Search Results

Search found 19115 results on 765 pages for 'region specific'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 322/765 | < Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >

  • How can I monitor the rendering time in a browser?

    - by adpd
    I work on an internal corporate system that has a web front-end as one of its interfaces. The web front-end is served up using Tomcat. How can I monitor the rendering time of specific pages in a browser (IE6)? I would like to be able to record the results in a log file (separate log file or the Tomcat access log).

    Read the article

  • Jetspeed 2.2 Nest or render one portlet inside another

    - by David Just
    I have a requirement to build an extensible wizard in a portlet. This wizard will list components that are installed and forward the user to a sub-wizard that is component specific. The requirement is that the components are to be developed by other people and dynamically plugged into this wizard (Jetspeed reboot is okay). I would like to be able to define the components as portlets themselves who's content is rendered into the primary portlet. Has anybody ever done something like this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • IE6 and IE7 Input padding CSS

    - by Podlsk
    I have input boxes with a height of 25 pixels. In Firefox, Safari and IE8 automatically vertically align the text of it in the middle correctly. However in IE6 and IE7 the text is aligned to the top. How may I resolve this? Adding padding-top increased the total height of the input as I have explicitly declared its height. I don't wish to use browser specific CSS. Thanks.

    Read the article

  • How do I tag files in a directory in a SVN repository with a global version number that will appear

    - by mithaldu
    I am working on a project that stores multiple versions in the same svn repo but in different directories. For ease of reference for the coders working on the project I'd like to be able to add a commented tag similarly to # $Revision: 144 $ However, instead of the file revision it should contain a simple version number like so: # $Version: 1.63 $ # $Version: 1.64 $ # $Version: 2.0 $ Is there a way to get subversion to do this automatically for a specific directory and all sub-directories as well as for any new files added to those?

    Read the article

  • Tomcat: Cache-Control

    - by Itay
    Jetty has a CacheControl parameter (can be specified webdefault.xml) that determines the caching behavior of clients (by affecting headers sent to clients). Does Tomcat has a similar option? In short, I want to turn off caching of all pages delivered by a tomcat server and/or by a specific webapp?

    Read the article

  • PHP codinh in real world

    - by user261002
    I know how to write program in PHP and implementation of MVC model. but I really want to practice coding like the coding in real world??? I was wondering is there any specific example or book which can show me the tricks or logic and the way professional programmers consider about coding???

    Read the article

  • Using Flex Builder with source control

    - by Dan Monego
    When setting up a source control repository for a Flex Builder workspace, what do you consider to be worth checking in? Do you exclude the workspace .metadata folder but keep the .project and other project specific files? Keep both? Throw away both? Is there a guideline you use to decide which is worth holding onto or do you do it out of practical experience?

    Read the article

  • Reverse engineering a bezier curve

    - by Martin
    Given a few sample points on a bézier curve, is it possible to work out the set of possible parameters of the curve? In my specific application there is a limited set of endpoints the curve may have, so I want to generate the set of possible curves, enumerate all of them and pick out all the ones which may end on a valid end point.

    Read the article

  • How to Keep to GPL Licence When Modifying a Script

    - by MagicAndi
    Hi, In answering my own question, I came across this GreaseMonkey script that automatically converts currency values on a webpage. I would like to modify the script for my specific case, and I want to know how I should modify the script MetaData block to acknowledge the script's original author and respect the (letter and spirit of the) GPL. Can anyone advise? Thanks, MagicAndi

    Read the article

  • Get the last '/' or '\\' character in Python

    - by wowus
    If I have a string that looks like either ./A/B/c.d OR .\A\B\c.d How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed. This problem kinda boils down to: How do I get the last of a specific character in a string? Basically, I want the path of a file without the file part of it.

    Read the article

  • adjustment of footer in website

    - by Mayur
    Hi All, I m web designer and getting problem in adjustment of footer. I need footer should be fixed at specific height and it will get down if content incresed otherwise it will be at same position please help me .... Thanks Mayur

    Read the article

  • Export symbol as png

    - by Etiennebr
    I'd like to export plotting symbols form R as a png graphic. But I haven't found a perfect way yet. Using png("symbol.png",width=20, height=20, bg="transparent") par(mar=c(0,0,0,0)) plot.new() symbols(1, 1, circles=0.3, bg=2, inches=FALSE, lwd=2, bty="n") dev.off() creates a little border around the symbol (I'd like it to be transparent) and the symbol isn't filling the whole space. Is there a more specific way of doing this ?

    Read the article

  • Is it against best practice to throw Exception on most JUnit tests?

    - by Chris Knight
    Almost all of my JUnit tests are written with the following signature: public void testSomething() throws Exception My reasoning is that I can focus on what I'm testing rather than exception handling which JUnit appears to give me for free. But am I missing anything by doing this? Is it against best practice? Would I gain anything by explicitly catching specific exceptions in my test and then fail()'ing on them?

    Read the article

  • Spring Batch validation

    - by sergionni
    Hello. Does Spring Batch framework provide its specific validation mechanism? I mean, how it's possible to specify validation bean? My validation is result of @NamedQuery - if query returned result, the validation is OK, else - false.

    Read the article

  • [Ruby on Rails] Data Structure

    - by siulamvictor
    I am building a online form, with about 20 multiple choice checkboxes. I can get the nested data with this command. raise params.to_yaml I need to store these data and call them again later. I want to sort out which user chose which specific checkbox, i.e. who chose checkbox no.2? What's the best way to store these data in database?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >