Search Results

Search found 139102 results on 5565 pages for 'one time password'.

Page 313/5565 | < Previous Page | 309 310 311 312 313 314 315 316 317 318 319 320  | Next Page >

  • MySQL: select words as rows even som are "new line" separated in one field

    - by Tillebeck
    Hi I have a table with a field where words are written separated with new lines. So a select on this single field from to rows will output 3 lines for first row and 2 lines for second row: Row1 designationer nye kolonier mindre byer Row2 udsteder bopladser I would like to do a select that select all these lines as if they had been rows in the table like: SELECT do_the_split(field) FROM table so the result would be more like: Row1 designationer Row2 nye kolonier Row3 mindre byer Row4 udsteder Row5 bopladser is there any way to do this in MySQL? BR. Anders

    Read the article

  • One-Click Application Moving from WinForms to WPF

    - by Tyler
    I have a WinForms app that I recently re-wrote in WPF and I need to release to my end users. I'd like to be able to have the users go to the ClickOnce install point for the WPF application and have their WinForm application removed so they don't have both on their machine What's the best way (read: easiest for users) of accomplishing this? I have thought about creating an prereq command line app to detect the old version and uninstall, but would like to avoid having to write an something like that where it only get's run once.

    Read the article

  • Convert regular date and time to Julian date and vice versa

    - by zbz.lvlv
    I am currently working on a program that will calculate sunrise and sunset times. How do I convert yyyymmddhhmmss to Julian date? I need the date to be very precise. It'll great if there can be an example for such conversions. Calendar cNow = Calendar.getInstance(); Calendar cJan1 = Calendar.getInstance(); double julianJan1_2014_12_00_00 = 2456659; cJan1.set(2014, 0, 0, 12, 0); Date dJan1 = cJan1.getTime(); Date dNow = cNow.getTime(); long lJan1 = dJan1.getTime(); long lNow = dNow.getTime(); double diffDay = (lNow - lJan1) / 1000 / 60 / 60 / 24; double julianDate = diffDay + julianJan1_2014_12_00_00; The code I currently have.

    Read the article

  • Treeview does not refresh to show childnode moved from one parent node to another

    - by mike
    I am using the Windows Forms TreeView class which contains a set of TreeNodes. The TreeNodes can have child nodes. I have a root node with 2 sub nodes (Node1 and Node2) Node1 has 2 subnodes (child1 and child2) I have a function that will allow a user to select any node and move it to another node: TreeNode SelectNode = this.TreeView1.SelectedNode; TreeNode DestNode = SelectedNewNode(); //function to select a new node SelectedNode.Remove(); DestNode.Nodes.Add(SelectedNode); this.TreeView1.Refresh(); When this executes, the current selected node (child2) is removed from its current parent (Node1) and added to Node2. However, the Refresh() method of the TreeView control does not show that child2 is under Node2. If I debug it and look at the Nodes collection in the TreeView i do see that child2 is under Node2. Can anyone tell me why the Refresh() method does not redraw the new parent to child mapping? Is there a way to tell the TreeView to redraw with the new mappings?

    Read the article

  • Many RewriteBase in one .htaccess file?

    - by Martti Laine
    Hello I have a domain and a wordpress-blog on same server. Now I have a problem (surprise). The wordpress is located on /httpdocs/blog/ and domain is pointing to /httpdocs/ and I'm trying to redirect it to /httpdocs/domain/. But, obvisiously, I have permalinks in Wordpress. Here's my current .htaccess: RewriteEngine On RewriteBase /blog/ RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule . /blog/index.php [L] RewriteBase / RewriteCond %{HTTP_HOST} domain.com RewriteCond %{REQUEST_URI} !^/domain RewriteCond %{REQUEST_URI} !^/cgi-bin RewriteRule ^(.*)$ domain/$1 [L] But as you already propably assumed, this doesn't work. Wordpress' permalinks affects to /domain/ also, so my images and other urls go wrong. Any advice? Is it possible to use RewriteBase like this? Martti Laine

    Read the article

  • How to move child element from one parent to another using jQuery

    - by Kapslok
    I am using the jQuery DataTables plugin. I would like to move the search box (.dataTables_filter) and number of records to display dropdown (.dataTables_length) from their parent element (.dataTables_wrapper) to another div on my page without losing any registered javascript behavior. For instance the search box has a function attached to the 'keyup' event and I want to keep that intact. The DOM looks like this: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> This is what I would like the DOM to look like after the move: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> I've been looking at the .append(), .appendTo(), .prepend() and .prependTo() functions but haven't had any luck with these in practice. I've also looked at the .parent() and .parents() functions, but can't seem to code a workable solution. I have also considered changing the CSS so that the elements are absolutely positioned - but to be frank the page is setup with fluid elements all over, and I really want these elements to be floated in their new parents. Any help with this is much appreciated.

    Read the article

  • How can I overlay one image onto another?

    - by Edward Tanguay
    I would like to display an image composed of two images. I want image rectangle.png to show with image sticker.png on top of it with its left-hand corner at pixel 10, 10. Here is as far as I got, but how do I combine the images? Image image = new Image(); image.Source = new BitmapImage(new Uri(@"c:\test\rectangle.png")); image.Stretch = Stretch.None; image.HorizontalAlignment = HorizontalAlignment.Left; Image imageSticker = new Image(); imageSticker.Source = new BitmapImage(new Uri(@"c:\test\sticker.png")); image.OverlayImage(imageSticker, 10, 10); //how to do this? TheContent.Content = image;

    Read the article

  • HTML: Place an image on top of another one

    - by Dimitris Baltas
    Inside a div, there is a picture that should have 10px margin in all directions from the DIV's border. On the left bottom corner of the picture there is an about-image. The picture is only displayed when its loaded in the DOM through jquery. The problem is that the existence of the about-image dislocates the picture downwards as many pixels as the height of the about-image. I am looking for the cleanest possible alternative to keep the picture inside the DIV and still display the about-image on top of it. Setting the picture as background will not work since i need the picture to load at once. Any improvement on the #about css would be greatly appreciated. Below is a full html page that reproduces the issue <html> <head> <title>Troubleshooting :: align the main picture inside the DIV</title> <style type="text/css"> html, body { background-color: #000000; } #about { z-index:2; position:relative; top:82%; left:3%; } #pic { width:100%; height:96%; } #main-content-image { height:100%; margin-right:10px; margin-left:10px; margin-top:10px; margin-bottom:10px; } #main-content { height:490px; border-width: 1px; border-style: solid; border-color: #777777; } #main-content-image.loading { background: url(http://farros.gr/images/ajax-loader2.gif) no-repeat center center; } a { text-decoration: none; text-decoration: none; color: #868686; outline:none; } .hide { display:none; } </style> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script> <script type="text/javascript"> <!-- $(document).ready(function(){ $(function () { var img = new Image(); $(img).load(function () { $(this).hide(); $(this).width('100%'); $(this).height('96%'); $('#main-content-image').removeClass('loading').append(this); $(this).fadeIn(); }).error(function () { // notify the user that the image could not be loaded }).attr('src', 'http://farros.gr/images/bg.jpg'); }); }); </script> </head> <body> <div id="main-content"> <div id="main-content-image" class="loading"> <a href="#"><img id="about" src='http://farros.gr/images/about.png' alt='Haris Farros'/></a> </div> </div> </body> </html>

    Read the article

  • prepend to a file one liner shell?

    - by elmarco
    This is probably a complex solution. I am looking for a simple operator like "", but for prepending. I am afraid it does not exist. I'll have to do something like mv $F tmp cat header tmp $F Anything smarter? (I am not fond of tmp files)

    Read the article

  • Multiple Windows Forms on one application

    - by Shukhrat Raimov
    I have two windows forms, first is initial and second is invoked when button on the first is pressed. It's two different windows, with different tasks. I programmed for both MVP pattern. But in the Main() I have this: static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); ViewFirst viewFirst = new ViewFirst();//First Form PresenterFirst presenterFirst = new PresenterFirst(viewFirst); Application.Run(viewFirst); } And I Have Second Windows Form: ViewSecond viewSecond = new ViewSecond();//Second Form PresenterSecond presenterSecond = new PresenterSecond(viewSecond); I want to run it in this app as soon as the button on the first is clicked. How could I do this? My button on the first WF is: private void history_button_Click(object sender, EventArgs e) { ViewSecond db = new ViewSecond();//second Form where I have sepparate WF. db.Show(); }

    Read the article

  • jquery function to convert datetime, split date time "2010-10-18 10:06" to return "18/10/2010" and

    - by Cesar Lopez
    Hi I was wondering if there is any jquery function around which can take this dateTime "2010-10-18 10:06" and convert and split it returning "2010/10/18" and "10:06". It would be also nice if the same function could either receive "2010-10-18 10:06" or "2010-10-18" only and return as mentioned above, or different formats besides "2010/10/18" like 18-10-2010" or and 18th of October 2010, giving the option but not that important, just curious about jQuery power dealing with dates. Thanks.

