Search Results

Search found 21183 results on 848 pages for 'indexing service'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 317/848 | < Previous Page | 313 314 315 316 317 318 319 320 321 322 323 324  | Next Page >

  • Simple question in ClientLogin using python gdata library

    Hi friends, I have incorporated ClientLogin into my python application to retrieve contact list of the user , I like to know how to get the name of the user who has logged in.My code to get the names from the contact list of the user is as given below gd_client = gdata.contacts.service.ContactsService() gd_client.email = yemail gd_client.password = ypass gd_client.source = 'GoogleInc-ContactsPythonSample-1' gd_client.ProgrammaticLogin() query = gdata.contacts.service.ContactsQuery() query.max_results=150 feed = gd_client.GetContactsFeed(query.ToUri()) for i, entry in enumerate(feed.entry): #print '\n%s %s' % (ctr+i+1, entry.title.text) na=entry.title.text names.append(na) Please help me to know how to get the name of the user who has logged in Thanks ganesh

    Read the article

  • How to setup Solr on a live VPS?

    - by user342960
    I follow the instruction on http://lucene.apache.org/solr/tutorial.html and I can setup Solr on my PC. Now when I come to my VPS I cannot overcome the step: $ java -jar start.jar Afer running that command, search service is available at http: //x.x.x.x:8983/solr/select . But, Whenever I close the SSH client, the service on http: //x.x.x.x:8983/solr/select is also closed. So I can't search any more. What should I do? Thanks for any help.

    Read the article

  • WCF client throws SocketException if I'm also running a Fiddler

    - by user437291
    Hi I'm trying to use Fiddler2 to inspect SOAP messages exchanged between WCF client and WCF service ( both client and service are running on same machine). But problem is, whenever I use Fiddler2, WCF client reports "EndpointnotFoundException:There was no endpoint listening at http://a-PC:8100 that could accept the message à System.Net.WebException: Unable to connect to the remote server - à System.Net.Sockets-SocketException:An attempt was made to access a socket in a way forbidden by its access permissions 127.0.0.1:8888" Thank you

    Read the article

  • How to find about structure of bitmap and JPEG files?

    - by Sorush Rabiee
    I'm trying to write a very simple image processing program for fun and practice. I was using System.Drawing. ... .Bitmap class to handle images and edit their data. but now I want to write my own class of Bitmap object implementation and want to know how bmp files (and other common bitmap formats) and their meta-data (indexing, color system & etc) are stored in files, and how to read and write them directly?

    Read the article

  • Reliable session faulting for unknown reason

    - by Scarfman007
    I am trying to achieve the following - one client-side proxy instance (kept open) accessed by multiple threads using a reliable session. What I have managed so far is to have either A) a reliable session with a client-side proxy which is created and disposed per call or B) what I aim for, but without a reliable session. When I enable reliable sessions on my binding however, the following behaviour is exhibited: Client-side Upon application startup everything appears to work fine until roughly 18 messages in to the WCF session. I firstly get the proxy.InnerChannel.Faulted event raised, then an exception is caught at the point where I am calling the method on the proxy. The exception is a System.TimeoutException, with message: "The request channel timed out while waiting for a reply after 00:00:59.9062512. Increase the timeout value passed to the call to Request or increase the SendTimeout value on the Binding. The time allotted to this operation may have been a portion of a longer timeout." The inner exception has a similar message: "The request operation did not complete within the allotted timeout of 00:01:00. The time allotted to this operation may have been a portion of a longer timeout." With the method at the top of the inner stack trace being: System.ServiceModel.Channels.ReliableRequestSessionChannel.SyncRequest.WaitForReply(TimeSpan timeout) I then call proxy.Close followed by proxy.Abort (catching and ignoring exceptions). If I utilize the default settings (i.e. have simply <reliableSession/>), then calling proxy. Close results in another System.Timeout exception (although this time the allotted timeout is 00:00:00), however if I override the defaults as specified above no exception is thrown. Service-side Utilizing WCF tracing I get a System.ServiceModel.CommunicationException, with message: "The sequence has been terminated by the remote endpoint. The session has stopped waiting for a particular reply. Because of this the reliable session cannot continue. The reliable session was faulted." And a stack trace ending at: System.ServiceModel.AsyncResult.End[TAsyncResult](IAsyncResult result) When remotely attaching to the server I get the same message, which occurs when code execution steps over the return statement of my service in the service call which causes the error. The puzzling thing to me is that the service is stable and runs with options A) or B) as decribed at the beginning of my post, and occurs after a varying number of messages (around 18). The former fact points to there being nothing wrong with the code (indeed I have checked that no exceptions are thrown), and the latter just serves to confuse me and is why I modified the settings on the reliable session binding. I am quite stuck on this. Can anyone suggest why the reliable session would fault in such a way?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Mocking digest authentication in RestEasy

