but it's not clear how (or if) I might be able to only retrieve the first joined record for each owner. Three related questions: Can I perform this kind of query using LINQ-to-SQL? Can I perform the query using T-SQL? Would it be best to just create a stored procedure for the query given its likely complexity?

  Read the article

• Visibility.Collapse doesnt work

  - by nitin

  Visibility.Collapse doesnt work in my case. below is the XAML. If i try to hide the lblCountry and cmbCountry a white space is shown between zip and practice fields. There is no option to hide an entire row of a Grid. <Grid> <Canvas Name="canDemographic" > </Canvas> <Grid HorizontalAlignment="Center" VerticalAlignment="Center"> <Grid.ColumnDefinitions> <ColumnDefinition Width="auto"/> <ColumnDefinition Width="auto"/> </Grid.ColumnDefinitions> <Grid.RowDefinitions> <RowDefinition Height="40"/> <RowDefinition Height="40" /> <RowDefinition Height="40" /> <RowDefinition Height="40" /> <RowDefinition Height="40" /> <RowDefinition Height="40"/> <RowDefinition Height="40"/> <RowDefinition Height="40"/> <RowDefinition Height="40"/> <RowDefinition Height="40"/> <RowDefinition Height="40"/> <RowDefinition Height="40"/> <RowDefinition Height="40"/> </Grid.RowDefinitions> <TextBlock Width="800" Height="50" Grid.Column="0" Grid.Row="1" Grid.ColumnSpan="2" VerticalAlignment="Center" HorizontalAlignment="Center" FontFamily="Arial" FontSize="30" FontWeight="Bold" Visibility="Collapsed"> Please review or enter your user information details: </TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="2" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *First Name: </TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="3" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Text=" Middle Name:"></TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="4" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *Last Name: </TextBlock> <TextBlock Name="tbEmail" Width="200" Height="30" Grid.Column="0" Grid.Row="12" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *Email Address: </TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="5" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *Address1: </TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="6" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Text=" Address2:"></TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="7" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *City: </TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="8" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *State: </TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="9" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold"> *Zip: </TextBlock> <TextBlock Name="lblCountry" Width="200" Grid.Column="0" Grid.ColumnSpan="2" Grid.Row="10" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Text=" *Country:" Visibility="Collapsed"="></TextBlock> <TextBlock Width="200" Height="30" Grid.Column="0" Grid.Row="11" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Text=" Practice/Affiliation:"></TextBlock> <!-- Input fields --> <TextBox Name="txtFirstName" Width="200" Height="30" Grid.Column="1" Grid.Row="2" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" MaxLength="20" TextChanged="txtFirstName_TextChanged" IsEnabled="True" /> <TextBox Name="txtMiddleName" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="3" MaxLength="10" IsEnabled="True" /> <TextBox Name="txtLastName" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="4" MaxLength="20" TextChanged="txtLastName_TextChanged" /> <TextBox Name="txtEmail" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="12" MaxLength="100"/> <TextBox Name="txtAddress1" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="5" MaxLength="100" TextChanged="txtAddress1_TextChanged" /> <TextBox Name="txtAddress2" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="6" MaxLength="100"/> <TextBox Name="txtCity" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="7" MaxLength="50" TextChanged="txtCity_TextChanged" /> <TextBox Name="txtState" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="8" MaxLength="50" TextChanged="txtState_TextChanged" /> <TextBox Name="txtZip" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="9" MaxLength="50" TextChanged="txtZip_TextChanged" /> <ComboBox Name="cmbCountry" Width="200" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="0" Grid.Row="10" Grid.ColumnSpan="2" SelectionChanged="cmbCountry_SelectionChanged" ItemsSource="{Binding}" Visibility="Collapsed" /> <TextBox Name="txtPractice" Width="200" Height="30" VerticalAlignment="Center" HorizontalAlignment="Left" FontFamily="Arial" FontSize="18" FontWeight="Bold" Grid.Column="1" Grid.Row="11" MaxLength="50"/> </Grid> <Button Name="btnExit" Height="30" VerticalAlignment="Bottom" Width="100" HorizontalAlignment="Left" Margin="21,0,0,12" BorderThickness="1" FontFamily="arial" Background="LightGray" FontSize="12pt" FontWeight="Bold" Click="btnExit_Click">Back</Button> <Button Name="btnNext" Height="30" VerticalAlignment="Bottom" Width="100" HorizontalAlignment="Right" Margin="0,0,21,12" BorderThickness="1" FontFamily="arial" Background="LightGray" FontSize="12pt" FontWeight="Bold" Click="btnNext_Click" IsEnabled="False" >Next</Button> </Grid> </ScrollViewer>

  Read the article

• Modifying a column with the 'Identity' pattern is not supported in WCF RIA Services

  - by Banford

  I've been following the walkthrough for creating your first WCF RIA Services Application from Microsoft and have encountered a problem when trying to edit and update data using the SubmitChanges() method of the Data Context. The table being updated has an Identity Specification set in SQL Server 2008 on the 'CourseID' column. However the PRIMARY key is a composite of two other fields. When using SubmitChanges() the application locks up in the browser an presents an unhandled exception. By handling this exception I managed to get the message: Modifying a column with the 'Identity' pattern is not supported. This is referring to the 'CourseID' column. Turning identity specification off solves the problem, but I need the auto-incrementing ID. In what way isn't this supported. Or where am I going wrong?

  Read the article

• Exception handling policy in libraries

  - by Asaf R

  When building a .NET library, what's your exception handling policy? In specific, what's your policy about handling exceptions inside library calls and exposing them to calling code? Would you treat a library function as any other, thus letting all exceptions it can't handle flow out of it as-is? Would you create a custom exception for that library? Would you catch all exceptions and throw the library's exception instead? Would you set the original exception as the library's exception internal exception? How would the library dependence on a DB affect your exception-handling policy? What other guidelines and rules would you suggest?

  Read the article

• Checking existence of file types via extensions bash.

  - by Tommy

  Hi, I need to test if various file types exist in a directory. I've tried $ [ -f *.$fileext] where fileext is the file extension but that does not seem to work. Both of these methods work function checkext() { fileext=$1 ls *.$fileext>/dev/null 2>&1 if [ $? -eq 0 ] then echo "We have $fileext files!" else echo "We don't have any $fileext files!" fi } and function checkext2() { extention=$1 filescheck=(`ls *.$1`) len=${#filescheck[*]} if [ $len -gt 0 ] then echo "We have $extention files!" else if [ $len -eq 0 ] then echo "We don't have any $extention files!" else echo "Error" fi fi } The second method is less tidy as any ls error is shown so I prefer method 1. Could people please suggest any improvements, more elegant solutions e.t.c

  Read the article

• The Zen of Python distils the guiding principles for Python into 20 aphorisms but lists only 19. What's the twentieth?

  - by Jeff Walden

  From PEP 20, The Zen of Python: Long time Pythoneer Tim Peters succinctly channels the BDFL's guiding principles for Python's design into 20 aphorisms, only 19 of which have been written down. What is this twentieth aphorism? Does it exist, or is the reference merely a rhetorical device to make the reader think? (One potential answer that occurs to me is that "You aren't going to need it" is the remaining aphorism. If that were the case, it would both exist and act to make the reader think, and it would be characteristically playful, thus fitting the list all the better. But web searches suggest this to be an extreme programming mantra, not intrinsically Pythonic wisdom, so I'm stumped.)

  Read the article

• How to set HTTP Headers from client class inherited from SoapHttpClientProtocol

  - by Alfred

  I'm using a class MyClass inherited from SoapHttpClientProtocol (auto-generated in my project by creating a WebReference from a .wsdl file, representing a service). Before calling a "WebMethod" of this service, I need to custom the http header of my request. I tried overloading the GetWebRequest() method of SoapHttpClientProtocol that way : public partial class MyClass: System.Web.Services.Protocols.SoapHttpClientProtocol{ protected override WebRequest GetWebRequest(Uri uri) { HttpWebRequest request = (HttpWebRequest)base.GetWebRequest(uri); request.Headers.Add("MyCustomHeader", "MyCustomHeaderValue"); return request; } } I was hoping that GetWebRequest was called in the constructor of MyClass, apparently it's not. Could someone help me ?

  Read the article

• get a process id from process name

  - by AJINKYA

  Hi i am trying to do a project using windows API in C language. The small part in my project is to get process ID of lsass.exe. i have tried the program below but it wont work. i have read about the CreateToolhelp32Snapshot, Process32First, Process32Next functions can anyone help me explaining how to use them in the code. So please help me. i am a beginner to windows API so i will appreciate it if anyone can suggest me an good ebook to refer.

  Read the article

• jQuery.load() Retrieving partial page content causes duplicate ID in DOM

  - by Warren Buckley

  Hello all, I currently have a JS function that allows me to load partial content from another page into the current page using jQuery.load() However I noticed when using this that I get a duplicate ID in the DOM (when inspecting with FireBug) This function is used in conjuction with a Flash Building viewe so it does not contain any code to retrieve the URL from the anchor tag. function displayApartment(apartmentID) { $("#apartmentInfo").load(siteURL + apartmentID + ".aspx #apartmentInfo", function () { //re-do links loaded in $("a.gallery").colorbox({ opacity: "0.5" }); }); } The code above works just fine in retrieving the content, however it just bugs me that when inspecting with firebug I get something like this. <div id="apartmentInfo"> <div id="apartmentInfo"> <!-- Remote HTML here..... --> </div> </div> Can anyone please suggest anything on how to remove the duplicate div? Thanks, Warren

  Read the article

• Computing MD5SUM of large files in C#

  - by spkhaira

  I am using following code to compute MD5SUM of a file - byte[] b = System.IO.File.ReadAllBytes(file); string sum = BitConverter.ToString(new MD5CryptoServiceProvider().ComputeHash(b)); This works fine normally, but if I encounter a large file (~1GB) - e.g. an iso image or a DVD VOB file - I get an Out of Memory exception. Though, I am able to compute the MD5SUM in cygwin for the same file in about 10secs. Please suggest how can I get this to work for big files in my program. Thanks

  Read the article

• Install mod_jk with Apache 2.2

  - by peter

  I have downloaded mod_jk-1.2.28-httpd-2.2.X.so for Apache 2.2 running on CentOS, and set up as per http://tomcat.apache.org/connectors-doc/webserver_howto/apache.html. When I try to start httpd it fails with the following error: "Starting httpd: httpd: Syntax error on line 993 of /etc/httpd/conf/httpd.conf: Syntax error on line 2 of /opt/apache-tomcat-6.0.26/conf/jk/mod_jk.conf-auto: Cannot load /etc/httpd/modules/mod_jk-1.2.28-httpd-2.2.X.so into server: /etc/httpd/modules/mod_jk-1.2.28-httpd-2.2.X.so: wrong ELF class: ELFCLASS32" Does that mean that mod_jk-1.2.28-httpd-2.2.X.so has not been properly compiled?. What can I do about that? Thanks Peter

  Read the article

• Bean is not instantiating while using hibernate interceptor

  - by amit sharma

  I am using hibernate interceptor with spring framework,but when i pass a bean reference of DAO class its not instantiating the bean. My interceptor class has: private IMyService myService; // and getters and setters while application-context.xml having entries: <bean id="sessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="entityInterceptor" ref="logInterceptor"></property> </bean> <bean name="logInterceptor" class="com.amit.project.Utility.TableLogInterceptor" > <property name="myService" ref="myService"/> </bean> <bean name="myService" class="com.amit.project.service.impl.MyService"> But my bean is not instantiating in class, showing null. entityInterceptor is not allowing to do that or anything else? plz suggest a way if anybody knows.

  Read the article

• Career Advice for a Bright Future [closed]

  - by HARSHITH

  I've completed my 12th . Now i am in a big dilemma . Coming to engineering , there are a lot of branches to choose. My elders and mentors suggested me to go for cse . But in this scenario of global meltdown , the cse boom had crushed down drastically . Are there chances for its regrowth . Please reply me with your valuable suggestions so that i can shape my future in a better way . Would you also suggest any other course for me?

  Read the article

• Studying MySQL, SQLite source code to learn about RDBMS implementation

  - by Yang

  I know implementing database is a huge topic, but I want to have a basic understanding of how database systems work (e.g. memory management, binary tree, transaction, sql parsing, multi-threading, partitions, etc) by investigating the source code of the database. Since there are a few already proven very robust open source databases like mysql, sqlite and so on. However, the code are very complicated and I have no clue where to start. Also I find that the old school database textbooks are only explaining the theory, not the implementation details. Can anyone suggest how I should get started and if there are any books that emphasis on the technology and techniques of building dbms used in modern database industry?

  Read the article

• Where/what is the specification for odata.service meta tag?

  - by Sam Saffron

  I would like to add some tags to our web app to enable auto-discovery of our odata feeds. So for example Nerd Dinner has the following tag: <link rel="odata.service" title="NerdDinner.com OData Service" href="/Services/OData.svc" /><link rel="odata.feed" title="NerdDinner.com OData Service - Dinners" href="/Services/OData.svc/Dinners" /> The trouble is that I have 4 different feeds and am unclear if I am allowed to add multiple link rel="odata.service" to the document. Where is the specification for this meta tag? (follow on question, are there any apps that take advantage of this tag that I can use to test out behavior)

  Read the article

• Making only the outer vector in vector<vector<int>> fixed

  - by Dennis Ritchie

  I want to create a vector<vector<int>> where the outer vector is fixed (always containing the same vectors), but the inner vectors can be changed. For example: int n = 2; //decided at runtime assert(n>0); vector<vector<int>> outer(n); //outer vector contains n empty vectors outer.push_back(vector<int>()); //modifying outer vector - this should be error auto outer_it = outer.begin(); (*outer_it).push_back(3); //modifying inner vector. should work (which it does). I tried doing simply const vector<vector<int>>, but that makes even the inner vectors const. Is my only option to create my own custom FixedVectors class, or are there better ways out there to do this?

  Read the article

• Using TextboxList events and callbacks

  - by Wraith

  Has anyone gotten callbacks working with Guillermo Rauch's TextboxList Autocomplete? I've tried multiple ways to bind and multiple events (e.g. hover) - nothing seems to register. $('#entSearch').textboxlist({unique: true, plugins: { autocomplete: { minLength: 3, queryRemote: true, placeholder: false, remote: { url: "{{=URL(r=request, f='call/json/suggest')}}", extraParams: {type: "", guid: ""} } } }, onHover: function(token) { alert('hover 1'); } }); $('#entSearch').hover(function() { alert('hover 2'); }); $('#entSearch').bind('hover', function() { alert('hover 3'); });

  Read the article

• String search and write into file in jython

  - by kdev

  hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

  Read the article

• javascript to print all tables and individual tables

  - by LiveEn

  I am retrieving values from a database and displaying it a table using php. Each table is stored inside a div tag. <div id="print"> table content 1 </div> <div id="print"> table content 2 </div> .................. Can some one please suggest a javascript where i can get a separate link/ button that will print all the tables and a link on all table to print each individual table. I used several javascripts and jquery plug ins but couldn't get my job done. any help will be appreciated

  Read the article

• using a "temporary files" folder in python

  - by zubin71

  I recently wrote a script which queries PyPI and downloads a package; however, the package gets downloaded to a user defined folder. I`d like to modify the script in such a way that my downloaded files go into a temporary folder, if the folder is not specified. The temporary-files folder in *nix machines is "/tmp" ; would there be any Python method I could use to find out the temporary-files folder in a particular machine? If not, could someone suggest an alternative to this problem?

  Read the article

• Wireframe mock-up software

  - by Dave Jarvis

  Requirements Looking for wireframe mock-up software for web apps with the following constraints: Desktop application (supports Linux) (can be online) Export all pages to separate image files (PNG or SVG preferred) Template for all pages Drag and drop standard HTML widgets for <forms> Tabbed panels (that allow content on the different tabs) Shuttle controls Saves in an XML format (XSLT could convert to HTML) Widget alignment and resizing (relative to other widgets) Under $100.00 USD Examples That come close: Cacoo - Not a desktop application; does not have a true tabbed panel widget Pencil - Export feature has serious bugs (missing text); no template? Balsamiq - Installation proved cantankerous on Linux (due to Adobe AIR) Mockingbird - No shuttle controls; no auto-resize of widgets Pencil & paper - Not a good look for a formal document presented to clients Any others that meet the requirements?

  Read the article

• Increase columns width in Silverlight DataGrid to fill whole DG width

  - by Henrik P. Hessel

  Hello, I have a DataGrid Control which is bound to a SQL Table. The XAML Code is: <data:DataGrid x:Name="dg_sql_data" Grid.Row="1" Visibility="Collapsed" Height="auto" Margin="0,5,5,5" AutoGenerateColumns="false" AlternatingRowBackground="Aqua" Opacity="80" > <data:DataGrid.Columns> <data:DataGridTextColumn Header="Latitude" Binding="{Binding lat}" /> <data:DataGridTextColumn Header="Longitude" Binding="{Binding long}" /> <data:DataGridTextColumn Header="Time" Binding="{Binding time}" /> </data:DataGrid.Columns> </data:DataGrid> Is it possible increase the single columns sizes to fill out the complete width of the datagrid? thx!, rAyt Edit: Columns with "*" as width are coming with the Silverlight SDK 4.

  Read the article

• What URL scheme would be better for "nested" resources in a RESTful application?

  - by Luke404

  Let's say we want a RESTful web service to manage some logically nested resources, where each instance of resource 'B' is logically contained by an instance of resource 'A'. The first example that comes to mind, working as a sysadmin, is email accounts and their domains: [email protected] [email protected] [email protected] ... What URL scheme would you suggest? At first I'd try: /domain/[domainname] /domain/[domainname]/account/[accountname] is that in line with RESTful principles? or should I go with something like: /domain/[domainname] /account/[account@domainname]/ or anything else?

  Read the article

• SQL query optimization

  - by nvtthang

  I have a problem with my SQL query that take time to get all records from database. Any body help me. Below is a sample of database: order(order_id, order_nm) customer(customer_id, customer_nm) orderDetail(orderDetail_id, order_id, orderDate, customer_id, Comment) I want to get latest customer and order detail information. Here is may solution: I've created a function that GetLatestOrderByCustomer(CusID) to get lastest Customer information. CREATE FUNCTION [dbo].[GetLatestOrderByCustomer] ( @cus_id int ) RETURNS varchar(255) AS BEGIN DECLARE @ResultVar varchar(255) SELECT @ResultVar = tmp.comment FROM ( SELECT TOP 1 orderDate, comment FROM orderDetail WHERE orderDetail.customer_id = @cust_id ) tmp -- Return the result of the function RETURN @ResultVar END Below is my SQL query SELECT customer.customer_id , customer.customer_nm , dbo.GetLatestOrderByCustomer(customer.customer_id) FROM Customer LEFT JOIN orderDetail ON orderDetail.customer_id = customer.customer_id It's take time to run the function. Could anybody suggest me any solutions to make it better? Thanks in advance.

  Read the article

• Thrift and .NET - Is this is right combination?

  - by Vadi

  I've been evaluating various technologies for a Social Networking project. The Thrift kind of interested me to evaluate. The advantage I see using Thrift is I can even come with C++ services when the computation in any such business is huge and may not fits with .NET etc., Please suggest your comments. My Questions: Is the open-sourced one is production-ready? Is it the right stack for services layer to choose when the application (GUI) is primarily gets developed in ASP.NET and DB is SQL Server? Is there any other caveats

  Read the article

< Previous Page | 294 295 296 297 298 299 300 301 302 303 304 305  | Next Page >