Search Results

Search found 30258 results on 1211 pages for 'open ended'.

Page 336/1211 | < Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >

  • which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

    - by ijjo
    i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • regex search a mysql text column

    - by Ian
    Okay, I thought my head hurt with regular regex, but I can't seem to find what I'm looking for with regexp in mysql. I'm trying to look for situations in news articles where a Textile-formatted url has not ended with a slash so: "Catherine Zeta-Jones":/cr/catherinezeta-jones/ visited stack overflow is ok but "Catherine Zeta-Jones":/cr/catherinezeta-jones visited stack overflow is not. [just used Catherine as an example because I'm assuming an alpha search wouldn't catch the hyphen] One of these days I'll have to do that goat sacrifice so I can gain the proper knowledge of regex. Thanks everyone!

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • Why isn't my assets folder being installed on emulator?

    - by Brad Hein
    Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • MKMapView within UITableView

    - by john-london
    I have a MKMapView within a UITableviewCell and I want to be able to disable scrolling of the table view when the user starts to drag within the map view. My plan had been to override the MKMapView touchesBegan/Moved etc methods and if they were called to then disable scrolling in the parent view. Scrolling in the parent view would be enabled again only when the touches in the MKMapView ended or were cancelled. My problem is that the touchesBegan/Moved methods inside MKMapView are not called - the problem is also discussed here: stackoverflow discussion. My table view is within a tab control, so I don't think I can extend UIWindow the way they describe, as there are several views that could be within the window, depending on which tab is active. How can I access the MKMapView touch events please?

    Read the article

  • Python urllib.urlopen IOError

    - by Michael
    So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

    Read the article

  • iphone - button outside MPMoviePlayerController window not responding

    - by Mike
    I have created a MPMoviePlayerController to play a movie. As the movie likes to play landscape in full screen, when the movie is about to play, I grab its window and resize it to be smaller. At the same time, I add a view to the movie's window and this view contains several buttons, that are supposed to be around the movie. As the movie's window is reduced in size, I have to scale the buttons' view up, so the buttons do not reduce in size. I ended with this What you can see here is this: four buttons (green rectangles), the reduced movie's window and the application's window, that now is visible because the movie's window was reduced. The problem is that the buttons just work if you click on their regions inside the movie's window (A). If you click them on the region outside (B) they don't work. WHen you click on B, TouchesMoved on the main view controller receives the touch and the button doesn't do its action. How can this be solved? thanks for any help

    Read the article

  • nested for loop

    - by Gary
    Hello, Just learning Python and trying to do a nested for loop. What I'd like to do in the end is place a bunch of email addresses in a file and have this script find the info, like the sending IP of mail ID. For now i'm testing it on my /var/log/auth.log file Here is my code so far: #!/usr/bin/python # this section puts emails from file(SpamEmail) in to a array(array) in_file = open("testFile", "r") array = in_file.readlines() in_file.close() # this section opens and reads the target file, in this case 'auth.log' log = open("/var/log/auth.log", "r") auth = log.readlines() for email in array: print "Searching for " +email, for line in auth: if line.find(email) > -1: about = line.split() print about[0], print Inside 'testfile' I have the word 'disconnect' cause I know it's in the auth.log file. It just doesn't find the word 'disconnect'. In the line of "if line.find(email) -1:" i can replace email and put "disconnect" the scripts finds it fine. Any idea? Thanks in advance. Gary

    Read the article

  • How to check if a generic type definition inherits from another generic type definition

    - by Anne
    I'm trying to check whether an open generic type definition implements some open generic interface. Look at the sample below: public interface IService<T> { } public class ServiceImpl<T> : IService<T> { } private static bool OpenGenericTypeImplementsOpenGenericInterface( Type derivedType, Type interfaceType) { return derivedType.GetInterfaces().Contains(interfaceType); } [TestMethod] public void Verify() { Type openGenericImplementation = typeof(ServiceImpl<>); Type expectedInterfaceType = typeof(IService<>); bool implDoesImplementInterface = OpenGenericTypeImplementsOpenGenericInterface( openGenericImplementation, expectedInterfaceType); // This assert fails. Why? Assert.IsTrue(implDoesImplementInterface); } I found out that the returned type from the Type.GetInterfaces() method does not match the type returned from typeof(IService<>). I can't figure out why that is and how to correctly validate whether some generic type definition inherits or implements some other generic type definition. What's going on here and how do I solve fix this problem?

    Read the article

  • Getting "Object is read only" error when setting ClientCredentials in WCF

    - by Paul Mrozowski
    I have a proxy object generated by Visual Studio (client side) named ServerClient. I am attempting to set ClientCredentials.UserName.UserName/Password before opening up a new connection using this code: InstanceContext context = new InstanceContext(this); m_client = new ServerClient(context); m_client.ClientCredentials.UserName.UserName = "Sample"; As soon as the code hits the UserName line it fails with an "Object is read-only" error. I know this can happen if the connection is already open or faulted, but at this point I haven't called context.Open() yet. I have configured the Bindings (which uses netTcpBinding) to use Message as it's security mode, and MessageClientCredentialType is set to UserName. Any ideas?

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • How do you fix an SVN 409 Conflict Error

    - by NerdStarGamer
    I used to use SVN 1.4 on OS X Leopard and everything was fine. A couple of weeks ago I installed a fresh copy of OS X 10.6. The version of SVN that comes with Snow Leopard is 1.6.5. I went ahead and built my own copy with 1.6.6. I'm using the built in apache server and just hosting repositories locally. Everything appeared to work fine until I actually tried to commit something. Everytime I try to commit a change, I get the following message: Transmitting file data .svn: Commit failed (details follow): svn: MERGE of '/svn/svn2': 409 Conflict (http://localhost) This happens with my old repositories, so I created a couple of new ones. Same deal. I also tried using the 1.6.5 version that comes with the system...same. Finally, I tried upgrading to the latest stable SVN (1.6.9) and still got the same problem. The Apache error logs the following for each failed commit: [Mon Mar 29 19:53:10 2010] [error] [client ::1] Could not MERGE resource "/svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1" into "/svn/svn2". [409, #0] [Mon Mar 29 19:53:10 2010] [error] [client ::1] An error occurred while committing the transaction. [409, #2] [Mon Mar 29 19:53:10 2010] [error] [client ::1] Can't open directory '/usr/local/svn/svn2/db/transactions/5-6.txn/\xeb\xa9\x0f\x1f': No such file or directory [409, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Could not DELETE /svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1. [500, #0] [Mon Mar 29 19:53:11 2010] [error] [client ::1] could not open transaction. [500, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Can't open file '/usr/local/svn/svn2/db/transactions/5-6.txn/props': No such file or directory [500, #2] And from the access log: ::1 - - [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 401 401 ::1 - user [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 200 188 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/vcc/default HTTP/1.1" 207 398 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/bln/6 HTTP/1.1" 207 449 ::1 - user [30/Mar/2010:13:02:20 -0400] "REPORT /svn/svn2/!svn/vcc/default HTTP/1.1" 200 1172 Curiously, the commit does actually commit the changes, but the working copy doesn't see that and everything gets screwy. I've tried to Google every variation I can think of for this problem, but the search results are pretty much useless. I'm not using TortoiseSVN or anything special and commits fail on a new repository, so I know it's not a problem with my old repos. Any help would be greatly appreciated.

    Read the article

  • NETWORK_ERROR: XMLHttpRequest Exception 101

    - by pawan Mangal
    I am getting this Error NETWORK_ERROR: XMLHttpRequest Exception 101 when trying to get XML content from one site. Here is my code var xmlhttp; if(window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } if (xmlhttp==null) { alert ("Your browser does not support XMLHTTP!"); return; } xmlhttp.onReadyStateChange=function() { if(xmlhttp.readyState==4) { var value =xmlhttp.responseXML; alert(value); } } xmlhttp.open("GET",url,false); xmlhttp.send(); //alert(xmlhttp.responseXML); } xmlhttp.open("GET",url,false); xmlhttp.send(null); Does any one have a solution?