    - by Ralph
    I am using RestEasy to develop a REST server and using the mock dispatcher (org.jboss.resteasy.mockMockDispatcherFactory) for testing the service in my unit tests. My service requires digest authentication and I would to make that part of my testing. Each of my services accepts a @Context SecurityContext securityContext parameter. Is there any way is inject a fake SecurityContext in the dispatcher so that I can test that my security methods function properly?

    Read the article

  • Custom Report Items in local reports

    - by IordanTanev
    Hi, i have read this article about custom report items(CRI) http://msdn.microsoft.com/en-us/magazine/cc188686.aspx The only problem is that CRI are only usable in reporting service and not in local reports. My question is it possible some how to use CRI in local reports( RDLC ). Also i am interested in which version of reporting service is this possible, if possible Best Regards, Iordan

    Read the article

  • developing browser extension for content filtering

    - by user272483
    i'm developing an application for content filtering. i'll use it as web service but my problem is that i hadn't developed any extension for firefox or ie before. i read some about firefox extensions and now i know a little about it. firstly can i use web service in a firefox/ie extension? if yes, can you give me a link of tutorial or sth like that? all suggestions are welcome. thx..

    Read the article

  • jQuery Mobile - how to force that page recreation - pagebeforecreate event

    - by NewUser
    I have a small jQuery mobile site. it's all single .html file it's has some edit functionality (view, edit, save) all works with ajax/json/web service Most of my pages are using data from web service, via AJAX & JSON, so I am using the following a lot: $(document).on( 'pagebeforecreate', '#monday', function() { // do some stuff on before create, load data with AJAX }); Now, how do I FORCE that page recreation (pagebeforecreate event) so the AJAX inside is run again (get the latest data from server)?

    Read the article

  • Send A DataSet via Sockets in .NET

    - by FinancialRadDeveloper
    I had written a Web Service to return a DataSet back to my ASP.Net site and this was working fine. However due to security issues and also the ability to get certain references installed, I have to move this to an App Server and so doing it as a Windows Service and communicating with the ASP.Net site now via sockets. Is there a way I can easily give the Website a serialized DataSet via Sockets from my App Server so I can read this in and then just carry on using the code I currently have to bind this to a GridView?

    Read the article

  • WCF wrapper COM object

    - by LarryR
    I have a third party COM component (they don't offer a .Net assy), that has the additional feature that it only works under x86 compile. I am trying to wrap this in a WCF service, but if I select x86, the service won't start (System.BadImageFormatException). Any workarounds for this ? Thanks Larry

    Read the article

  • Meassure website

    - by s0mmer
    Hi, I was wondering if it is possible to install or use any online service to measure your website's performance? I've seen many just checking the download speed of images, external files etc. But is it possible to meassure how long asp/php code takes to execute? I have a site running a bit slowly, and it would be very nice with some app/service guiding where to optimize.

    Read the article

  • C# - Sharing static data between multiple processes

    - by Murtaza Mandvi
    I have a WCF service (instantiated within a Console application on NetTCP), this service has static data (large volume) which gets instantiated on the load. I have multiple instances of this Console application running at once, and all of them are doing the same static data initialization , is there a way that I can have a single data source and share the data among processes so that each process does not have to consume large amount of memory?

    Read the article

  • Python ZSI : error while serializing an object ?

    - by KaluSingh Gabbar
    this is the code, I get error that it can not serialize reference (sumReq) sumReqClass = GED("http://www.some-service.com/sample", "getSumRequest").pyclass sumReq = sumReqClass() rq = GetSumSoapIn() sum._sumReqObj = sumReq rs=proxy.GetSum(rq, soapheaders=[credentials]) I get error : TypeError: bad usage, failed to serialize element reference (http://www.some-service.com/sample, getSumRequest), in: /SOAP-ENV:Body

    Read the article

  • In Google Glass, Menu Items are not shown after XE 17.2 Update, any Solutions?

    - by Amalan Dhananjayan
    This worked when the Glass in on XE12, I have opened the solution after about 2 Months and now with XE17 the menu items are not shown when tapped on the Live card, instead the live card is disappearing. I have updated the GDK, I have changed the code to support the latest GDK sneak peek version 2 changes according to this (https://developers.google.com/glass/release-notes#xe12) This is the code public class MenuActivity extends Activity { private static final String TAG = MenuActivity.class.getSimpleName(); private VisionService.VisionBinder mVisionService; private ServiceConnection mConnection = new ServiceConnection() { @Override public void onServiceConnected(ComponentName name, IBinder service) { if (service instanceof VisionService.VisionBinder) { mVisionService = (VisionService.VisionBinder) service; openOptionsMenu(); } // No need to keep the service bound. unbindService(this); } @Override public void onServiceDisconnected(ComponentName name) { } }; private boolean mResumed; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); bindService(new Intent(this, VisionService.class), mConnection, 0); } @Override protected void onResume() { super.onResume(); mResumed = true; openOptionsMenu(); } @Override protected void onPause() { super.onPause(); mResumed = false; } @Override public void openOptionsMenu() { if (mResumed && mConnection != null) { super.openOptionsMenu(); } } @Override public boolean onCreateOptionsMenu(Menu menu) { getMenuInflater().inflate(R.menu.menu, menu); return true; } @Override public boolean onOptionsItemSelected(MenuItem item) { int id = item.getItemId(); if (id == R.id.action_send) { mVisionService.requestWorkOrderCard(); finish(); return true; } else if (id == R.id.action_refresh) { mVisionService.requestTopWorkOrders(); finish(); return true; } else if (id == R.id.action_finish) { stopService(new Intent(this, VisionService.class)); finish(); return true; } else { return super.onOptionsItemSelected(item); } } @Override public void onOptionsMenuClosed(Menu menu) { super.onOptionsMenuClosed(menu); } } It would be great if any body could help on this. Thank You

    Read the article

  • SEO Help with Pages Indexed by Google

    - by Joe Majewski
    I'm working on optimizing my site for Google's search engine, and lately I've noticed that when doing a "site:www.joemajewski.com" query, I get results for pages that shouldn't be indexed at all. Let's take a look at this page, for example: http://www.joemajewski.com/wow/profile.php?id=3 I created my own CMS, and this is simply a breakdown of user id #3's statistics, which I noticed is indexed by Google, although it shouldn't be. I understand that it takes some time before Google's results reflect accurately on my site's content, but this has been improperly indexed for nearly six months now. Here are the precautions that I have taken: My robots.txt file has a line like this: Disallow: /wow/profile.php* When running the url through Google Webmaster Tools, it indicates that I did, indeed, correctly create the disallow command. It did state, however, that a page that doesn't get crawled may still get displayed in the search results if it's being linked to. Thus, I took one more precaution. In the source code I included the following meta data: <meta name="robots" content="noindex,follow" /> I am assuming that follow means to use the page when calculating PageRank, etc, and the noindex tells Google to not display the page in the search results. This page, profile.php, is used to take the $_GET['id'] and find the corresponding registered user. It displays a bit of information about that user, but is in no way relevant enough to warrant a display in the search results, so that is why I am trying to stop Google from indexing it. This is not the only page Google is indexing that I would like removed. I also have a WordPress blog, and there are many category pages, tag pages, and archive pages that I would like removed, and am doing the same procedures to attempt to remove them. Can someone explain how to get pages removed from Google's search results, and possibly some criteria that should help determine what types of pages that I don't want indexed. In terms of my WordPress blog, the only pages that I truly want indexed are my articles. Everything else I have tried to block, with little luck from Google. Can someone also explain why it's bad to have pages indexed that don't provide any new or relevant content, such as pages for WordPress tags or categories, which are clearly never going to receive traffic from Google. Thanks!

    Read the article

  • Key Event Handling in Windows Services C#

    - by Yakov
    Hi! I want to create a windows service that may log pressed keys into files. For handling global key events I use hooks, hooks works great for desktop apps. But it doesn't work for the services. Is it possible to develop a windows service with key event handling? Developing on C#... Thanks for your time.

    Read the article

  • Wcf inhereted models

    - by jack london
    [DataContract] Base { [DataMember] public int Id {get;set;} } [DataContract] A : Base { [DataMember] public string Value {get;set;} } [ServiceContract] interface IService { [OperationContract] void SetValue (Base base); } is there a way to use the service like the following style: new Service ().SetValue (new A ());

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 313 314 315 316 317 318 319 320 321 322 323 324  | Next Page >