Search Results

Search found 85647 results on 3426 pages for 'file write'.

Page 333/3426 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

  • How to change icons of specific file types on Ubuntu 11.10?

    - by Curious Apprentice
    I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

    Read the article

  • Writing to an already existing file using FileWriter Java

    - by delo
    Is there anyway I can write to an already existing file using Filewriter For example when the user clicks a submit button: FileWriter writer = new FileWriter("myfile.csv"); writer.append("LastName"); writer.append(','); writer.append("FirstName"); writer.append('/n'); writer.append(LastNameTextField.getText()); writer.append(','); writer.append(FirstNameTextField.getText()); I want to be able to write new data into the already existing myfile.csv without having to recreate a brand new one every time

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • o write a C++ program to encrypt and decrypt certain codes.

    - by Amber
    Step 1: Write a function int GetText(char[],int); which fills a character array from a requested file. That is, the function should prompt the user to input the filename, and then read up to the number of characters given as the second argument, terminating when the number has been reached or when the end of file is encountered. The file should then be closed. The number of characters placed in the array is then returned as the value of the function. Every character in the file should be transferred to the array. Whitespace should not be removed. When testing, assume that no more than 5000 characters will be read. The function should be placed in a file called coding.cpp while the main will be in ass5.cpp. To enable the prototypes to be accessible, the file coding.h contains the prototypes for all the functions that are to be written in coding.cpp for this assignment. (You may write other functions. If they are called from any of the functions in coding.h, they must appear in coding.cpp where their prototypes should also appear. Do not alter coding.h. Any other functions written for this assignment should be placed, along with their prototypes, with the main function.) Step 2: Write a function int SimplifyText(char[],int); which simplifies the text in the first argument, an array containing the number of characters as given in the second argument, by converting all alphabetic characters to lower case, removing all non-alpha characters, and replacing multiple whitespace by one blank. Any leading whitespace at the beginning of the array should be removed completely. The resulting number of characters should be returned as the value of the function. Note that another array cannot appear in the function (as the file does not contain one). For example, if the array contained the 29 characters "The 39 Steps" by John Buchan (with the " appearing in the array), the simplified text would be the steps by john buchan of length 24. The array should not contain a null character at the end. Step 3: Using the file test.txt, test your program so far. You will need to write a function void PrintText(const char[],int,int); that prints out the contents of the array, whose length is the second argument, breaking the lines to exactly the number of characters in the third argument. Be warned that, if the array contains newlines (as it would when read from a file), lines will be broken earlier than the specified length. Step 4: Write a function void Caesar(const char[],int,char[],int); which takes the first argument array, with length given by the second argument and codes it into the third argument array, using the shift given in the fourth argument. The shift must be performed cyclicly and must also be able to handle negative shifts. Shifts exceeding 26 can be reduced by modulo arithmetic. (Is C++'s modulo operations on negative numbers a problem here?) Demonstrate that the test file, as simplified, can be coded and decoded using a given shift by listing the original input text, the simplified text (indicating the new length), the coded text and finally the decoded text. Step 5: The permutation cypher does not limit the character substitution to just a shift. In fact, each of the 26 characters is coded to one of the others in an arbitrary way. So, for example, a might become f, b become q, c become d, but a letter never remains the same. How the letters are rearranged can be specified using a seed to the random number generator. The code can then be decoded, if the decoder has the same random number generator and knows the seed. Write the function void Permute(const char[],int,char[],unsigned long); with the same first three arguments as Caesar above, with the fourth argument being the seed. The function will have to make up a permutation table as follows: To find what a is coded as, generate a random number from 1 to 25. Add that to a to get the coded letter. Mark that letter as used. For b, generate 1 to 24, then step that many letters after b, ignoring the used letter if encountered. For c, generate 1 to 23, ignoring a or b's codes if encountered. Wrap around at z. Here's an example, for only the 6 letters a, b, c, d, e, f. For the letter a, generate, from 1-5, a 2. Then a - c. c is marked as used. For the letter b, generate, from 1-4, a 3. So count 3 from b, skipping c (since it is marked as used) yielding the coding of b - f. Mark f as used. For c, generate, from 1-3, a 3. So count 3 from c, skipping f, giving a. Note the wrap at the last letter back to the first. And so on, yielding a - c b - f c - a d - b (it got a 2) e - d f - e Thus, for a given seed, a translation table is required. To decode a piece of text, we need the table generated to be re-arranged so that the right hand column is in order. In fact you can just store the table in the reverse way (e.g., if a gets encoded to c, put a opposite c is the table). Write a function called void DePermute(const char[],int,char[], unsigned long); to reverse the permutation cypher. Again, test your functions using the test file. At this point, any main program used to test these functions will not be required as part of the assignment. The remainder of the assignment uses some of these functions, and needs its own main function. When submitted, all the above functions will be tested by the marker's own main function. Step 6: If the seed number is unknown, decoding is difficult. Write a main program which: (i) reads in a piece of text using GetText; (ii) simplifies the text using SimplifyText; (iii) prints the text using PrintText; (iv) requests two letters to swap. If we think 'a' in the text should be 'q' we would type aq as input. The text would be modified by swapping the a's and q's, and the text reprinted. Repeat this last step until the user considers the text is decoded, when the input of the same letter twice (requesting a letter to be swapped with itself) terminates the program. Step 7: If we have a large enough sample of coded text, we can use knowledge of English to aid in finding the permutation. The first clue is in the frequency of occurrence of each letter. Write a function void LetterFreq(const char[],int,freq[]); which takes the piece of text given as the first two arguments (same as above) and returns in the 26 long array of structs (the third argument), the table of the frequency of the 26 letters. This frequency table should be in decreasing order of popularity. A simple Selection Sort will suffice. (This will be described in lectures.) When printed, this summary would look something like v x r s z j p t n c l h u o i b w d g e a q y k f m 168106 68 66 59 54 48 45 44 35 26 24 22 20 20 20 17 13 12 12 4 4 1 0 0 0 The formatting will require the use of input/output manipulators. See the header file for the definition of the struct called freq. Modify the program so that, before each swap is requested, the current frequency of the letters is printed. This does not require further calls to LetterFreq, however. You may use the traditional order of regular letter frequencies (E T A I O N S H R D L U) as a guide when deciding what characters to exchange. Step 8: The decoding process can be made more difficult if blank is also coded. That is, consider the alphabet to be 27 letters. Rewrite LetterFreq and your main program to handle blank as another character to code. In the above frequency order, space usually comes first.

    Read the article

  • Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

    - by JM4
    My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • Write a C++ program to encrypt and decrypt certain codes.

    - by Amber
    Step 1: Write a function int GetText(char[],int); which fills a character array from a requested file. That is, the function should prompt the user to input the filename, and then read up to the number of characters given as the second argument, terminating when the number has been reached or when the end of file is encountered. The file should then be closed. The number of characters placed in the array is then returned as the value of the function. Every character in the file should be transferred to the array. Whitespace should not be removed. When testing, assume that no more than 5000 characters will be read. The function should be placed in a file called coding.cpp while the main will be in ass5.cpp. To enable the prototypes to be accessible, the file coding.h contains the prototypes for all the functions that are to be written in coding.cpp for this assignment. (You may write other functions. If they are called from any of the functions in coding.h, they must appear in coding.cpp where their prototypes should also appear. Do not alter coding.h. Any other functions written for this assignment should be placed, along with their prototypes, with the main function.) Step 2: Write a function int SimplifyText(char[],int); which simplifies the text in the first argument, an array containing the number of characters as given in the second argument, by converting all alphabetic characters to lower case, removing all non-alpha characters, and replacing multiple whitespace by one blank. Any leading whitespace at the beginning of the array should be removed completely. The resulting number of characters should be returned as the value of the function. Note that another array cannot appear in the function (as the file does not contain one). For example, if the array contained the 29 characters "The 39 Steps" by John Buchan (with the " appearing in the array), the simplified text would be the steps by john buchan of length 24. The array should not contain a null character at the end. Step 3: Using the file test.txt, test your program so far. You will need to write a function void PrintText(const char[],int,int); that prints out the contents of the array, whose length is the second argument, breaking the lines to exactly the number of characters in the third argument. Be warned that, if the array contains newlines (as it would when read from a file), lines will be broken earlier than the specified length. Step 4: Write a function void Caesar(const char[],int,char[],int); which takes the first argument array, with length given by the second argument and codes it into the third argument array, using the shift given in the fourth argument. The shift must be performed cyclicly and must also be able to handle negative shifts. Shifts exceeding 26 can be reduced by modulo arithmetic. (Is C++'s modulo operations on negative numbers a problem here?) Demonstrate that the test file, as simplified, can be coded and decoded using a given shift by listing the original input text, the simplified text (indicating the new length), the coded text and finally the decoded text. Step 5: The permutation cypher does not limit the character substitution to just a shift. In fact, each of the 26 characters is coded to one of the others in an arbitrary way. So, for example, a might become f, b become q, c become d, but a letter never remains the same. How the letters are rearranged can be specified using a seed to the random number generator. The code can then be decoded, if the decoder has the same random number generator and knows the seed. Write the function void Permute(const char[],int,char[],unsigned long); with the same first three arguments as Caesar above, with the fourth argument being the seed. The function will have to make up a permutation table as follows: To find what a is coded as, generate a random number from 1 to 25. Add that to a to get the coded letter. Mark that letter as used. For b, generate 1 to 24, then step that many letters after b, ignoring the used letter if encountered. For c, generate 1 to 23, ignoring a or b's codes if encountered. Wrap around at z. Here's an example, for only the 6 letters a, b, c, d, e, f. For the letter a, generate, from 1-5, a 2. Then a - c. c is marked as used. For the letter b, generate, from 1-4, a 3. So count 3 from b, skipping c (since it is marked as used) yielding the coding of b - f. Mark f as used. For c, generate, from 1-3, a 3. So count 3 from c, skipping f, giving a. Note the wrap at the last letter back to the first. And so on, yielding a - c b - f c - a d - b (it got a 2) e - d f - e Thus, for a given seed, a translation table is required. To decode a piece of text, we need the table generated to be re-arranged so that the right hand column is in order. In fact you can just store the table in the reverse way (e.g., if a gets encoded to c, put a opposite c is the table). Write a function called void DePermute(const char[],int,char[], unsigned long); to reverse the permutation cypher. Again, test your functions using the test file. At this point, any main program used to test these functions will not be required as part of the assignment. The remainder of the assignment uses some of these functions, and needs its own main function. When submitted, all the above functions will be tested by the marker's own main function. Step 6: If the seed number is unknown, decoding is difficult. Write a main program which: (i) reads in a piece of text using GetText; (ii) simplifies the text using SimplifyText; (iii) prints the text using PrintText; (iv) requests two letters to swap. If we think 'a' in the text should be 'q' we would type aq as input. The text would be modified by swapping the a's and q's, and the text reprinted. Repeat this last step until the user considers the text is decoded, when the input of the same letter twice (requesting a letter to be swapped with itself) terminates the program. Step 7: If we have a large enough sample of coded text, we can use knowledge of English to aid in finding the permutation. The first clue is in the frequency of occurrence of each letter. Write a function void LetterFreq(const char[],int,freq[]); which takes the piece of text given as the first two arguments (same as above) and returns in the 26 long array of structs (the third argument), the table of the frequency of the 26 letters. This frequency table should be in decreasing order of popularity. A simple Selection Sort will suffice. (This will be described in lectures.) When printed, this summary would look something like v x r s z j p t n c l h u o i b w d g e a q y k f m 168106 68 66 59 54 48 45 44 35 26 24 22 20 20 20 17 13 12 12 4 4 1 0 0 0 The formatting will require the use of input/output manipulators. See the header file for the definition of the struct called freq. Modify the program so that, before each swap is requested, the current frequency of the letters is printed. This does not require further calls to LetterFreq, however. You may use the traditional order of regular letter frequencies (E T A I O N S H R D L U) as a guide when deciding what characters to exchange. Step 8: The decoding process can be made more difficult if blank is also coded. That is, consider the alphabet to be 27 letters. Rewrite LetterFreq and your main program to handle blank as another character to code. In the above frequency order, space usually comes first.

    Read the article

  • Is there a way to recover a file that I have deleted but is still open somewhere?

    - by George Edison
    This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Can I copy large files faster without using the file cache?

    - by Veazer
    After adding the preload package, my applications seem to speed up but if I copy a large file, the file cache grows by more than double the size of the file. By transferring a single 3-4 GB virtualbox image or video file to an external drive, this huge cache seems to remove all the preloaded applications from memory, leading to increased load times and general performance drops. Is there a way to copy large, multi-gigabyte files without caching them (i.e. bypassing the file cache)? Or a way to whitelist or blacklist specific folders from being cached?

    Read the article

  • Writing to the middle of the file (without overwriting data)

    - by Andreas Bonini
    In windows is it possible through an API to write to the middle of a file without overwriting any data and without having to rewrite everything after that? If it's possible then I believe it will obviously fragment the file; how many times can I do it before it becomes a serious problem? If it's not possible what approach/workaround is usually taken? Re-writing everything after the insertion point becomes prohibitive really quickly with big (ie, gigabytes) files. Note: I can't avoid having to write to the middle. Think of the application as a text editor for huge files where the user types stuff and then saves. I also can't split the files in several smaller ones.

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • could not save the file /usr/... permission denied (13.04)

    - by plaguedoctor
    I am running Ubuntu 13.04 and am trying to create an .sh file for conky in /usr/bin using gedit. When trying to save I get the error dialogue: Could not save the file /usr/bin/conky-start.sh You do not have the permissions necessary to save the file. Please check that you typed the location correctly and try again." From searching, I think I have to run a command in terminal to allow permission, but I couldn't find out what that is. Edit: I'm trying to create the file conky-start.sh, not change or run it. Thus far, I've opened gedit, copied and pasted some required info from the net, and I'm trying to save-as /usr/bin/conky-start.sh Perhaps I need to create the file first in terminal, then edit it? How would I do that?

    Read the article

  • Haskell: writing the result of a computation to file

    - by peterwkc
    I have a function which creates a tuple after computation, but I would like to write it to file. I know how to write to a file using writeFile, but do not know how to combine the computation and monads IO together in the type signature. This is my code. invest :: ([Char]->Int->Int->([Char], Int) ) -> [Char]->Int->Int->([Char], Int) invest myinvest x y = myinvest x y myinvest :: [Char]->Int->Int->([Char], Int) myinvest w x y | y > 0 = (w, x + y) | otherwise = error "Invest amount must greater than zero" where I have a function which computes the maximum value from a list, but I want this function to receive input from a file, and then perform the computation of maximum value. maximuminvest :: (Ord a) => [a] -> a maximuminvest [] = error "Empty Invest Amount List" maximuminvest [x] = x maximuminvest (x:xs) | x > maxTail = x | otherwise = maxTail where maxTail = maximuminvest xs Please help. Thanks.

    Read the article

  • Save file in a different location in iPhone App

    - by zp26
    Hi, I have a problem. My proget create a xml file. In the iPhone this file was store in the NSDocumentDirectory. I wanna save this file in another directory like Desktop(where there are the apps) or another visible folder. Thanks. This is my code: -(void)saveInXML:(NSString*)name:(float)x:(float)y:(float)z{ //NSDocumentDirectory put the file in the app directory NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectoryPath = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectoryPath stringByAppendingPathComponent:@"filePosizioni.xml"]; NSFileHandle *myHandle; NSFileManager *fileManager = [NSFileManager defaultManager]; NSString *titoloXML = [NSString stringWithFormat:@"File Xml delle posizioni del iPhone"]; NSString *inizioTag = [NSString stringWithFormat:@"\n\n\n<posizione>"]; NSString *tagName = [NSString stringWithFormat:@"\n <name>%@</name>", name]; NSString *tagX = [NSString stringWithFormat:@"\n <x>%f</x>", x]; NSString *tagY = [NSString stringWithFormat:@"\n <y>%f</y>", y]; NSString *tagZ = [NSString stringWithFormat:@"\n <z>%f</z>", z]; NSString *fineTag= [NSString stringWithFormat:@"\n</posizione>"]; NSData* dataTitoloXML = [titoloXML dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataInizioTag = [inizioTag dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataName = [tagName dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataX = [tagX dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataY = [tagY dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataZ = [tagZ dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataFineTag = [fineTag dataUsingEncoding: NSASCIIStringEncoding]; if(![fileManager fileExistsAtPath:filePath]) [fileManager createFileAtPath:filePath contents:dataTitoloXML attributes:nil]; myHandle = [NSFileHandle fileHandleForUpdatingAtPath:filePath]; [myHandle seekToEndOfFile]; [myHandle writeData:dataInizioTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataName]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataX]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataY]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataZ]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataFineTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; NSLog(@"zp26 %@",filePath); }

    Read the article

  • How can I make a web browser view my .h file as text?