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • Installing fonts

    - by Lazar
    I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

  • Windows Service Hosting WCF Objects over SSL (https) - Custom JSON Error Handling Doesn't Work

    - by bpatrick100
    I will first show the code that works in a non-ssl (http) environment. This code uses a custom json error handler, and all errors thrown, do get bubbled up to the client javascript (ajax). // Create webservice endpoint WebHttpBinding binding = new WebHttpBinding(); ServiceEndpoint serviceEndPoint = new ServiceEndpoint(ContractDescription.GetContract(Type.GetType(svcHost.serviceContract + ", " + svcHost.assemblyName)), binding, new EndpointAddress(svcHost.hostUrl)); // Add exception handler serviceEndPoint.Behaviors.Add(new FaultingWebHttpBehavior()); // Create host and add webservice endpoint WebServiceHost webServiceHost = new WebServiceHost(svcHost.obj, new Uri(svcHost.hostUrl)); webServiceHost.Description.Endpoints.Add(serviceEndPoint); webServiceHost.Open(); I'll also show you what the FaultingWebHttpBehavior class looks like: public class FaultingWebHttpBehavior : WebHttpBehavior { public FaultingWebHttpBehavior() { } protected override void AddServerErrorHandlers(ServiceEndpoint endpoint, EndpointDispatcher endpointDispatcher) { endpointDispatcher.ChannelDispatcher.ErrorHandlers.Clear(); endpointDispatcher.ChannelDispatcher.ErrorHandlers.Add(new ErrorHandler()); } public class ErrorHandler : IErrorHandler { public bool HandleError(Exception error) { return true; } public void ProvideFault(Exception error, MessageVersion version, ref Message fault) { // Build an object to return a json serialized exception GeneralFault generalFault = new GeneralFault(); generalFault.BaseType = "Exception"; generalFault.Type = error.GetType().ToString(); generalFault.Message = error.Message; // Create the fault object to return to the client fault = Message.CreateMessage(version, "", generalFault, new DataContractJsonSerializer(typeof(GeneralFault))); WebBodyFormatMessageProperty wbf = new WebBodyFormatMessageProperty(WebContentFormat.Json); fault.Properties.Add(WebBodyFormatMessageProperty.Name, wbf); } } } [DataContract] public class GeneralFault { [DataMember] public string BaseType; [DataMember] public string Type; [DataMember] public string Message; } The AddServerErrorHandlers() method gets called automatically, once webServiceHost.Open() gets called. This sets up the custom json error handler, and life is good :-) The problem comes, when we switch to and SSL (https) environment. I'll now show you endpoint creation code for SSL: // Create webservice endpoint WebHttpBinding binding = new WebHttpBinding(); ServiceEndpoint serviceEndPoint = new ServiceEndpoint(ContractDescription.GetContract(Type.GetType(svcHost.serviceContract + ", " + svcHost.assemblyName)), binding, new EndpointAddress(svcHost.hostUrl)); // This exception handler code below (FaultingWebHttpBehavior) doesn't work with SSL communication for some reason, need to resarch... // Add exception handler serviceEndPoint.Behaviors.Add(new FaultingWebHttpBehavior()); //Add Https Endpoint WebServiceHost webServiceHost = new WebServiceHost(svcHost.obj, new Uri(svcHost.hostUrl)); binding.Security.Mode = WebHttpSecurityMode.Transport; binding.Security.Transport.ClientCredentialType = HttpClientCredentialType.None; webServiceHost.AddServiceEndpoint(svcHost.serviceContract, binding, string.Empty); Now, with this SSL endpoint code, the service starts up correctly, and wcf hosted objects can be communicated with just fine via client javascript. However, the custom error handler doesn't work. The reason is, the AddServerErrorHandlers() method never gets called when webServiceHost.Open() is run. So, can anyone tell me what is wrong with this picture? And why, is AddServerErrorHandlers() not getting called automatically, like it does when I'm using non-ssl endpoints? Thanks!

    Read the article

< Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >