Search Results

Search found 28928 results on 1158 pages for 'open collar'.

Page 311/1158 | < Previous Page | 307 308 309 310 311 312 313 314 315 316 317 318  | Next Page >

  • Have Button re-appear immediately after clicking button in ListView row

    - by Soeren
    I have 4 buttons on a page. Each button opens a modal window and let’s the user input data in a form. When the user hits the save button in the modal, a ListView appears on the page with the submitted data. The button the user clicked to open the modal window is set to visible=false, so it’s gone when the row is added to the ListView. Now there are 3 buttons and the same goes for those; when the user hits a button, a modal appears, and when the modal form is submitted, the button disappears and a row is added to the ListView. In the ListView row, there is a delete button. When this button is clicked, the row is deleted and the button that was initially clicked to add this row (and open the modal), SHOULD reappear, but it doesn’t. The row disappears, but I have to refresh the page before the button comes back. There is a ScriptManager on the masterpage, so I guess this is an AJAX partial refresh issue. I tried adding different events, but I can’t find the one that fires at the right time. I use an ObjectDataSource to fill the ListView, and the data comes from a database, wrapped in a business object. This code loads a business object in a List< and checks if the user inserted an item of a specific type. If he did, the button he used to open the modal is hidden. This works fine (maybe not the most elegant) _goals = GoalManager.GetGoalsByUser(UserID); if (_goals != null) { foreach (Goal _goalinlist in _goals) { if (_goalinlist.GoalType == 1) { Button1.Visible = false; goalid1 = true; } if (_goalinlist.GoalType == 2) { Button2.Visible = false; goalid2 = true; } if (_goalinlist.GoalType == 3) { Button3.Visible = false; goalid3 = true; } if (_goalinlist.GoalType == 4) { Button4.Visible = false; goalid4 = true; } } } As you can see, I tried setting a boolean, and then check it when the page is re-loaded. But the problem (I guess) is that the whole page isn't refreshed when the delete button is clicked in the ListView. This is the delete button in the ListView: <asp:ImageButton ID="ImageButton2" runat="server" CommandName="Delete" CausesValidation="false" ToolTip="Delete" CommandArgument='<%#Eval("GoalID")%>' ImageUrl="delete.gif" OnClientClick="return confirm('Delete this post?');" CssClass="button"/> I guess the question is, how do I make the button re-appear right after the ListView button is clicked?

    Read the article

  • Problem in Rail Casts Episode 190

    - by Gautam
    Hello, This is the code I have written require 'rubygems' require 'nokogiri' require 'open-uri' url = "http://timesofindia.indiatimes.com/rssfeeds/-2128838597.cms" doc = Nokogiri::HTML(open(url)) puts doc.at_css("title").text and I am getting this output. I have installed Nokogiri. I use Windows 7 C:\Ruby>ruby hello.rb C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/nokogiri.rb:1:in `require': 127: The specified procedure could not be found. - Init_nokogiri (LoadError) C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/1.9/nokogiri.so from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/nokogiri.rb:1:in `<top (required)>' from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri.rb:13:in `require' from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri.rb:13:in `<top (required)>' from hello.rb:2:in `require' from hello.rb:2:in `<main>'

    Read the article

  • Python (Twisted) - reading from fifo and sending read data to multiple protocols

    - by SpankMe
    Hi, Im trying to write some kind of multi protocol bot (jabber/irc) that would read messages from fifo file (one liners mostly) and then send them to irc channel and jabber contacts. So far, I managed to create two factories to connect to jabber and irc, and they seem to be working. However, I've problem with reading the fifo file - I have no idea how to read it in a loop (open file, read line, close file, jump to open file and so on) outside of reactor loop to get the data I need to send, and then get that data to reactor loop for sending in both protocols. I've been looking for information on how to do it in best way, but Im totally lost in the dark. Any suggestion/help would be highly appreciated. Thanks in advance!

    Read the article

  • How to configure a session timeout for Grails application?

    - by curd0
    In one of controllers in my Grails application I'm preserving a parameter value in a session variable like this: session.myVariable = params.myValue After that, I can access the saved value from different controllers/GSP-pages as long as I actively use the app. However, if I don't use my app for a while, even though my browser window is still open, the session variable looses it's value. Does this happens because the session expires? I was under impression that a session lives until the browser window is still open, but apparently I was wrong. What should I do to ensure all session variables I define in my Grails app don't expire until the browser is closed? Is there any way to set session timeout manually? Thank you in advance for your answers!

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

    - by ijjo
    i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • Why isn't my assets folder being installed on emulator?

    - by Brad Hein
    Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • Python urllib.urlopen IOError

    - by Michael
    So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

    Read the article

  • nested for loop

    - by Gary
    Hello, Just learning Python and trying to do a nested for loop. What I'd like to do in the end is place a bunch of email addresses in a file and have this script find the info, like the sending IP of mail ID. For now i'm testing it on my /var/log/auth.log file Here is my code so far: #!/usr/bin/python # this section puts emails from file(SpamEmail) in to a array(array) in_file = open("testFile", "r") array = in_file.readlines() in_file.close() # this section opens and reads the target file, in this case 'auth.log' log = open("/var/log/auth.log", "r") auth = log.readlines() for email in array: print "Searching for " +email, for line in auth: if line.find(email) > -1: about = line.split() print about[0], print Inside 'testfile' I have the word 'disconnect' cause I know it's in the auth.log file. It just doesn't find the word 'disconnect'. In the line of "if line.find(email) -1:" i can replace email and put "disconnect" the scripts finds it fine. Any idea? Thanks in advance. Gary

    Read the article

  • How to check if a generic type definition inherits from another generic type definition

    - by Anne
    I'm trying to check whether an open generic type definition implements some open generic interface. Look at the sample below: public interface IService<T> { } public class ServiceImpl<T> : IService<T> { } private static bool OpenGenericTypeImplementsOpenGenericInterface( Type derivedType, Type interfaceType) { return derivedType.GetInterfaces().Contains(interfaceType); } [TestMethod] public void Verify() { Type openGenericImplementation = typeof(ServiceImpl<>); Type expectedInterfaceType = typeof(IService<>); bool implDoesImplementInterface = OpenGenericTypeImplementsOpenGenericInterface( openGenericImplementation, expectedInterfaceType); // This assert fails. Why? Assert.IsTrue(implDoesImplementInterface); } I found out that the returned type from the Type.GetInterfaces() method does not match the type returned from typeof(IService<>). I can't figure out why that is and how to correctly validate whether some generic type definition inherits or implements some other generic type definition. What's going on here and how do I solve fix this problem?

    Read the article

  • Getting "Object is read only" error when setting ClientCredentials in WCF

    - by Paul Mrozowski
    I have a proxy object generated by Visual Studio (client side) named ServerClient. I am attempting to set ClientCredentials.UserName.UserName/Password before opening up a new connection using this code: InstanceContext context = new InstanceContext(this); m_client = new ServerClient(context); m_client.ClientCredentials.UserName.UserName = "Sample"; As soon as the code hits the UserName line it fails with an "Object is read-only" error. I know this can happen if the connection is already open or faulted, but at this point I haven't called context.Open() yet. I have configured the Bindings (which uses netTcpBinding) to use Message as it's security mode, and MessageClientCredentialType is set to UserName. Any ideas?

    Read the article

  • NETWORK_ERROR: XMLHttpRequest Exception 101

    - by pawan Mangal
    I am getting this Error NETWORK_ERROR: XMLHttpRequest Exception 101 when trying to get XML content from one site. Here is my code var xmlhttp; if(window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } if (xmlhttp==null) { alert ("Your browser does not support XMLHTTP!"); return; } xmlhttp.onReadyStateChange=function() { if(xmlhttp.readyState==4) { var value =xmlhttp.responseXML; alert(value); } } xmlhttp.open("GET",url,false); xmlhttp.send(); //alert(xmlhttp.responseXML); } xmlhttp.open("GET",url,false); xmlhttp.send(null); Does any one have a solution?

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • How do you fix an SVN 409 Conflict Error

    - by NerdStarGamer
    I used to use SVN 1.4 on OS X Leopard and everything was fine. A couple of weeks ago I installed a fresh copy of OS X 10.6. The version of SVN that comes with Snow Leopard is 1.6.5. I went ahead and built my own copy with 1.6.6. I'm using the built in apache server and just hosting repositories locally. Everything appeared to work fine until I actually tried to commit something. Everytime I try to commit a change, I get the following message: Transmitting file data .svn: Commit failed (details follow): svn: MERGE of '/svn/svn2': 409 Conflict (http://localhost) This happens with my old repositories, so I created a couple of new ones. Same deal. I also tried using the 1.6.5 version that comes with the system...same. Finally, I tried upgrading to the latest stable SVN (1.6.9) and still got the same problem. The Apache error logs the following for each failed commit: [Mon Mar 29 19:53:10 2010] [error] [client ::1] Could not MERGE resource "/svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1" into "/svn/svn2". [409, #0] [Mon Mar 29 19:53:10 2010] [error] [client ::1] An error occurred while committing the transaction. [409, #2] [Mon Mar 29 19:53:10 2010] [error] [client ::1] Can't open directory '/usr/local/svn/svn2/db/transactions/5-6.txn/\xeb\xa9\x0f\x1f': No such file or directory [409, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Could not DELETE /svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1. [500, #0] [Mon Mar 29 19:53:11 2010] [error] [client ::1] could not open transaction. [500, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Can't open file '/usr/local/svn/svn2/db/transactions/5-6.txn/props': No such file or directory [500, #2] And from the access log: ::1 - - [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 401 401 ::1 - user [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 200 188 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/vcc/default HTTP/1.1" 207 398 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/bln/6 HTTP/1.1" 207 449 ::1 - user [30/Mar/2010:13:02:20 -0400] "REPORT /svn/svn2/!svn/vcc/default HTTP/1.1" 200 1172 Curiously, the commit does actually commit the changes, but the working copy doesn't see that and everything gets screwy. I've tried to Google every variation I can think of for this problem, but the search results are pretty much useless. I'm not using TortoiseSVN or anything special and commits fail on a new repository, so I know it's not a problem with my old repos. Any help would be greatly appreciated.

    Read the article

  • Installing fonts

    - by Lazar
    I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

< Previous Page | 307 308 309 310 311 312 313 314 315 316 317 318  | Next Page >