    - by drewbenn
    I want to post a .h file from a project I'm working on. I set a simple href link to it, like: <p>Click here to download the <a href=project_strings.h>strings file</a>. When I click on it, though, my web browser (Iceweasel 12) gives me a prompt to download the file, instead of just displaying it: Is there any magic I can add to the web page, or as a header to the file (that will still allow it to be included by a .c compiled with gcc), to get the .h file to be displayed in the web browser?

    Read the article

  • Scala importing a file in all files of a package

    - by Core_Dumped
    I need to use an implicit ordering that has been defined in an object in a file abc in the following way: object abc{ implicit def localTimeOrdering: Ordering[LocalDate] = Ordering.fromLessThan(_.isBefore(_)) } So, I make a package object xyz inside a file 'package.scala' that in turn is in the package 'xyz' that has files in which I need the implicit ordering to be applicable. I write something like this: package object xyz{ import abc._ } It does not seem to work. If I manually write the implicit definition statement inside the package object, it works perfectly. What is the correct way to import the object (abc) such that all of its objects/classes/definitions can be used in my entire package 'xyz' ?

    Read the article

  • sharpziplib - can you add a file without it copying the entire zip first?

    - by schmoopy
    Im trying to add an existing file to a .zip file using sharpziplib - problem is, the zip file is 1GB in size. When i try to add 1 small file (400k) sharpziplib creates a copy/temp of the orig zip file before adding the new file - this poses a problem when the amount of free disk space is less than 2x the zip file you are trying to update. for example: 1GB zip myfile.zip 1GB zip myfile.zip.tmp.293 ZipFile zf = new ZipFile(path); zf.BeginUpdate(); zf.Add(file); // Adding a 400k file here causes a 1GB temp file to be created zf.EndUpdate(); zf.Close(); Is there a more efficient way to do this? Thanks :-)

    Read the article

  • How to check whether a excel file is write protected or not in C#?

    - by Pavan Navali
    Hi, I'm developing a sample application in which I have to open an excel file and check whether the file is write protercteed or not. The code is using System.Windows.Forms; using Microsoft.Office.Core; private void button1_Click(object sender, EventArgs e) { string fileNameAndPath = @"D:\Sample\Sample1.xls"; // the above excel file is a write protected. Microsoft.Office.Interop.Excel.Application a = new Microsoft.Office.Interop.Excel.Application(); if (System.IO.File.Exists(fileNameAndPath)) { Microsoft.Office.Interop.Excel.ApplicationClass app = new Microsoft.Office.Interop.Excel.ApplicationClass(); // create the workbook object by opening the excel file. app.Workbooks.Open(fileNameAndPath,0,false,5,"","",true,Microsoft.Office.Interop.Excel.XlPlatform.xlWindows,"\t",false, true, 0,false,true,0); Microsoft.Office.Interop.Excel._Workbook w = app.Workbooks.Application.ActiveWorkbook; if (w.ReadOnly) MessageBox.Show("HI"); // the above condition is true. } } I would like know whether the file is write protected or not.