    Read the article

  • ArrayAdapter need to be clear even i am creating a new one

    - by Roi
    Hello I'm having problems understanding how the ArrayAdapter works. My code is working but I dont know how.(http://amy-mac.com/images/2013/code_meme.jpg) I have my activity, inside it i have 2 private classes.: public class MainActivity extends Activity { ... private void SomePrivateMethod(){ autoCompleteTextView.setAdapter(new ArrayAdapter<String>(this, android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList("")))); autoCompleteTextView.addTextChangedListener(new MyTextWatcher()); } ... private class MyTextWatcher implements TextWatcher { ... } private class SearchAddressTask extends AsyncTask<String, Void, String[]> { ... } } Now inside my textwatcher class i call the search address task: @Override public void afterTextChanged(Editable s) { new SearchAddressTask().execute(s.toString()); } So far so good. In my SearchAddressTask I do some stuff on doInBackground() that returns the right array. On the onPostExecute() method i try to just modify the AutoCompleteTextView adapter to add the values from the array obtained in doInBackground() but the adapter cannot be modified: NOT WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); adapter.addAll(new ArrayList<String>(Arrays.asList(addressArray))); adapter.notifyDataSetChanged(); Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // Returns true!!??! } I dont get why this is not working. Even if i run it on UI Thread... I kept investigating, if i recreate the arrayAdapter, is working in the UI (Showing the suggestions), but i still need to clear the old adapter: WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); autoCompleteDestination.setAdapter(new ArrayAdapter<String>(NewDestinationActivity.this,android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList(addressArray)))); //adapter.notifyDataSetChanged(); // no needed Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // keeps returning true!!??! } So my question is, what is really happening with this ArrayAdapter? why I cannot modify it in my onPostExecute()? Why is working in the UI if i am recreating the adapter? and why i need to clear the old adapter then? I dont know there are so many questions that I need some help in here!! Thanks!!

    Read the article

  • MyEclipse builds workspace on saving JSP page every time

    - by Tahir Akram
    Whenever I save a jsp page, MyEclipse IDE start building the workspace. It should build when I change in any class file. Or if there are classes that not compiled. But why it start building whole workspace when I change in a JSP file. I am stuck on it. Please advise me on this problem. I am using MyEclipse 5.5 over Eclipse 3.2 Thanks.

    Read the article

  • Worker process reached its allowed processing time

    - by Confused
    We are experiencing this issue approximately once a month. It is very hard to pinpoint the cause so any help would be appreciated. This causes the App pool to stop and brings the site down. We have gone through all log files and have concluded nothing. We are using the 2.0.3 version on IIS 6.

    Read the article

  • Replace string in one file with contents of a second file

    - by jag7720
    I have two files: fileA: date >> /root/kvno.out kvno serverXXX\$ >> /root/kvno.out fileB: foobar I need to create a new file, fileC, with the same contents as fileA, except with the string XXX being replaced with the contents of fileB: date >> /root/kvno.out kvno serverfoobar\$ >> /root/kvno.out I'd like to do this using sed. I tried some of the examples I found but I only get the contents of fileB in fileC.

    Read the article

  • Consolidate data from many different databases into one with minimum latency

    - by NTDLS
    I have 12 databases totaling roughly 1.0TB, each on a different physical server running SQL 2005 Enterprise - all with the same exact schema. I need to offload this data into a separate single database so that we can use for other purposes (reporting, web services, ect) with a maximum of 1 hour latency. It should also be noted that these servers are all in the same rack, connected by gigabit connections and that the inserts to the databases are minimal (Avg. 2500 records/hour). The current method is very flakey: The data is currently being replicated (SQL Server Transactional Replication) from each of the 12 servers to a database on another server (yes, 12 different employee tables from 12 different servers into a single employee table on a different server). Every table has a primary key and the rows are unique across all tables (there is a FacilityID in each table). What are my options, these has to be a simple way to do this.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Add button to Internet Explorer toolbar during run time

    - by karikari
    I am currently create a simple additional button to my Internet Explorer 7, toolbar. The button works. I am using Visual C++. But now, I would like to create a to create a button during my Internet Explorer is running. Means, on certain condition, my program (a dll registered with regsvr32) will add a button to the toolbar. and after certain condition, the button also can be disappeared. How can I achieve this?

    Read the article

  • Play and Stop in One button

    - by Ardi
    i'm newbie, i'm tried to make play audio play and stop for 1 button only, but i'm in trouble now. if i touch a button when audio is playing, it doesn't stop, even playing audio again and make a double sound. here's my code public class ProjectisengActivity extends Activity{ ImageButton mainkan; MediaPlayer mp; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.test2); mainkan=(ImageButton)findViewById(R.id.imageButton1); mainkan.setOnClickListener(new OnClickListener(){ @Override public void onClick(View v){ go(); } }); public void go(){ mp=MediaPlayer.create(ProjectisengActivity.this, R.raw.test); if(mp.isPlaying()){ mp.stop(); try { mp.prepare(); } catch (IllegalStateException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } mp.seekTo(0); } else { mp.start(); } i'm create for android 3.0 (HoneyComb) thanks for help

    Read the article

< Previous Page | 309 310 311 312 313 314 315 316 317 318 319 320  | Next Page >