    Read the article

  • Creating and Saving an Excel File

    - by Kris
    I have the following code that creates a new Excel file in my C# code behind. When I attempt to save the file I would like the user to select the location of the save. In Method #1, I can save the file my using the workbook SaveCopyAs without prompting the user for a location. This saves one file to the C:\Temp directory. Method #2 will save the file in my Users\Documents folder, then prompt the user to select the location and save a second copy. How can I eliminate the first copy from saving in the Users\Documents folder? Excel.Application oXL; Excel._Workbook oWB; Excel._Worksheet oSheet; Excel.Range oRng; try { //Start Excel and get Application object. oXL = new Excel.Application(); oXL.Visible = false; //Get a new workbook. oWB = (Excel._Workbook)(oXL.Workbooks.Add(Missing.Value)); oSheet = (Excel._Worksheet)oWB.ActiveSheet; // ***** oSheet.Cells[2, 6] = "Ship To:"; oSheet.get_Range("F2", "F2").Font.Bold = true; oSheet.Cells[2, 7] = sShipToName; oSheet.Cells[3, 7] = sAddress; oSheet.Cells[4, 7] = sCityStateZip; oSheet.Cells[5, 7] = sContactName; oSheet.Cells[6, 7] = sContactPhone; oSheet.Cells[9, 1] = "Shipment No:"; oSheet.get_Range("A9", "A9").Font.Bold = true; oSheet.Cells[9, 2] = sJobNumber; oSheet.Cells[9, 6] = "Courier:"; oSheet.get_Range("F9", "F9").Font.Bold = true; oSheet.Cells[9, 7] = sCarrierName; oSheet.Cells[11, 1] = "Requested Delivery Date:"; oSheet.get_Range("A11", "A11").Font.Bold = true; oSheet.Cells[11, 2] = sRequestDeliveryDate; oSheet.Cells[11, 6] = "Courier Acct No:"; oSheet.get_Range("F11", "F11").Font.Bold = true; oSheet.Cells[11, 7] = sCarrierAcctNum; // ***** Method #1 //oWB.SaveCopyAs(@"C:\Temp\" + sJobNumber +".xls"); Method #2 oXL.SaveWorkspace(sJobNumber + ".xls"); } catch (Exception theException) { String errorMessage; errorMessage = "Error: "; errorMessage = String.Concat(errorMessage, theException.Message); errorMessage = String.Concat(errorMessage, " Line: "); errorMessage = String.Concat(errorMessage, theException.Source); }

    Read the article

  • How to write multiple files from one NSData object?

    - by Kevin Cupp
    Hi there! I'm writing an iPhone app that includes in-app purchasing. It downloads a zip file, then I unzip the file using the popular NSData category (zlibDeflate) which outputs the uncompressed file into an NSData object. The zip file contains multiple files in it which I need to write to the Documents directory. How can I write each file separately from this one NSData object? writeToFile just writes the whole thing to one file. Thank you and let me know if you need any more information.

    Read the article

  • How can I delete a file in Sinatra after it has been sent via send_file?

    - by John Reilly
    I have a simple sinatra application that needs to generate a file (via an external process), send that file to the browser, and finally, delete the file from the filesystem. Something along these lines: class MyApp < Sinatra::Base get '/generate-file' do # calls out to an external process, # and returns the path to the generated file file_path = generate_the_file() # send the file to the browser send_file(file_path) # remove the generated file, so we don't # completely fill up the filesystem. File.delete(file_path) # File.delete is never called. end end It seems, however, that the send_file call completes the request, and any code after it does not get run. Is there some way to ensure that the generated file is cleaned up after it has been successfully sent to the browser? Or will I need to resort to a cron job running a cleanup script on some interval?

    Read the article

  • Access .ldb file & multiple connection.

    - by bMathew
    I have an API which opens an access database for read and write. The API opens the connection when it's constructed and closes the connection when it's destructed. When the db is opened an .ldb file is created and when it closes it's removed (or disappears). There are multiple applications using the API to read and write to the access db. I want to know: Is ldb file used to track multiple connections Does calling an db.close() closes all connections or just one instance. Will there be any sync issues with the above approach.

    Read the article

  • How can I do individual file encryption on Dropbox?

    - by Scaine
    I'd like to set a single directory inside Dropbox in which files are encrypted on a file-by-file basis. At the moment, I use a 2Mb Truecrypt container inside my Dropbox which I then have to mount manually, access/change the files within, then unmount manually. At that point, the entire 2Mb uploads to Dropbox. This is a pain for a number of reasons : Dropbox sync will only occur when the Truecrypt container is unmounted, because Dropbox only syncs files that aren't locked and mounting a container locks it. A single byte change to one file inside that container results in the whole 2Mb being uploaded again. It doesn't scale - I was originally using a 10Mb container, but obviously the bigger the container, the longer it takes to sync when it's unmounted. I was wondering if I can somehow use LUKS to implement file-by-file encryption to get round the "container" issues.

    Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >